Development of Triplex SYBR Green RealTime PCR for Detecting ...

Jpn. J. Infect. Dis., 63, 173180, 2010

Original Article

Development of Triplex SYBR Green RealTime PCR for Detecting Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp. without Extraction of DNA Anusak Kerdsin, Ryuichi Uchida1*, Chris Verathamjamrus2, Parichart Puangpatra2, Kazuyoshi Kawakami3, Pollert Puntanakul4, Sorasak Lochindarat5, Thanyanut Bunnag5, Pathom Sawanpanyalert, Surang Dejsirilert, and Kazunori Oishi6 National Institute of Health, Department of Medical Sciences, Ministry of Public Health, Nonthaburi; 2ThailandJapan Research Collaboration Center for Emerging and Reemerging Infections, National Institute of Health, Department of Medical Sciences, Ministry of Public Health, Nonthaburi; 4Bangkok Metropolitan Administration Medical College and Vajira Hospital, Bangkok; 5Queen Sirikit National Institute of Child Health, Bangkok, Thailand; 1ThailandJapan Research Collaboration Center for Emerging and Reemerging Infections, Research Institute for Microbial Diseases, Osaka University, Osaka 5650871; 3Department of Medical Microbiology, Mycology and Immunology, Tohoku University Graduate School of Medicine, Miyagi 9808575; 6International Research Center for Infectious Diseases, Research Institute for Microbial Diseases, Osaka University, Osaka 5650871, Japan (Received November 13, 2009. Accepted April 15, 2010) SUMMARY: Although Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp. are prevalent causes of communityacquired pneumonia, rapid and sensitive diagnosis is difficult. Real time PCR provides rapid and sensitive diagnosis, however, DNA extraction is still required, which is timeconsuming, costly and includes a risk of contamination. Therefore, we aimed to develop triplex realtime PCR without DNA extraction. AmpDirect} Plus which inhibits PCR inhibitors was used as the PCR buffer. Melting temperatures of the PCR products for the three bacteria were analyzed by SYBR green triplex realtime PCR and were found to be significantly different. Detection limits of bacteria cells diluted in nasopharyngeal aspirates (NPAs) were comparable with the detection limits of previously reported realtime PCR. Our PCR without DNA extraction and probe realtime PCR with DNA extraction showed identical results for the detection of the three bacteria from 38 respiratory specimens (sputum, endotracheal aspirates, and NPAs) collected from patients with pneumonia. No crossreaction with other bacteria was observed. Our triplex realtime PCR successfully detected and differentiated the three bacteria. Although further field tests are required, our assay is a promising method for the rapid and costeffective detection of the three bacteria. of legionella infection is thought to be underestimated (2,3). Although culture and serological tests are stand ard methods for the diagnosis of these bacterial infec tions, these are exorbitantly timeconsuming for the management of acute illness, and their detection rates are insufficient. Although PCR offers a better approach for rapid and sensitive detection of microorganisms, conventional PCR usually consists of three steps: DNA extraction, PCR amplification, and postPCR analysis, including gel electrophoresis, hybridization or sequencing. Real time PCR is an attractive technique since the method does not require postPCR analysis and has an excellent detection limit (2,4,5). However, realtime PCR still re quires a DNA extraction step, which is especially time and costconsuming and includes a risk of contamina tion. Eliminating this step will reduce analysis time, cost, and risk of contamination. In direct PCR, the use of clinical specimens that usu ally contain endogenous PCRinhibitory substances is a major problem. AmpDirect} (Shimadzu, Kyoto, Ja pan) is a novel reagent for conventional PCR that has

INTRODUCTION Communityacquired pneumonia (CAP) is the most frequent cause of medical consultation at acute care hospitals as well as for general practitioners. Up to now the most frequent etiologic bacteria has been Strep tococcus pneumoniae. However, owing to improvement in diagnostic techniques, Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella pneumo phila have now been recognized as frequent causes of respiratory tract infections (1). In some reports, M. pneumoniae and C. pneumoniae accounted for one third of the cases of CAP in children, with occasional dual infections (1,2). In addition, many Legionella spp. have been shown to cause pneumonia, and the incidence *Corresponding author: Present address: National Hospital Organization Nagasaki Kawatana Medical Center, 20051, Shimogumigou, Kawatanacho, Higashisonogigun, Nagasaki 8593615, Japan. Tel: {81956823121, Fax: {81956833710, Email: ryuryu1_uyahoo.co.jp 173

been shown to suppress the effect of PCR inhibitors in blood and feces (6,7). However, it has not been con firmed whether or not this reagent works in realtime PCR assay or for respiratory specimens. Although a SYBR green realtime PCR assay is highly sensitive and low in cost, it nonspecifically binds to amplified doublestranded DNA and has only one color. There fore, reliable differentiation of the three organisms by melting temperature (Tm) analysis of the PCR products is necessary for triplex SYBR green realtime PCR. In this study, applying AmpDirect} PLUS (Shimadzu) to respiratory specimens, we developed a triplex SYBR green realtime PCR without extraction of DNA for the detection and differentiation of the three respiratory pathogens, i.e. M. pneumoniae, C. pneumoniae, and Legionella spp., by using Tm analysis of the PCR products.

MATERIALS AND METHODS Bacterial strains: A total of 159 bacterial strains from 114 species of bacteria were used in this study (Table 1). Seven reference strains of C. pneumoniae (AR39, AR388, KKpn15, KKpn16, KKpn17, YK41, and CpnTh1), three strains of M. pneumoniae (M129, FH, and CU), each strain of L. pneumophila serogroup 1 (ATCC331559) to 15, two strains each of L. long beachae, L. micdadei, L. jordanis, L. bozemanii, L. feelei, and individual strains of another 12 species of Legionella spp., were used for the crossreaction test and Tm value analysis. When DNA extraction was re quired, it was done using a NucleoSpin} Tissue Kit (MachereyNagel, Duren, Germany) according to the manufacturer's instructions. Primer design: Primers were designed based on the

Table 1. Bacterial strains used in the triplex SYBR green realtime PCR Genus Achromobacter Acinetobacter Alcaligenes Bacillus Bacteroides Bordetella Burkholderia Brucella Brevundimonas Chlamydia Chlamydophila Cupriavidus Clostridium Delftia Enterobacter Enterococcus Escherichia Haemophilus Klebsiella Legionella

Moraxella Mycobacterium Mycoplasma Neisseria Pandoraea Pasteurella Pseudomonas Ralstonia Salmonella Serratia Shewanella Shigella Staphylococcus Stenotrophomonas Streptococcus Ureaplasma Vibrio

Species (no. of strains) xylosoxidans (2) calcoaceticus (1), baumannii (1), haemolyticus (1), junii (1), parvus (1), ursingii (1), johnsonii (1), lwoffii (1), genospecies 3 (1) faecalis (1) cereus (1), mycoides (1), thuringiensis (1), anthracis (1), coagulans (1), popilliae (1), pumilus (1), polymyxa (1) fragilis (1) pertussis (1), bronchiseptica (1) cepacia (1), cenocepacia (1), stabilis (1), vietnamiensis (1), gladioli (1), pseudomallei (1), mallei (1), oklahomensis (1), ubonensis (1), multivorans (1) melitensis (1) vesicularis (1), diminuta (1) trachomatis (1), psittaci (1) pneumoniae (7) pauculus (1) butyricum (1), botulinum (2), sporogenes (1) acidovorans (1) cloacae (1), sakazakii (1), agglomerans (1) faecalis (1) coli (2) influenzae (2), parainfluenzae (1), segnis (1) pneumoniae (1) pneumophila serogroup 115 (15), longbeachae (2), micdadei (2), dumoffii (1), jordanis (2), bozemanii (2), feelei (2), cherrii (1), anisa (1), parisiensis (1), birminghamensis (1), gormanii (1), israelensis (1), sainthelensis (1), jamestowniensis (1), hackeliae (1), maceachernii (1), oakridgensis (1) catarrhalis (4), atlantae (1), urethralis (1), phenylpyruvica (1), osloensis (1) avium (1) pneumoniae (3), hominis (2), salivarium (2), genitalium (1) meningitidis (6) norimbergensis (1) multocida (1), avium (1) aeruginosa (2), putida (1), fluorescens (1) pickettii (1) enteritidis (1), typhi (1) marcescens (1) putrefaciens (1) dysenteriae (1), flexneri (1) aureus (2) maltophilia (2) pneumoniae (3), oralis (1), salivarius (1), rattus (1), mutans (1), mitis (1), canis (1), dysagalactiae (1), pyogenes (1), porcinus (1), suis (1), sanguinis (1), constellatus (1), anginosus (1) urealyticum (1), parvum (1) parahaemolyticus (1), cholerae (1)

174

Table 2. Primers used in this study Bacteria

Primer name

Primer sequence (5?3?)

Target gene

Product size (bp)

C. pneumoniae

CpnRTF CpnRTR

AGGGCTATAAAGGCGTTGCT CATGATAATTGATGGTCGCAGACT

ompA

90

M. pneumoniae

MpnRTF MpnRTR

TCAATCTGGCGTGGATCTCT CACCACATCATTCCCCGTATTA

P1

136

Legionella spp.

LEGRTF LEGRTR

AAGATTAGCCTGCGTCCGATTAGC AACCTATCAACCCTCCTCCCCACT

16S rRNA

241

Triplex SYBR green realtime PCR using reference strains: A triplex realtime PCR was performed in a sin gle reaction for the three bacteria. The templates were classified into four types as follows: (A) DNA extracted from the three bacteria diluted with (i) nucleasefree water or (ii) the NPA from healthy children; and, (B) whole cells of each of the three bacteria without DNA extraction diluted either with (i) nucleasefree water or (ii) the NPA. A total of 25 ml of reaction mixture con sisted of 1~ AmpDirect} PLUS, 1~ SYBR green dye I (Invitrogen, Carlsbad, Calif., USA), 0.2 mM for each primer (Table 2), 1 unit of NovaTaqTM Hot Start DNA polymerase (Novagen, San Diego, Calif., USA), and 2 ml of template. The reaction mixture was applied to 7500 Fast Realtime PCR System (Applied Biosystems). The thermal profile of realtime PCR proceeded as follows: an initial activation of DNA polymerase at 959 C for 7 min, followed by 45 rounds of denaturation at 959 C for 15 s and primer annealing and extension at 659 C for 25 s, followed by the dissociation program for measuring the Tm of PCR products. Samples yielding enough of an amplification signal to determine a cycle threshold (CT value) and a single peak of Tm specific for their am plified product were classified as positive for realtime PCR. For C. pneumoniae AR39, M. pneumoniae M129, and L. pneumophila serogroup 1 ATCC331559, Tm values were determined in the realtime PCR reactions by using the templates which were classified into four types of templates; (A) the extracted DNA of the bacte ria diluted (i) with nucleasefree water, or (ii) with the NPA from healthy children, (B) the bacterial cells without DNA extraction diluted (i) with nucleasefree water, or (ii) with the NPA. The number of the PCR reaction (n) by using the four types of templates, Ai, A ii, Bi, and Bii, were as follows, respectively. C. pneumoniae AR39 (n 4, 3, 3, 3), M. pneumoniae M129 (n 7, 3, 3, 3), L. pneumophila serogroup 1 ATCC331559 (n 1, 3, 3, 3). For other bacterial strains, the reactions were performed using a single type of template, (Ai) extracted DNA in water. The num bers of the reactions (n) for the other strains were as fol lows. C. pneumoniae AR388 (n 3), KKpn15 (n 3), KKpn16 (n 3), KKpn17 (n 3), YK41 (n 3), CpnTh1 (n 9), M. pneumoniae FH (n 3), CU (n 5), and Legionella spp. (n 1, for each of all strains, n 37, in total). For all four types of templates, the number of replicates were as follows: C. pneumoniae (n 37), M. pneumoniae (n 24), and Legionella spp. (n 46). Application of triplex realtime PCR without DNA

specific and consensus regionsP1 for M. pneumoniae, ompA for C. pneumoniae, and 16S rRNA for Legionel la spp. (Table 2)using the nucleotide sequences of M. pneumoniae M129 (GenBank accession no. FJ603706), C. pneumoniae koala (X72023), L. pneumophila sero group 1 Corby (CP000675) by Primer Express Software version 3.0 (Applied Biosystems, Foster City, Calif., USA) and Fast PCR (http://www.primerdigital.com/ index.php). The nucleotide sequences of the PCR products were highly conserved and specific for each target bacteria, suggesting suitability for differentiation of the bacteria by the Tm analysis of the PCR products. The identity of the nucleotide sequences of the PCR products was 100z for the 10 strains of M. pneumo niae, M129 (FJ603706), FH (FJ215693), 1136 (FJ215694), 684 (GQ861493), 2p (FJ215695), 549 (GQ861495), Mp22 (FJ603760), Mp1842 (FJ603871), Mac (FJ603725), and Mp3896 (EF656612), 100z for the eight strains of C. pneumoniae koala (X72023), koa la type I (M73038), unnamed (M69230), CpnC (AY426607), IOL207 (M64064), unnamed (AF131889), unnamed (AF131230), and TW183 (AE009440), and 97z for the eight strains of Legionella spp., L. pneumophila serogroup 1 Corby (CP000675), L. long beachae ATCC33484 (AY444741), L. sainthelensis NCTC 11988 (Z49734), L. bozemanii NCTC 11975 (Z49718), L. birminghamensis NCTC12437 (Z49717), L. anisa ATCC35292 (X73394), L. dumoffii ATCC700715 (AF129522), and L. parisiensis ATCC700174 (U59697), respectively, in the results of multiple sequence alignment by using the software Clustal W. Preparation of nasopharyngeal aspirates (NPAs) col lected from healthy children: In order to evaluate the in hibitory effects of NPA on our realtime PCR assay, NPAs collected from three healthy children were used for dilution of templates after written informed con sents were obtained from their parents. This was ap proved by the ethical committee of the Department of Medical Sciences, Ministry of Public Health, Thailand. Nasopharyngeal swabs of these children were all posi tive for bacterial culture (Child 1, S. pneumoniae 1 ~ 107 colony forming unit [CFU]/ml, Haemophilus influenzae 1 ~ 108 CFU/ml; Child 2, Moraxella catarrhalis 7 ~ 108 CFU/ml; Child 3, M. catarrhalis 1 ~ 107 CFU/ml). Mucous substances were observed in each NPA by visual inspection. The NPAs were nega tive for M. pneumoniae, C. pneumoniae, and Legionel la spp., according to realtime PCR with DNA extrac tion using primers listed in Table 2. NPAs were pooled and homogenized and used for dilution of templates. 175

extraction to clinical respiratory specimens: A total of 38 clinical respiratory specimens (NPAs, n 14; endo tracheal aspirates, n 19; and sputum, n 5) collect ed from patients with pneumonia, which were stored at |809 C at the National Institute of Health (NIH) Thailand, were also tested to compare the detection sen sitivity for the three respiratory bacteria between previ ously reported probe realtime PCR with DNA extrac tion (8,9) and our triplex PCR without DNA extraction. For the previously published realtime PCR with DNA extraction, 5 ml of DNA template was used, which was equivalent to 20 ml of the original specimen. For our triplex realtime PCR without DNA extraction, 3 ml of the original specimen was used for the template after homogenization with Nacetyl cysteine. Among all of the clinical respiratory specimens, 37 specimens were also tested for common bacteria by cul ture method on delivery to NIH Thailand during 2007 and 2008. The specimens were inoculated on chocolate and 5z sheep blood agar and then incubated overnight at 379C in 5z CO2. In the suspected cases of legionella infection, buffered charcoalyeast extracta (BCYEa) agar was used for the bacterial culture. The identifica tion of bacteria was performed using conventional biochemical tests (10) and/or API test kits (bioM áerieux, Marcy l'Etoile, France). Statistical analyses: Statistically significant differ ences in mean Tm values for each bacterium were exam ined by multiple comparisons with Tukey's honestly sig nificant difference test. A repeatedmeasures oneway analysis of variance of CT values among our realtime SYBR green PCR with and/or without DNA extraction and the probe realtime PCR with DNA extraction was performed. Both analyses were done using SPSS statis tics software version 17 (SPSS Inc., an IBM company, Chicago, Ill., USA).

triplex assay as templates (Table 1). DNA extracted from each strain of the three target bacteria was also ap plied to single assays using primers specific for the other two target bacteria. No crossreactivity with primers specific for the three target bacteria was observed for DNA extracted from the other bacterial strains. Detection limits: Detection limits for the three target bacteria were determined in three replicates by the lowest concentration of the sample yielding definite CT and Tm values for their specific amplified products. (A) Detection limits (genomic copies/assay) using ex tracted DNA in nucleasefree water: in order to deter mine the best detection limit of this assay, 10fold serial dilutions of DNA in nucleasefree water extracted from M. pneumoniae M129, L. pneumophila serogroup 1 (ATCC331559), and pCPN, a recombinant plasmid containing an ompA gene of C. pneumoniae AR39, were used as templates. The detection limits for extract ed DNA were 4.76, 2.32, and 0.76 genomic copies/assay for M. pneumoniae, C. pneumoniae, and L. pneumo phila, respectively. (B) Comparison of detection limits among the four types of templates: M. pneumoniae M129, L. pneumo phila serogroup 1 (ATCC331559), and C. pneumoniae AR39, were used in our triplex assay as the four types of templates, i.e., (Ai) the extracted DNA in the water, (Aii) the extracted DNA in the NPA, (Bi) bacterial cells in the water, and (Bii) bacterial cells in the NAP, respectively. The detection limits for the four types of templates in our triplex assay are shown in Table 3. The difference in the detection limits for each of the three bacteria for the template type with the bacterial cells in the NPA without DNA extraction was within a 10fold dilution compared with the other three types of templates. For Legionella, the detection limits in nucleasefree water and NPA were similar. For C. pneumoniae and M. pneumoniae, the detection limits in NPA were only 10 fold higher than those in nucleasefree water. The effect of NPA on our PCR assay was small. Application of triplex realtime PCR without DNA extraction to clinical respiratory specimens: Each of the

RESULTS Crossreaction with other bacteria: Each of the DNA extracted from 112 bacterial strains (94 species), other than the three target organisms, was applied to this

Table 3. Comparison of detection limits for M. pneumoniae, C. pneumoniae, and Legionella spp. among triplex SYBR green realtime PCR with and/or without DNA extraction and PCR assays with DNA extraction reported by other investigators Realtime PCR with hybridization probe

Triplex SYBR green realtime PCR

Khanna et al. (2)

Present study

Bacteria

Raggam et al. (12)

Conventional PCR with microplate hybridization Khanna et al. (2)

Ginevra et al. (15)

Type of template

C. pneumoniae M. pneumoniae L. pneumophila

DL CT DL CT DL CT

Extracted DNA in water

Extracted DNA in NPA

Bacteria cell in water

Bacteria cell in NPA

0.003 26.27{0.73 0.01 24.64{0.09 0.02 31.04{0.87

0.002 29.43}1.45 0.02 30.11}0.56 0.02 28.82}0.95

0.002 24.11}0.79 0.02 25.94}0.68 0.2 30.39}1.57

0.02 26.94}1.41 0.2 28.28}1.08 0.2 27.05}2.25

Extracted DNA in water 0.0011) 34.8 0.5 33 0.9 34.8

0.5 0.5 0.5

0.00011) 0.05 0.09

0.001 0.052) 1

The units of detection limit are inclusion body forming unit (IFU)/assay for C. pneumoniae except (i) 50z tissue culture infectious dose (TCID50)/assay, colony forming unit (CFU)/assay for M. pneumoniae, and L. pneumophila except (ii) color change unit (CCU)/assay. NPA, nasopharyngeal aspirate; DL, detection limit; CT, cycle thresholds (mean}SD); , not described. 176

Table 4. Comparison of triplex SYBR green realtime PCR with and/or without DNA extraction, and probe realtime PCR with DNA ex traction as applied to clinical respiratory specimens collected from patients with pneumonia

Patient

Specimen

Triplex SYBR green realtime PCR with DNA extraction Bacterial detection

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32

ETA ETA ETA ETA ETA NPA NPA NPA NPA NPA ETA Sputum Sputum Sputum Sputum Sputum ETA ETA ETA ETA ETA ETA ETA ETA ETA ETA ETA ETA ETA NPA NPA NPA

C C C C C C M M M M L L (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|)

33 34 35 36 37 38

NPA NPA NPA NPA NPA NPA

(|) (|) (|) (|) (|) (|)

Triplex SYBR green realtime PCR without DNA extraction

Tm

CT

Bacterial detection

84.1 84.1 82.6 83.3 83.7 83.6 86.2 86.4 86.2 85.2 88.7 89.2

32.54 30.53 33.67 29.12 30.87 28.49 27.85 24.11 25.31 26.77 31.24 26.45 UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD UD

C C C C C C M M M M L L (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|)

UD UD UD UD UD UD

(|) (|) (|) (|) (|) (|)

Probe realtime PCR with DNA extraction

Tm

CT

Bacterial detection

83.2 84.1 83.9 84.3 84.5 83.1 86.7 85.9 86.2 85.2 88.3 88.8


C C C C C C M M M M L L (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|) (|)


UD UD UD UD UD UD

(|) (|) (|) (|) (|) (|)

UD UD UD UD UD UD

CT

Result of bacterial culture

(|) Staphylococcus aureus, Streptococcus spp. Moraxella catarrhalis, Stomatococcus spp. (|) (|) Neisseria lactamica, Aerococcus spp. S. pneumoniae M. catarrhalis (|) (|) (|) Legionella pneumophila serogroup 7 (|) (|) Pseudomonas aeruginosa, Escherichia coli (|) (|) (|) S. aureus, Stenotrophomonas maltophilia (|) S. salivarius E. coli (|) S. pneumoniae (|) S. constellatus subsp. constellatus, S. oralis P. aeruginosa S. sangius biotype 3 S. parasangius, S. canosus subsp. utilis Corynebacterium pseudodiphthericum (|) S. pneumoniae, Haemophilus influenzae, H. parainfluenzae S. pneumoniae, H. influenzae S. pneumoniae, H. influenzae (|) (|) (|) M. catarrhalis

ETA, endotracheal aspirates; NPA, nasopharyngeal aspirates; C, Chlamydophila pneumoniae; M, Mycoplasma pneumoniae; L, Legionella spp.; Tm, melting temperature value; Ct, cycle threshold value; UD, undetected; (|), negative.

clinical respiratory specimens collected from patients with pneumonia was tested by three methods: our triplex realtime PCR with and/or without DNA extrac tion, and by previously published probe realtime PCR with DNA extraction. The three methods yielded con cordant results for detection of the targets (Table 4). Among 38 clinical respiratory specimens, 12 samples proved to be positive for one of the three target bacte ria. Six, four, and two samples were positive for C. pneumoniae, M. pneumoniae, and Legionella spp., re spectively, by all realtime PCR assays. In two samples positive for PCR detecting Legionella spp., one sample was identified as L. pneumophila serogroup 7 by bac

terial culture. Another one was identified as L. pneumo phila by PCR using macrophage infectivity potentia tor (mip) gene specific primers (11), although the bac terial culture was negative. CT values, mean } SD (range), of positive specimens for any of the three target bacteria were 28.9 } 2.95 (24.1133.67), 29.6 } 4.27 (23.2735.78), and 30.6 } 3.04 (24.3635.86), for our PCR with and/or without DNA extraction and for the probe PCR with DNA extraction, respectively. The mean CT values were not significantly different among the three realtime PCR assays, regardless of DNA ex traction. Although 19 species of bacteria other than the target bacteria were detected by culture in 19 cases out 177

Fig. 1. A typical result of melting temperature (Tm) analysis of the PCR product for each of three bacteria. In this reaction, DNA in nucleasefree water extracted from bacteria strain, C. pneumoniae AR39, M. pneumoniae M129, and L. pneumophila serogroup 1 ATCC331559, were used as template. For other types of template with and/or without DNA extraction, the results were similar.

pneumoniae (n 37), M. pneumoniae (n 24), and Legionella spp. (n 46), respectively (Fig. 1). Tm values were significantly different among the three or ganisms ( P 5.10 ~ 10|9). No nonspecific PCR products were observed either by Tm analysis in real time PCR or by agarose gel electrophoresis (Figs. 1 and 2). In comparison of the four types of templates, (Ai) the extracted DNA in the water, (Aii) the extracted DNA in the NPA, (Bi) the bacterial cells in the water, and (Bii) the bacterial cells in the NAP, Tm values (9C) were 83.284.3, 84.084.2, 84.284.3, and 84.184.3 for C. pneumoniae AR39, 85.285.8, 85.085.6, 85.686.0, and 86.086.2 for M. pneumoniae M129, 88.2, 87.8 88.2, 88.088.4, and 88.188.5 for L. pneumophila serogroup 1 ATCC331559, respectively. For each of the three reference strains, a difference in Tm values was not evident among the four types of templates. In the PCR reactions using clinical respiratory speci mens (endotracheal aspirate, sputum, and NPA) with and/or without DNA extraction, the mean Tm values } SD (range) 9C, were 83.7 } 0.56 (82.684.5), 86.0 } 0.54 (85.286.7), and 88.8 } 0.37 (88.389.2) for C. pneumoniae (n 12), M. pneumoniae (n 8), and Legionella spp. (n 4, two reactions using each of specimens positive for L. pneumophila serogroup 7 and L. pneumophila), respectively. Tm values were similar between clinical specimens without DNA extraction and those with DNA extraction. Overall, in the PCR reactions using the templates of laboratory strains and clinical specimens with and/or without DNA extraction, the mean Tm values } SD (range) were 83.6 } 0.54 (82.684.5), 85.8 } 0.41 (85.086.7), and 88.1 } 0.45 (87.489.3) for C. pneumoniae (n 49), M. pneumoniae (n 32), and Legionella spp. (n 50), respectively. The mean Tm values were significantly different among the three bac teria ( P 5.10 ~ 10|9). All the templates were re classified into the four types; (i) the DNA extracted from laboratory strains diluted in nucleasefree water and/or the NPA from healthy children, (ii) bacterial cells of laboratory strains without DNA extraction diluted in water and/or the NPA, (iii) the DNA extract

Fig. 2. Agarose gel electrophoresis analysis of the triplex SYBR green realtime PCR products from each of three bacteria. Lane 1 was a 50bp DNA ladder; lanes 2 and 3 were PCR products using the templates of extracted DNA in nucleasefree water of L. pneumophila serogroup 1 ATCC331559 (241bp); lanes 4 and 5 were those of C. pneumoniae AR39 (90 bp); lanes 6 and 7 were those of M. pneumoniae M129 (136 bp); and lane 8 was the negative control. For other types of template with and/or without DNA extraction, the results were similar.

of a total of 38 clinical specimens, no crossreactions with triplex realtime PCR for the target bacteria were observed. Among 12 specimens positive for any one of the three bacteria by realtime PCR, five specimens were positive for other bacteria by culture, suggesting that our realtime PCR can detect target bacteria in the presence of other bacteria. Differentiation of the three target bacteria by Tm value analysis of the products of the triplex SYBR green realtime PCR: In the PCR reactions using laboratory reference bacteria strains with and/or without DNA ex traction, the mean Tm values } SD (range) 9C, were determined to be 83.5 } 0.53 (82.884.3), 85.7 } 0.34 (85.086.3), and 88.1 } 0.41 (87.489.3) for C. 178

both reference strains and clinical respiratory specimens without DNA extraction. The detection limits for whole cells of each of three bacteria without DNA extraction diluted with NPA ranged from 10100 inclusion body forming unit (IFU) or CFU/ml (0.020.2 IFU or CFU/assay), which was similar to the detection limits of previously published studies with DNA extraction (Ta ble 3) (2,1216). This is significant considering that several studies showed that the amount of bacteria in various respiratory samples ranged from 102107 CFU/ml for M. pneumoniae and 104105 IFU/ml for C. pneumoniae (17,18). Indeed, using clinical respiratory specimens from patients with pneumonia, our realtime PCR without DNA extraction and a realtime PCR with DNA extraction showed identical results for the detec tion of the three bacteria, and the CT values of both methods were also similar. In addition, the presence of other bacteria did not affect PCR amplification of the target bacteria. These results demonstrated that our as say without DNA extraction had comparable sensitivity to other assays with DNA extraction (Table 4). Tm values for each of the three bacteria were not different between the clinical respiratory specimens with and without DNA extraction. This result showed that clini cal respiratory specimens without DNA extraction had no effect on Tm analysistherefore, there was no effect on the specificity of our assay. Also, crossreaction with other bacteria was not observed in either reference strains or clinical respiratory specimens (Table 4). These results showed that our triplex realtime PCR has sufficient specificity, even with clinical respiratory specimens. Since a difference in Tm values was not evi dent among laboratory strains and clinical specimens, both with and without DNA extraction, the range of Tm values in the PCR reactions for all types of templates would be proposed as the criteria for determining the Tm value (9C) in our assay, i.e., 82.684.5 for C. pneumoniae, 85.086.7 for M. pneumoniae, and 87.489.3 for Legionella spp., respectively. Since Tm value analysis might vary according to realtime PCR machine and reagents, optimization in each laboratory would also be recommended. Sputum and/or endotracheal aspirates are the preferred respiratory samples for determining the etiol ogy of CAP. However, sputum is usually difficult to collect from children and elderly who are unable to ex pectorate sputum. Endotracheal aspirates are usually only available from intubated patients. When sputum and/or endotracheal aspirates are unavailable, NPA could be used as the diagnostic test for M. pneumoniae and C. pneumoniae (19). Also, this method successfully detected all species of Legionella simultaneously with C. pneumoniae and M. pneumoniae. Although several previous reports of real time PCR detected only some species of Legionella, es pecially L. pneumophila and/or L. micdadei, simul taneously with M. pneumoniae and C. pneumoniae, they were not able to detect other species of Legionella (2,4,5,16). However, at least 19 Legionella spp. are documented as human pathogens on the basis of their isolation from clinical specimens (3). Compared with the United States and Europe, in Thailand, a higher in cidence of legionella infections other than L. pneumo phila has been reported (20,21).

Fig. 3. Distribution of melting temperature (Tm) values of the three target bacteria, C. pneumoniae, M. pneumoniae, and Legionella spp., using both laboratory reference strains and clinical specimens. The mean Tm values } SD (range) were 83.6 } 0.54 (82.684.5), 85.8 } 0.41 (85.086.7), and 88.1 } 0.45 (87.489.3), for C. pneumoniae (n 49), M. pneumoniae (n 32), and Legionella spp. (n 50), respectively. The mean Tm values were significantly different among three bacteria ( P 5.10 ~ 10|9). Types of templates were classified into 1 to 4, as follows. 1, Extracted DNA of laboratory strains in the water and/or the NPA; 2, Bacteria cell of laboratory strains without DNA extraction in the water and the NPA; 3, Extracted DNA of clinical respiratory specimens in the water; 4, Clinical respiratory specimens without DNA extraction. The laboratory strains used in this figure were as follows, C. pneumoniae (AR39, AR388, KKpn15, KKpn16, KKpn17, YK41, and CpnTh1), M. pneumoniae (M129, FH, and CU), each strain of L. pneumohila serogroup 1 (ATCC331559) to 15, two strains of L. longbeachae, L. micdadei, L. jordanis, L. bozemanii, and L. feelei, respectively, and each strain of another 12 species of Legionella spp. For C. pneumoniae AR39, M. pneumoniae M129, L. pneumohila serogroup 1 (ATCC331559), types of templates both 1 and 2 were used. For other laboratory strains, only a type of template 1, extracted DNA in water was used.

ed from clinical specimens diluted in nucleasefree water, and (iv) clinical specimens without DNA extrac tion. For each of the three target bacteria, a difference in Tm values was not evident among these four types of templates (Fig. 3). These results demonstrated that triplex SYBR green realtime PCR successfully and simultaneously detected and differentiated C. pneumoniae, M. pneumoniae, and Legionella spp. by analysis of the Tm value of PCR products in a single reaction. DISCUSSION This is a new report on the application of realtime PCR assay for clinical respiratory specimens without DNA extraction. In view of the fact that our triplex real time PCR detects the three bacteria without DNA ex traction, only one step is required to obtain results. This saves time, labor, and cost and reduces the risk of con tamination in comparison with other realtime PCR as says. In our realtime PCR, the template DNA was neither purified nor concentrated, and the clinical respiratory specimen contained various PCR inhibitors. Therefore, sensitivity and specificity of our assay were tested using 179

In conclusion, our method differentiated these three organisms with high reliability, as shown by Tm value analysis, had no crossreactivity with other organisms, and had detection limits sufficient for the three target bacteria. However, a limitation of our study was the small number of tested clinical specimens, and there fore, further field tests are still necessary. Our triplex realtime PCR shows promise for further clinical appli cation based on three advantages: rapid detection, low cost, and a reduced risk of contamination.

7.

8.

9.

Acknowledgments Six strains of C. pneumoniae (AR39, AR388,

10.

KKpn15, KKpn16, KKpn17, YK41), and each strain of Chlamydia psittaci and C. trachomatis were kindly provided by Dr. Naoyuki Miyashita, Division of Respiratory Diseases, Kawasaki Medical School, Japan, while those of two strains of M. pneumoniae (M129, FH), each strain of M. salivarium, M. hominis, M. genitalium, Ureaplasma urealyticum, and U. parvum were kindly provided by Dr. Tsuguo Sasaki and Dr. Atsuko Horino, National Insitute of Infec tious Diseases, Japan. Reference bacterial strains (n 103) other than M. pneumoniae, C. pneumoniae, and Legionella spp. were pro vided from the Department of Medical Sciences, ThailandCulture Collection (DMSTCC). We are grateful to Dr. Naokazu Takeda and Dr. Shigeyuki Hama da, ThailandJapan Research Collaboration Center for Emerging and Reemerging Infections, Osaka University for scientific suggestions. We also appreciate Dr. Sumihisa Honda, Department of Public Health, Faculty of Medicine, Nagasaki University for suggestions for statistical analysis. This work was supported in part by the Department of Medical Sciences, Ministry of Public Health, Thailand, the Program of Research Centers for Emerging and Reemerging Infectious Diseases launched by a project commissioned by the Ministry of Education, Culture, Sports, Science and Technology of Japan, and GrantsinAid from the Ministry of Health, Labour and Welfare of Japan on ``Mechanisms, epidemiology, prevention and control of acute respira tory infection.''

11.

12.

13.

14.

15.

16.

REFERENCES 1. File, T.M. (2003): Communityacquired pneumonia. Lancet, 362, 19912001. 2. Khanna, M., Fan, J., PehlerHarrington, K., et al. (2005): The pneumoplex assays, a multiplex PCRenzyme hybridization assay that allows simultaneous detection of five organisms, Mycoplas ma pneumoniae, Chlamydia (Chlamydophila) pneumoniae, Legionella pneumophila, Legionella micdadei, and Bordetella pertussis, and its realtime counterpart. J. Clin. Microbiol., 43, 565571. 3. Muder, R.R. and Yu, V.L. (2002): Infection due to Legionella species other than L. pneumophila. Clin. Infect. Dis., 35, 990998. 4. Morozumi, M., Nakayama, E., Iwata, S., et al. (2006): The Acute Respiratory Diseases Study Group. Simultaneous detection of pathogens in clinical samples from patients with community ac quired pneumonia by realtime PCR with pathogenspecific molecular beacon probes. J. Clin. Microbiol., 44, 14401446. 5. Welti, M., Jaton, K., Altwegg, M., et al. (2003): Development of a multiplex realtime quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumo niae in respiratory tract secretions. Diagn. Microbiol. Infect. Dis., 45, 8595. 6. Nishimura, N., Nakayama, T., Tonoike, H., et al. (2000): Direct

17.

18. 19.

20. 21.

180

polymerase chain reaction from whole blood without DNA isola tion. Ann. Clin. Biochem., 37, 674680. Okamoto, H., Takano, E., Sugao, T., et al. (1999): Direct am plification of Escherichia coli O157 vero toxin genes from human faeces by the polymerase chain reaction. Ann. Clin. Biochem., 36, 642648. Gullsby, K., Storm, M. and Bondeson, K. (2008): Simultaneous detection of Chlamydophila pneumoniae, and Mycoplasma pneumoniae by use of molecular beacons in a duplex realtime PCR. J. Clin. Microbiol., 46, 727731. Diederen, B.M.W., de Jong, C.M.A., Marmouk, M., et al. (2007): Evaluation of realtime PCR for the early detection of Legionella pneumophila DNA in serum samples. J. Med. Microbiol., 56, 94101. Murray, P.R., Baron, E.J., Pfaller, M.A., et al (ed.) (1999): Manual of Clinical Microbiology. 7th ed. American Society for Microbiology, Washington, D.C. Kessler, H.H., Renthaler, F.F., Pschaid, A., et al. (1993): Rapid detection of Legionella species in bronchoalveolar lavage fluids with the EnvriAmp legionella PCR amplification and detection kit. J. Clin. Microbiol., 31, 33253328. Raggam, R.B., Leither, E., Berg, J., et al. (2005): Singlerun, parallel detection of DNA from three pneumoniaproducing bac teria by realtime polymerase chain reaction. J. Mol. Diagn., 7, 133138. Templeton, K.E., Scheltinga, S.A., Graffelman, A.W., et al. (2003): Comparison and evaluation of realtime PCR, realtime nucleic acid sequencebased amplification, conventional PCR, and serology for diagnosis of Mycoplasma pneumoniae. J. Clin. Microbiol., 41, 43664371. Templeton, K.E., Scheltinga, S.A., Sillekens, P., et al. (2003): Development and clinical evaluation of an internally controlled, singletube multiplex realtime PCR assay for detection of Legionella pneumophila and other Legionella species. J. Clin. Microbiol., 41, 40164021. Ginevra, C., Barranger, C., Ros, A., et al. (2005): Development and evaluation of chlamylege, a new commercial test allowing simultaneous detection and identification of Legionella, Chlamydophila pneumoniae, and Mycoplasma pneumoniae in clinical respiratory specimens by multiplex PCR. J. Clin. Microbiol., 43, 32473254. McDonough, E.A., Barrozo, C.P., Russell, K.L., et al. (2005): A multiplex PCR for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bor detella pertussis in clinical specimens. Mol. Cell. Probe, 19, 314322. Apfalter, P., Barousch, W., Nehr, M., et al. (2003): Comparison of a new quantitative ompAbased realtime PCR Taqman assay for detection of Chlamydia pneumoniae DNA in respiratory specimens with four conventional PCR assays. J. Clin. Microbiol., 41, 592600. R äaty, R., R äonkk äo, E. and Kleemola, M. (2005): Sample type is crucial to the diagnosis of Mycoplasma pneumoniae pneumonia by PCR. J. Med. Microbiol., 54, 287291. Strålin, K., T äornqvist, E., Kaltoft, M.S., et al. (2006): Etiologic diagnosis of adult bacterial pneumonia by culture and PCR ap plied to respiratory tract samples. J. Clin. Microbiol., 44, 643645. Chunhaswasdikul, B., Sukonthaman, A., Lind, K., et al. (1986): Legionella jordanis pneumonia: a case report. J. Med. Assoc. Thai., 69, 283287. Phares, C.R., Wangroongsarb, P., Chantra, S., et al. (2007): Epidemiology of severe pneumonia caused by Legionella long beachae, Mycoplasma pneumoniae, and Chlamydia pneumoniae: 1year, populationbased surveillance for severe pneumonia in Thailand. Clin. Infect. Dis., 15, e147155.