Differentiation between Trypanosoma cruzi and Trypanosoma rangeli ...

Tropical Medicine and International Health

doi:10.1111/tmi.12222

volume 19 no 2 pp 195–206 february 2014

Differentiation between Trypanosoma cruzi and Trypanosoma rangeli using heat-shock protein 70 polymorphisms Jorge Fraga1, Aym e Fernandez-Calienes1, Ana Margarita Montalvo1, Ilse Maes2, Jean-Claude Dujardin2,3 and Gert Van der Auwera2 1 Parasitology Department, Institute of Tropical Medicine Pedro Kouri, La Havana, Cuba 2 Department of Biomedical Sciences, Institute of Tropical Medicine, Antwerp, Belgium 3 Department of Biomedical Sciences, University of Antwerp, Antwerp, Belgium

Abstract

objective Differential diagnosis of infection with Trypanosoma cruzi or T. rangeli is relevant for epidemiological studies and clinical practice as both species infect humans, but only T. cruzi causes Chagas’ disease. Their common antigen determinants complicate the distinction between both species, while current PCR assays used for differentiation show some drawbacks. We developed and validated a generic PCR discriminating the species by restriction fragment length polymorphism (RFLP) analysis and a duplex PCR specifically amplifying a differently sized fragment of both species. methods The assays are based upon a partial region of the heat-shock protein 70 gene (hsp70). The analytical sensitivity and specificity were determined for both PCRs. The assays were analytically evaluated on a panel of six T. cruzi, one T. cruzi marinkellei and four T. rangeli strains, various other infectious pathogens, a panel of spiked samples of T. cruzi, and artificially mixed infections of T. cruzi and T. rangeli. Finally, the tools were applied on 36 additional isolates of Trypanosoma species. results The detection limit of the PCRs was between 0.05 and 0.5 parasite genomes, and 1–10 parasites spiked in 200 ll blood. In artificial mixtures, PCR–RFLP picked up both species in ratios up to 102 and duplex PCR up to 104. In the 36 isolates tested, both single and mixed infections were identified. All assays were shown to be specific. conclusion Our PCRs show high potential for the differential diagnosis of T. cruzi and T. rangeli, which in view of their sensitivity can aid in the confirmation of infection with these parasites in vectors, reservoirs and clinical samples. keywords Trypanosoma cruzi, Trypanosoma rangeli, restriction fragment length polymorphism, hsp70, differentiation

Introduction Chagas’ disease, caused by the protozoan parasite Trypanosoma cruzi, affects 21 countries in Latin America with a burden of approximately 0.43 million disabilityadjusted life years (DALYs) (World Health Organization 2010). An estimated eight to nine million people are infected and over 100 million are at risk. Yearly, there are close to 41 200 new reported cases of infection by T. cruzi and 12 500 deaths (World Health Organization 2007; Hotez et al. 2008; Schmunis & Yadon 2010). The illness has a variable clinical course that may include asymptomatic infection, acute disease or a chronic condition. Trypanosoma cruzi is a heterogeneous taxon with multiple hosts, vectors and routes of infection and is

© 2013 John Wiley & Sons Ltd

currently classified into six discrete typing units (DTU): Tc I–VI. These DTUs are differently distributed in the endemic regions and transmission cycles and probably impact the clinical manifestation and severity of the disease differently (Zingales et al. 2012). Trypanosoma rangeli is the second most common American trypanosome that infects humans, but it is a non-pathogenic parasite. T. rangeli presents extensive genetic variability, and kDNA minicircle characteristics identified two groups named KP1(+) and KP1( ), according to the presence or absence of KP1 minicircles, respectively (Vallejo et al. 2002). This parasite shares morphological similarities and antigenic determinants with T. cruzi, making differential microscopic and serological diagnosis challenging. Both parasites occur in the same geographical locations and share insect vectors (Vallejo et al. 1999; Morales et al. 195



J. Fraga et al. Differentiation between T. cruzi and T. rangeli using the hsp70 gene

2002). Mixed infections with both parasite species have been reported in humans (Guhl et al. 1987; Coura et al. 1996; Chiurillo et al. 2003), vectors and reservoir animals (Vargas et al. 2000; Ramirez et al. 2002; Dias et al. 2007; Pavia et al. 2007; Thekisoe et al. 2010; Salda~ na et al. 2012), necessitating accurate differential diagnosis (Thekisoe et al. 2010). The lack of an adequate specific diagnostic procedure and the absence of clinical manifestations have been responsible for the underestimation of human T. rangeli incidence (Coura et al. 1996; D’ Alessandro & Saravia 1999; Vargas et al. 2000). Several techniques such as resistance to complement lysis and reaction with monoclonal antibodies (Acosta et al. 1991), lectin agglutination lysis (de Miranda Santos & Pereira 1984), nuclear or kinetoplast DNA probes (Greig et al. 1990; Macedo et al. 1993; Vallejo et al. 1994), and the restriction patterns of kDNA (Vallejo et al. 1994) have been used for distinguishing both trypanosome species, but none is completely satisfactory when used alone, and all require propagation of the parasite (Morales et al. 2002). To solve these problems, different PCR methods and targets have been described for differentiation: kinetoplast DNA (Sturm et al. 1989; Dorn et al. 1999; Vallejo et al. 1999); the mini-exon gene (Murthy et al. 1992; Fernandes et al. 2001); a 195-bp nuclear repeated satellite DNA (Breniere et al. 1993); the 24S large subunit ribosomal RNA (Souto et al. 1999); a gene coding for a flagellar protein (Silber et al. 1997); cysteine proteinase (Tanaka 1997), DNA repetitive element P542 (Vargas et al. 2000); telomeric sequences (Chiurillo et al. 2003); a short interspersed repetitive element (SIRE) sequence inserted into the histone H2A gene; and the small nucleolar RNA-C11 gene (Pavia et al. 2007). However, these PCR assays show some disadvantages such as the amplification of similar bands both in T. cruzi and T. rangeli (Souto et al. 1999), the amplification of bands of different size related with the amplification of polymorphic regions (Murthy et al. 1992; Grisard et al. 1999; Fernandes et al. 2001) and a bias towards T. cruzi in the case of mixed T. cruzi and T. rangeli infections (Sturm et al. 1989; Dorn et al. 1999; Vallejo et al. 1999; Vargas et al. 2000). Therefore, it is necessary to develop new techniques as better options to specifically identify each of the parasite species in single and mixed infections. The cytoplasmic 70-kDa heat-shock protein genes (hsp70), which are organised as a tandem array in a head-to-tail manner (Requena et al. 1988), have been exploited for Leishmania species identification in the Old and New World using PCR, followed by restriction fragment length polymorphism (RFLP) analysis, showing high sensitivity and specificity in clinical samples (Garcia et al. 196

2007; Fraga et al. 2012; Montalvo et al. 2012; Veland et al. 2012). Recently, Cuervo et al. (2013) proposed a PCR–RFLP based on this gene, using the SphI enzyme, for differentiating the two groups of T. rangeli KP1(+) and KP1( ).The goal of this study was to exploit the cytoplasmic hsp70 gene for differential diagnosis of T. cruzi and T. rangeli through the design of a PCR– RFLP and species-specific PCRs.

Materials and methods Strains and isolates Table 1 lists the species and geographical origin of the strains and isolates used in different steps of our study and representative of T. cruzi, T. cruzi marinkellei and T. rangeli. As DNA was obtained from different laboratories and collections, the reference species identification and genotype was based on various data such as multilocus sequence typing (MLST), multilocus enzyme electrophoresis (MLEE), multilocus microsatellite typing (MLMT), PCR and PCR–RFLP techniques. All DNAs were isolated from parasite cultures, and DNA was obtained from the different institutes acknowledged at the end of this article. To test the analytical specificity of the PCRs, DNAs from clinical samples or cultures from various microorganisms and viruses were used: Trypanosoma brucei brucei, T. brucei gambiense, T. brucei rhodesiense, T. congolense, T. vivax, T. equiperdum, T. theileri, T. evansi, Leishmania (L.) infantum (chagasi), L. (L.) mexicana, L.(V.) braziliensis, L. (V.) naiffi, L. (V.) peruviana, L. (V.) guyanensis, L. (V.) lainsoni, Plasmodium falciparum, Schistosoma mansoni, Candida albicans, Candida parasilopsis, Cryptococcus neoformans, Haemophilus influenzae, Streptococcus pneumonia, Enterococcus, Mycobacterium tuberculosis, Mycobacterium habana, Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeroginosa, Escherichia coli, Neisseria meningitides, Epstein–Bar virus, herpes zoster virus, herpes simplex virus, and cytomegalovirus. These were obtained from various sources acknowledged at the end of the manuscript. Trypanosoma cruzi epimastigotes of three strains (X10/ 4, Tula and M6241) of different DTUs were counted, and a 10-fold dilution series was prepared in human blood from a healthy individual, ranging from 106 to 1 parasite in 200 ll blood. Non-spiked blood was used as a negative control. Extraction of DNA was performed using the High Pure PCR Product Purification Kit (Roche Applied Science, Mannheim, Germany), whereby the DNA was eluted in 200 ll.





Table 1 Strains and isolates used in the study

Species

Strain name

Country

Genotype*

Trypanosoma cruzi (n = 27)

SP104 OPS21 P209 Cutia X10/4 MAS Esm Tu18 IVV CBB PERU M5631 M6241 CM17 X109/2 92122102R CanIII Theis SO3 MN Bug2148 SC43 CL Brener

Chile Venezuela Bolivia Brazil Brazil Brazil Brazil Bolivia Chile Chile Peru Brazil Brazil Colombia Paraguay USA Brazil USA Bolivia Chile Brazil Bolivia Brazil

I I I I I II II II II II II III III III III IV IV IV V V V V VI

Tula P63 Y BRAZIL

Chile Paraguay Brazil Brazil

VI VI nk nk

RPLA4 CAN AC LEM2946 LEM2963 B28V1A06P2C3 B28P1A06P1C1 LEM2947 R1271 Sjm30 TCI2307 TET2408 TET2414 TET2417 TPY2422 Perija 226 H14

Venezuela Venezuela French Guyana French Guyana Venezuela Venezuela French Guyana Colombia Bolivia Ecuador Ecuador Ecuador Ecuador Ecuador Colombia Colombia Honduras

nk nk nk nk nk nk nk nk nk nk nk nk nk nk nk nk KP1+

Tre

Colombia

KP1

Trypanosoma rangeli (n = 25)

Accession number KC959988 KC959989

Evaluation panel† (Figure 3)

Spiked samples† (Figure 5)

Application panel† (Figure 6)

v v v v v

KC959990 KC959991

v v v v v

M26595‡ KC959992 KC959993 KC959994 KC959995 KC959996

v v

v v v v

v v

KC959997 KC959998

v v v v v

KC959999/ XM_812644‡§/ XM_812645‡§ v KC960000 FJ222459‡ X67716‡

v

KC960001 KC960002 KC960003 KC960004 KC960005 KC960006 KC960007 KC960008 KC960009

v v v v

KC960010 EF108422‡/ EF442767‡/ EF442768‡ EF108420‡/ EF108421‡/ EF108419‡

v v

v v v

v v v v v v v

(continued) © 2013 John Wiley & Sons Ltd

197




Table 1 (Continued)

Species

T. cruzi marikellei (n = 2)

Strain name

Country

Genotype*

TBJ2273 TET2408 TLG2355 TRC2377 R1625 SC58 TLG2343_cl3

Ecuador Ecuador Ecuador Ecuador El Salvador Brazil Ecuador

nk nk nk nk KP1+ KP1 nk

M1909 B3

Venezuela Brazil

nk nk

Evaluation panel† (Figure 3)

Accession number

Spiked samples† (Figure 5)

Application panel† (Figure 6) v v v v v v v

KC960011

v v

*Trypanosoma cruzi genotype listed as DTU; T. rangeli listed as KP1 present or absent; nk, not known. †Isolates tested are indicated with v. ‡Sequences from strains retrieved from GenBank, and the remaining ones were determined in this study. §Accession numbers starting with XM are derived from a contemporary annotation of full-genome sequences and were also retrieved from the GenBank database.

Sequenced fragment (1380 bp) T. cruzi 2034

1

T. rangeli 2010

1 Generic PCR-hsp70T

HSP70T_F703

470 bp HSP70T_R1172 HSP70T_F1048

200 bp

Duplex PCR-hsp70TcTr

95 bp

HSP70T_R1142Tc 202 bp HSP70T_R1249Tr

Figure 1 Schematic representation of the Trypanosoma cruzi (GenBank accession number XM-812645) and T. rangeli (GenBank accession number EF108422) hsp70 genes encoding cytoplasmic HSP70, showing the annealing sites of the oligonucleotides in Table 2. White boxes represent the coding region of hsp70 gene. The sequenced fragment of 1380 nucleotides is shown on the top. The numbers below represent the nucleotide number of the coding region relative to the start codon. The coding regions are aligned, except for the 3′ end where both species have a different size. The PCR products (Table 2) are represented by grey-shaded boxes, indicating the size of the amplicon, for which no intraspecific variation was detected. The primers used in each PCR are indicated by horizontal arrows (not to scale) with the name and 5′–3′ orientation. Generic primers (for both species) are indicated with black horizontal arrows, and specific primers are indicated with grey horizontal arrows. The recognition sites of restriction enzymes used in RFLP analysis are indicated by vertical lines inside the white boxes: Sau3AI (discontinuous) and HaeIII (continuous).

Primer design and in silico analysis of hsp70 coding sequences Partial sequences of the hsp70 gene (Figure 1, Garcia et al. 2007) from different isolates of T. cruzi, T. rangeli and T. cruzi marinkellei (Table 1) were generated using the dideoxy nucleotide chemistry from the ABI PRISM BigDyeTM Terminator cycle sequencing kit (PerkinElmer, 198

Foster City, CA, USA). They were analysed on an ABI 3730 automated sequencer (PerkinElmer). The sequences were aligned with those previously published in GenBank (Table 1) using the software package MEGA5 (Molecular Evolutionary Genetic Analysis, version 5.05, Tamura et al. 2011, www.megasoftware.net). A phylogenetic network was constructed with the SplitsTree4 software (Huson 1998; Huson & Bryant 2006), using the Kimura





Table 2 PCR primers and conditions

PCR

Primers*

Annealing

Primer Sequence 5′–3′

Amplicon size

Reagent concentrations†

Amplification conditions

hsp70T

HSP70T_F703

1160–1180‡ 1157–1177§ 1629–1609‡ 1626–1606§

GCAAGAGCAAGCAGACGGAGG

470 bp

0.8 lM primers 3.5 mM MgCl2

1 cycle 95 °C 5 min 35 cycles 94 °C 40 s/ 65 °C 1 min/ 72 °C 1 min 1 cycle 72 °C 10 min 1 cycle 95 °C 5 min 35 cycles 94 °C 40 s/ 66 °C 1 min/ 72 °C 1 min 1 cycle 72 °C 10 min

HSP70T_R1172

CTTTGCGTCAATGCGCTCGCG

hsp70Tc

HSP70T_F1048 HSP70T_R1142Tc

1505–1528‡ 1599–1578‡

GCAACCAGATTGTCATCACGAACG GTCCTGCGMCTCGTACTTGGCA

95 bp


hsp70Tr

HSP70T_F1048 HSP70T_R1249Tr

1502–1525§ 1703–1683§

GCAACCAGATTGTCATCACGAACG GCCTCCTCAATCTTGCCGCTC

202 bp


hsp70TcTr

HSP70T_F1048

1505–1528‡ 1502–1525§ 1599–1578‡ 1703–1683§

GCAACCAGATTGTCATCACGAACG

95 bp 202 bp


HSP70T_R1142Tc HSP70T_R1249Tr

GTCCTGCGMCTCGTACTTGGCA GCCTCCTCAATCTTGCCGCTC

*F = sense primer; R = antisense primer. †Primer concentrations are listed per primer; the total MgCl2 concentration in the reaction mix is given (1.5 mM of which is included with the PCR buffer, as explained in Material and Methods). ‡The annealing position of the primers is given relative to GenBank accession number XM_812645 (T. cruzi CL Brener). §The annealing position of the primers is given relative to GenBank accession number EF108422 (T. rangeli H14).

2-parameter model (Kimura 1980) and the neighbour-net algorithm (Bryant & Moulton 2004). One PCR primer set in a conserved region was selected for amplification of both species and subsequent differentiation through RFLP. Also PCR primer sets specific for T. cruzi and T. rangeli were selected for a duplex PCR (Figure 1, Table 2). In silico RFLP analysis and prediction of the resulting fragments was performed with the software packages MEGA5 and DNAMAN, version 4.02 (Lynnon Biosoft, Quebec, Canada), as well as with the online tools NEBcutter (tools.neb.com/NEBcutter2) and DistinctiEnz (www.bioinformatics.org/~docreza/cgi-bin/ restriction/DistinctiEnz.pl).

Various amounts of DNA were added to the PCRs, as mentioned with the respective results, and DNA concentrations were measured spectrophotometrically using the Nanodrop (ND1000, Thermo Scientific, Wilmington, DE, USA). Negative no-template controls were always included, along with a positive control consisting of 1 ng DNA from T. cruzi (SP104 strain) and T. rangeli (CAN AC strain). The amplification conditions for all PCRs are shown in Table 2. Thermal cycling was performed either in a PTC150 (MJ Research, Waltham, MA, USA), in a MyCyclerTM (Bio-Rad, Foster City, CA, USA) or in an iCycler (Bio-Rad). Analysis on a 2% agarose gel was used to verify the amplified product size and to check for non-specific amplification.

PCRs

RFLP analysis

Four PCR-hsp70 protocols were performed (Figure 1, Table 2). The generic PCR-hsp70T was performed in 50 ll total volume, while the specific PCR-hsp70Tc, PCR-hsp70Tr and duplex PCR-hsp70TcTr were performed in 25 ll total volume, each containing 19 Q solution and 19 CoralLoad PCR buffer including 1.5 mM MgCl2, 200 lM of each deoxynucleoside triphosphate and 1 U HotStar Taq Plus DNA Polymerase (Qiagen, Hilden, Germany). The additionally added MgCl2 and primers varied as detailed in Table 2.

Restriction fragment length polymorphism analysis was carried out on amplicons from PCR-hsp70T. Digests were performed in a total of 10 ll containing 5 ll nonpurified amplicon solution in 19 optimal buffer provided by the manufacturer, using 2 U HaeIII or 2 U Sau3AI (MBI Fermentas, St. Leon-Rot, Germany). Reaction mixtures were incubated 3 h at 37 °C. Subsequently, restriction patterns were analysed by electrophoresis on a 3% small fragment agarose gel (Gentaur, Brussels, Belgium) running at 3.5 V/cm for 3 h.


199




0.01

99.9

100

T. cruzi 100

T. rangeli

T. cruzi marinkellei Figure 2 Complete phylogenetic network of the Trypanosoma hsp70 sequences in Table 1. Bootstrap support of the branches was inferred from 2000 replicates and is shown in percentages only for the branches leading to the three main groups. The scale is shown in the top left corner, in substitutions per nucleotide.

Results A single fragment covering 1380 bp of the hsp70 coding region (Figure 1) was successfully PCR-amplified and sequenced for 24 strains of T. cruzi, T. cruzi marinkellei and T. rangeli. Table 1 lists the accession numbers of the newly determined sequences and 11 additional ones from GenBank. Figure 2 depicts the relationships between these sequences, which form a general reference framework for finding genetic polymorphisms to differentiate T. cruzi from T. rangeli. Figure 1 shows the three PCR fragments for which primers were developed: PCRhsp70T (generic PCR for RFLP analysis), PCR-hsp70Tc and PCR-hsp70Tr (species-specific PCRs). The latter two were combined in a duplex assay PCR-hsp70TcTr. Primer HSP70T_R1142Tc (T. cruzi specific) has 1–2 mismatches with T. rangeli at the 3′ terminus, while primer HSP70T_R1249Tr (T. rangeli specific) has four mismatches with T. cruzi. After determining the optimal conditions of each PCR (data not shown), the analytical specificity and sensitivity were tested in a panel of 11 strains representing the studied Trypanosoma species (Table 1 and Figure 3). For all T. cruzi, T. cruzi marinkellei and T. rangeli species, the amplicon size of PCR-hsp70T agreed with the in silico analysis (470 bp, Table 2, Figure 3a). The PCR was able to detect between 10 fg (0.05 parasite genomes) and 100 fg (0.5 parasite genomes, the amount used in Figure 3) of DNA. Nucleotide polymorphisms affecting restriction endonuclease recognition sites for differentiation between T. cruzi and T. rangeli were identified in silico. The enzyme Sau3AI produced restriction fragments of 340/91/39 bp for T. cruzi and T. cruzi marinkellei, and 222/118/109/21 bp for T. rangeli, as confirmed in Figure 3b. No intraspecies diversity was observed in the Sau3AI restriction digests. Restriction endonuclease HaeIII produced fragments of 354/94/22 bp for T. cruzi and T. cruzi marinkellei, and 307/94/47/22 or 307/69/50/ 200

44 bp for T. rangeli, as confirmed in Figure 3c. No intraspecies diversity was observed at the level of HaeIII restriction digests among T. cruzi. Both enzymes thus allow differentiation between the two species, from as little as 100 fg parasite DNA. PCR-hsp70Tc was designed to specifically amplify a 95-bp fragment from the T. cruzi genome. This fragment was obtained from all T. cruzi of the Figure 3 panel, using 10–100 fg DNA, while none of the T. rangeli amplified even from 10 ng DNA. Conversely, the PCRhsp70Tr 202-bp fragment was only amplified from 10 to 100 fg of T. rangeli DNA, but not from up to 10 ng T. cruzi DNA (results not shown). After establishing the optimal conditions for both PCRs, the three primers were combined in the duplex PCR-hsp70TcTr. Figure 3d shows the successful amplification of the 95- and 202-bp fragments from 100 fg DNA in the entire panel and from T. cruzi and T. rangeli, respectively. With regard to the analytical specificity, PCR-hsp70T amplified the fragment of 470 bp in other Trypanosoma species (T. congolense and T. vivax), Leishmania (Viannia) guyanensis and L. (V.) lainsoni, from 10 ng genomic DNA. In T. congolense, an additional fragment of 1100 bp was obtained. In each of these cases, the amplicons could be distinguished from T. cruzi and T. rangeli DNA by RFLP analysis with both enzymes (Figure 3b,c). No PCR-hsp70T amplification was observed from any of the other DNAs from Leishmania, Trypanosoma, other parasites, bacteria or viruses mentioned in the Material and Methods section. As for the duplex PCR-hsp70TcTr, this proved specific as none of the DNAs of the specificity panel were amplified. To mimic mixed infections, several ratios of DNA quantities from both species were tested (Figure 4). The fragment of 470 bp was amplified from each mixture by PCR-hsp70T (Figure 4a). Agarose gel analysis of the digested PCR products showed that T. cruzi and T. rangeli could be detected in a ratio of up to 1:100 in the





T. cruzi DTU = I bp MM SP104 600 (a) 500

II Esm

III

Tcm IV

m6241 CanIII

V

VI

SO3

P63

M1909

T. rangeli RPLA4 CAN AC LEM2946 LEM2963

470 Tvi

400 400 300 (b) 200 100

Tco

LIa Lgu

340 222 118/109 91 39

400 300 (c) 200

354 307

100

94 69 50/47/44

300 (d) 200

202 95

100

Figure 3 PCR-hsp70T, RFLP results and PCR-hsp70TcTr evaluated in a panel of Trypanosoma cruzi, T. cruzi marinkellei (Tcm) and T. rangeli (Table 1). The species, strain name and T. cruzi discrete typing unit (DTU) of each strain are shown on the top. On the right, RFLP patterns are depicted for T. vivax (Tvi), T. congolense (Tco), Leishmania (Viannia) lainsoni (Lla) and L. (V.) guyanensis (Lgu), whereby these gels are aligned with the gels on the left, and only the region containing the T. cruzi and T. rangeli fragments is shown. All T. cruzi, T. cruzi marinkellei and T. rangeli products were amplified from 100 fg DNA, while the other products were amplified from 10 ng DNA. (a) Agarose gel analysis (2%) of PCR-hsp70T. (b) PCR-RFLP patterns on 3% agarose gel obtained with the restriction endonuclease Sau3AI. (c) PCR–RFLP patterns on 3% agarose gel obtained with the restriction endonuclease HaeIII. (d) Agarose gel analysis (2%) of PCR-hsp70TcTr. MM: Molecular weight marker GeneRulerTM 100 bp DNA ladder (MBI Fermentas), with band sizes indicated on the left in base pairs. Size indication of the PCR and RFLP fragments are depicted on the right of the gels in base pairs.

presence of one another (Figure 4b,c), even though the interpretation of the Sau3AI patterns is hampered by the presence of spurious bands at the extreme ratios shown in the left- and rightmost lanes of the gel. PCRhsp70TcTr was able to amplify ratios of up to 1:10 000 (T. cruzi:T. rangeli) and 1:100 (T. rangeli:T. cruzi), respectively (Figure 4d). The detection limit of PCR-hsp70T and PCRhsp70TcTr was evaluated on blood samples spiked with decreasing numbers of living T. cruzi epimastigotes (Figure 5). The lower detection limit of PCR-hsp70T in three T. cruzi strains representing different DTUs was 1–10 parasites per 200 ll blood (Figure 5a). The digestion patterns could be interpreted down to 10 parasites per 200 ll, as the amplicons from lower amounts were too faint for reliable analysis (data not shown). The detection limit of PCR-hsp70TcTr was one T. cruzi parasite per 200 ll blood (Figure 5b). Finally, PCR-hsp70T and PCR-hsp70TcTr were applied on 10 ng DNA from 36 isolates from which the


species is known (Table 1), and Figure 6 shows a selection of results. Of the 17 T. rangeli strains evaluated, only one strain (LEM2947) showed the HaeIII RFLP pattern of 307/69/50/44 bp, and the rest produced fragments of 307/94/47/22 bp. Both RFLP and PCR-hsp70TcTr identified the correct species in each case, except for two isolates of T. rangeli: TBJ2273 and TRC2377. In these, all methods identified DNA of both species, and hence, these are by our method scored as a mixed T. cruzi– T. rangeli infection. Discussion Precise diagnosis of infection with T. cruzi or T. rangeli in naturally infected vectors, reservoirs and humans is relevant for epidemiological studies. Also, considering that inaccurate serological tests can lead to misdiagnosis, unnecessary chemotherapy (frequently accompanied by side effects) and psychological trauma to the patients and their families (Chiurillo et al. 2003), we sought to 201




bp 500 (a) 400

1ng 1ng MM 0.01pg 0.1pg

0.1ng 0.01ng 0.9pg 0.8pg 0.6pg 0.4pg 0.2pg 0.1pg 0.1pg 0.1pg 0.2pg 0.4pg 0.6pg 0.8pg

0.1pg 0.1pg 0.1pg 0.1pg 0.01pg 0.9pg 0.01ng 0.1ng 1ng 1ng

Tc Tr 470

400 300 (b) 200

340 222 118/109 91

100

39 400 300 (c) 200

354 307

100

94 47 22

300 (d) 200

202 Tr

100

95 Tc

Figure 4 Evaluation of artificially mixed ratios of Trypanosoma cruzi (Esm strain) and T. rangeli (CAN AC strain) (Table 1). The amounts of each DNA added in the PCRs are shown on the top, Tc = T. cruzi; Tr = T. rangeli. a–d as in Figure 3. MM: Molecular weight marker GeneRulerTM 100 bp DNA ladder (MBI Fermentas), and band sizes are indicated on the left in base pairs. Size indication of the PCR and RFLP fragments is depicted on the right of each gel in base pairs.

(a)

DTU-III M6241

DTU-I X10/4

6 5 4 3 2 bp MM 10 10 10 10 10 10 10 10 600 500 400

1 1

1

DTU-VI Tula

MM 106 105 104 103 102 10 10 10 1

0

1

1

0

MM 106 105 104 103 102 10 10 10 600 500 400

1

1

1 0

1 1

1

0

MM 106 105 104 103 102 10 10 10 1 300 200 100

1

1 0

600 500 400

(b) 300 200 100

MM 106 105 104 103 102 10 10 10

1 1

1

0 300 200 100

MM 106 105 104 103 102 10 10 10

Figure 5 Sensitivity of PCR-hsp70T (a) and PCR-hsp70TcTr (b) evaluated in three panels of spiked samples of Trypanosoma cruzi on a 2% agarose gel. The T. cruzi strains and discrete typing unit (DTU) are indicated on the top (Table 1). The parasite quantity spiked in 200 ll of blood is shown on the top of each lane, whereby some amounts were tested in triplicate. MM: Molecular weight marker GeneRulerTM 100 bp DNA ladder (MBI Fermentas), and band sizes are indicated on the left in base pairs.

develop a molecular test for detection and differentiation between these two species. Previous PCR studies describing the detection and differentiation between T. cruzi and T. rangeli were designed either with one set of primers amplifying a differently sized fragment for each species (Murthy et al. 1992; Silber et al. 1997; Vallejo et al. 1999; Fernandes et al. 2001), or with species-specific primers (Vargas 202

et al. 2000; Pavia et al. 2007; Ortiz et al. 2009), or as a duplex PCR (Souto et al. 1999; Chiurillo et al. 2003). The majority of these studies evaluated the analytical sensitivity using only one strain per species, and the analytical specificity or parasite mixtures were not tested. We successfully applied PCR-hsp70T followed by digestion with Sau3AI and HaeIII, and PCR-hsp70TcTr to differentiate T. cruzi from T. rangeli. The analytical





bp MM 600 500 400 (a) 300 200

Cutia

Tu18

CM17

Tula

MN

B3

TET2417 TPY2422 TET2408 TET2414 TBJ2273 TRC2377

470

100 500 400 300 (b) 200 100

340 222 118/109 91 39

400 300 200

354 307

100

94

(c)

47 300 200

202 Tr

(d) 100

95 Tc

Figure 6 Application of PCR-hsp70T and its RFLP analysis, and PCR-hsp70TcTr on DNA from cultured parasite isolates. The isolate names (Table 1) are shown on the top. (a–d) as in Figure 3. MM: Molecular weight marker TrackItTM 100 bp ladder (Invitrogen, USA), and band sizes are indicated on the left in base pairs. Size indication of the PCR and RFLP fragments is depicted on the right of each gel in base pairs. Tc = T. cruzi, Tr = T. rangeli.

sensitivity obtained for both PCRs was similar to other PCR assays using as targets kDNA, flagellar protein F29, repetitive DNA element P542, H2A, telomeric sequences and cathepsin L-like proteases (Silber et al. 1997; Vallejo et al. 1999; Vargas et al. 2000; Chiurillo et al. 2003; Pavia et al. 2007; Ortiz et al. 2009). Our PCRs showed higher analytical sensitivity than reported PCRs based on nuclear repeated satellite DNA, the small nuclear RNA C11 gene and the 24S large subunit ribosomal RNA (Breniere et al. 1993; Souto et al. 1999; Pavia et al. 2007), and the specific detection of T. cruzi and T. rangeli based on the 18S ribosomal RNA (rRNA) and the small nucleolar RNA (snoRNA) genes using loop-mediated isothermal amplification (LAMP) (Thekisoe et al. 2010). Only Tanaka (1997) described the use of RFLP for the differentiation between T. cruzi and T. rangeli, based on cysteine proteinase. The detection limit corresponded to a single parasite cell, but mixtures and intraspecies variability were not evaluated. Our RFLPs were applicable on artificially mixed parasite DNAs and on all isolates tested despite their various geographical origins, two parameters often not studied in the above-mentioned reports.


Mixed infections with T. cruzi and T. rangeli have been reported in humans, vectors and reservoir animals (Guhl et al. 1987; Coura et al. 1996; Vargas et al. 2000; Ramirez et al. 2002; Chiurillo et al. 2003; Dias et al. 2007; Pavia et al. 2007; Thekisoe et al. 2010; Salda~ na et al. 2012). Two isolates were detected by our methods as a mixed T. cruzi–T. rangeli infection. They were obtained from Rhodnius ecuadoriensis collected in Ecuador and previously typed as T. rangeli based on minicircle kDNA with S35/S36 primers (PCR-kDNA) (Vallejo et al. 1999). Rhodnius ecuadoriensis is considered one of the domestic and sylvatic vectors of T. cruzi in Ecuador (Vallejo et al. 2009), and natural infection with T. rangeli has been reported before (Guhl & Vallejo 2003). Given the analytical sensitivity and specificity of the RFLP and duplex PCR approach, both methods are adequate for differentiation between T. cruzi and T. rangeli. PCR-hsp70TcTr has two advantages over RFLP: it needs only gel analysis following PCR, and its sensitivity for identifying mixed infections is higher, which is likely related to the fact that the specific primers do not compete for the same template. Hence, it seems the method 203




of choice for analysing clinical samples. A disadvantage of any specific PCR is the danger of cross-reactivity with the other species in case the DNA amounts would be very high, even though we did not detect any problem up to 10 ng DNA, a quantity not expected in clinical samples. RFLP does not suffer from this latter drawback and is the method of choice for analysing highly concentrated culture DNA. Sau3AI is about 10 times the price of HaeIII and tends to produce more spurious bands at high DNA concentrations, probably from incompletely digested products. HaeIII, on the other hand, shows some variability in T. rangeli, and in our opinion, a combination of both enzymes is the best option. This would also ensure timely detection of amplicons from other Trypanosoma or Leishmania species, even though such crossreactions seem exceptional. Our methods are promising candidates for testing on human, animal and environmental samples in clinical and epidemiological studies, but also in some limited-resource settings, where they can be used to the benefit of the patients and populations at risk of Chagas’ disease. Acknowledgements The authors would like to thank all colleagues and institutes who kindly donated the Trypanosoma reference strains and DNA, among whom S. Deborggraeve, P. B€ uscher (Institute of Tropical Medicine, Antwerp, Belgium); F. Guhl (Universidad de los Andes, Bogota, Colombia); M. D. Lewis and M. A. Miles (London School of Hygiene and Tropical Medicine, London, United Kingdom); H. J. Carrasco (Instituto de Medicina Tropical, Caracas, Venezuela); and J. A. Costales and M. J. Grijalva (Centro de Investigaci on en Enfermedades Infecciosas (CIEI), Pontificia Universidad Cat olica del Ecuador, Ecuador and Tropical Disease Institute (TDI), Ohio University, USA). We also thank the Molecular Biology Laboratory (Parasitology, Virology and Bacteriology), IPK, Havana, Cuba. This work was funded by the third framework agreement of the Belgian Directorate General for Development with ITM Antwerp. References Acosta L, Romanha AJ, Cosenza H & Krettli AU (1991) Trypanosomatid isolates from Honduras: differentiation between Trypanosoma cruzi and Trypanosoma rangeli. American Journal of Tropical Medicine and Hygiene 44, 676–683. Breniere SF, Bosseno MF, Barnabe C, Urdaneta-Morales S & Tibayrenc M (1993) Copy number differences in the 195 bp repeated satellite DNA from Trypanosoma cruzi and

204

Trypanosoma rangeli: potential use for epidemiologic surveys. Memoria do Instituto Oswaldo Cruz 88, 163–165. Bryant D & Moulton V (2004) Neighbor-Net: an agglomerative method for the construction of phylogenetic networks. Molecular Biology and Evolution 21, 255–265. Chiurillo MA, Crisante G, Rojas A et al. (2003) Detection of Trypanosoma cruzi and Trypanosoma rangeli infection by duplex PCR assay based on telomeric sequences. Clinical and Diagnostic Laboratory and Immunology 10, 775–779. Coura JR, Fernandes O, Arboleda M et al. (1996) Human infection by Trypanosoma rangeli in the Brazilian Amazon. Transactions of the Royal Society of Tropical Medicine and Hygiene 90, 278–279. Cuervo C, Thomas MC, Lopez MC & Puerta CJ (2013) Sequence polymorphism in the Trypanosoma rangeli HSP70 coding genes allows typing of the parasite KP1(+) and KP1( ) groups. Experimental Parasitology 133, 447–453. D’ Alessandro A & Saravia N (1999). Trypanosoma rangeli. In: Protozoal Diseases. (ed. HM Gilles) Oxford University Press Inc., New York, USA, pp. 398–412. Dias FB, Diotaiuti L, Romanha AJ, Bezerra CM & Machado EM (2007) First report on the occurrence of Trypanosoma rangeli Tejera, 1920 in the state of Ceara, Brazil, in naturally infected triatomine Rhodnius nasutus Stal, 1859 (Hemiptera, Reduviidae, Triatominae). Memoria do Instituto Oswaldo Cruz 102, 643–645. Dorn PL, Engelke D, Rodas A et al. (1999) Utility of the polymerase chain reaction in detection of Trypanosoma cruzi in Guatemalan Chagas’ disease vectors. American Journal of Tropical Medicine and Hygiene 60, 740–745. Fernandes O, Santos SS, Cupolillo E et al. (2001) A mini-exon multiplex polymerase chain reaction to distinguish the major groups of Trypanosoma cruzi and T. rangeli in the Brazilian Amazon. Transactions of the Royal Society of Tropical Medicine and Hygiene 95, 97–99. Fraga J, Veland N, Montalvo AM et al. (2012) Accurate and rapid species typing from cutaneous and mucocutaneous leishmaniasis lesions of the New World. Diagnostic Microbiology and Infectious Disease 74, 142–150. Garcia AL, Parrado R, De DS, Bermudez H & Dujardin JC (2007) American tegumentary leishmaniasis: direct species identification of Leishmania in non-invasive clinical samples. Transactions of the Royal Society of Tropical Medicine and Hygiene 101, 368–371. Greig S, Ashall F & Hudson L (1990) Use of total parasite DNA probes for the direct detection of Trypanosoma cruzi and Trypanosoma rangeli in domicilliary Rhodnius prolixus. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 59–60. Grisard EC, Campbell DA & Romanha AJ (1999) Mini-exon gene sequence polymorphism among Trypanosoma rangeli strains isolated from distinct geographical regions. Parasitology 118, 375–382. Guhl F & Vallejo GA (2003) Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review. Memoria do Instituto Oswaldo Cruz 98, 435–442.





Guhl F, Hudson L, Marinkelle CJ, Jaramillo CA & Bridge D (1987) Clinical Trypanosoma rangeli infection as a complication of Chagas’ disease. Parasitology 94, 475–484. Hotez PJ, Bottazzi ME, Franco-Paredes C, Ault S & Periago MR (2008) The neglected tropical diseases of Latin America and the Caribbean: a review of disease burden and distribution and a roadmap for control and elimination. PLoS Neglected Tropical Diseases 2, e300. Huson DH (1998) SplitsTree: analyzing and visualizing evolutionary data. Bioinformatics 14, 68–73. Huson DH & Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23, 254–267. Kimura M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular and Evolution 16, 111–120. Macedo AM, Vallejo GA, Chiari E & Pena SD (1993) DNA fingerprinting reveals relationships between strains of Trypanosoma rangeli and Trypanosoma cruzi. Experientia Supplementum 67, 321–329. de Miranda Santos IK & Pereira ME (1984) Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes. American Journal of Tropical Medicine and Hygiene 33, 839–844. Montalvo AM, Fraga J, Maes I, Dujardin JC & Van der Auwera G (2012) Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification. European Journal of Clinical Microbiology & Infectious Diseases 31, 1453–1461. Morales L, Romero I, Diez H et al. (2002) Characterization of a candidate Trypanosoma rangeli small nucleolar RNA gene and its application in a PCR-based parasite detection. Experimental Parasitology 102, 72–80. Murthy VK, Dibbern KM & Campbell DA (1992) PCR amplification of mini-exon genes differentiates Trypanosoma cruzi from Trypanosoma rangeli. Molecular and Cellular Probes 6, 237–243. Ortiz PA, da Maia SF, Cortez AP et al. (2009) Genes of cathepsin L-like proteases in Trypanosoma rangeli isolates: markers for diagnosis, genotyping and phylogenetic relationships. Acta Tropica 112, 249–259. Pavia PX, Vallejo GA, Montilla M, Nicholls RS & Puerta CJ (2007) Detection of Trypanosoma cruzi and Trypanosoma rangeli infection in triatomine vectors by amplification of the histone H2A/SIRE and the sno-RNA-C11 genes. Revista do Instuto de Medicina Tropical S~ao Paulo 49, 23–30. Ramirez LE, Lages-Silva E, Alvarenga-Franco F et al. (2002) High prevalence of Trypanosoma rangeli and Trypanosoma cruzi in opossums and triatomids in a formerly-endemic area of Chagas disease in Southeast Brazil. Acta Tropica 84, 189–198. Requena JM, Lopez MC, Jimenez-Ruiz A, de la Torre JC & Alonso C (1988) A head-to-tail tandem organization of hsp70 genes in Trypanosoma cruzi. Nucleic Acids Research 16, 1393–1406.


Salda~ na A, Pineda V, Martinez I et al. (2012) A new endemic focus of Chagas disease in the northern region of Veraguas Province, Western Half Panama, Central America. PLoS One 7, e34657. Schmunis GA & Yadon ZE (2010) Chagas disease: a Latin American health problem becoming a world health problem. Acta Tropica 115, 14–21. Silber AM, Bua J, Porcel BM, Segura EL & Ruiz AM (1997) Trypanosoma cruzi: specific detection of parasites by PCR in infected humans and vectors using a set of primers (BP1/BP2) targeted to a nuclear DNA sequence. Experimental Parasitology 85, 225–232. Souto RP, Vargas N & Zingales B (1999) Trypanosoma rangeli: discrimination from Trypanosoma cruzi based on a variable domain from the large subunit ribosomal RNA gene. Experimental Parasitology 91, 306–314. Sturm NR, Degrave W, Morel C & Simpson L (1989) Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas’ disease. Molecular and Biochemical Parasitology 33, 205–214. Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739. Tanaka T (1997) Differential diagnosis of Trypanosoma cruzi and T. rangeli infection by PCR of cysteine proteinase genes. Kansenshogaku Zasshi 71, 903–909. Thekisoe OM, Rodriguez CV & Rivas F (2010) Detection of Trypanosoma cruzi and T. rangeli infections from Rhodnius pallescens bugs by loop-mediated isothermal amplification (LAMP). American Journal of Tropical Medicine and Hygiene 82, 855–860. Vallejo GA, Macedo AM, Chiari E & Pena SD (1994) Kinetoplast DNA from Trypanosoma rangeli contains two distinct classes of minicircles with different size and molecular organization. Molecular and Biochemical Parasitology 67, 245–253. Vallejo GA, Guhl F, Chiari E & Macedo AM (1999) Species specific detection of Trypanosoma cruzi and Trypanosoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Tropica 72, 203–212. Vallejo GA, Guhl F, Carranza JC et al. (2002) KDNA markers define two major Trypanosoma rangeli lineages in Latin-America. Acta Tropica 81, 77–82. Vallejo GA, Gulh F & Schaub GA (2009) Triatominae–Trypanosoma cruzi/T. rangeli: vector–parasite interactions. Acta Tropica 110, 137–147. Vargas N, Souto RP, Carranza JC, Vallejo GA & Zingales B (2000) Amplification of a specific repetitive DNA sequence for Trypanosoma rangeli identification and its potential application in epidemiological investigations. Experimental Parasitology 96, 147–159.

205




Veland N, Boggild AK, Valencia C et al. (2012) Leishmania (Viannia) species identification on clinical samples from cutaneous leishmaniasis in Peru: assessment of a molecular stepwise approach. Journal of Clinical Microbiology 50, 495–498. WHO – World Health Organization (2010) Chagas disease (American trypanosomiasis) fact sheet (revised in June 2010). The Weekly Epidemiological Record 85, 329–336.

World Health Organization. (2007) Report of the scientific working group on Chagas disease. (http://whqlibdoc.who.int/ hq/2007/TDR_SWG_09_spa.pdf). Accessed May 2012. Zingales B, Miles MA, Campbell DA et al. (2012) The revised Trypanosoma cruzi subspecific nomenclature: rationale, epidemiological relevance and research applications. Infection Genetics and Evolution 12, 240–253.

Corresponding Author Gert Van der Auwera, Department of Biomedical Sciences, Institute of Tropical Medicine (ITM), Nationalestraat 155, 2000 Antwerp, Belgium. Tel.:+32 3 2476586; Fax +32 3 2476359; E-mail: [email protected]

206
