Parasitol Res (2014) 113:4225–4232 DOI 10.1007/s00436-014-4098-z
ORIGINAL PAPER
The geographical distribution and first molecular analysis of Culicoides Latreille (Diptera: Ceratopogonidae) species in the Southern and Southeastern Turkey during the 2012 outbreak of bovine ephemeral fever B. Dik & D. Muz & M. N. Muz & U. Uslu
Received: 11 July 2014 / Accepted: 25 August 2014 / Published online: 9 September 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract This study investigated the geographical distribution and molecular analysis of Culicoides species in the Southern and Southeastern Turkey during the 2012 outbreak of bovine ephemeral fever (BEF). The midge specimens caught by Onderstepoort-type light traps from livestock farms were tested for molecular evidence of existence of viral genome. Blood specimens were collected from clinically BEFsuspected acute febrile cattle. Total nucleic acid samples obtained from field specimens were checked against the BEF virus G gene and Culicoides internal transcribed spacer 1 (ITS-1) gene. A total of 20,845 Culicoides specimens (20,569 ♀♀, 276 ♂♂) comprising 11 species (Culicoides badooshensis, Culicoides circumscriptus, Culicoides gejgelensis, Culicoides imicola, Culicoides kibunensis, Culicoides longipennis, Culicoides newsteadi, Culicoides nubeculosus, Culicoides odiatus, Culicoides punctatus, Culicoides schultzei, Culicoides spp.) were collected. C. schultzei (18,032) was found as the dominant species and followed by C. imicola (1,857), C. nubeculosus complex (545), and C. circumscriptus (259), respectively. C. kibunensis was identified as new species for this region. PCR positivity of BEF was found 37.14 % (13/35) in blood samples whereas no viral genome was obtained from Culicoides specimens. Culicoides spp. ITS-1 gene sequences were analyzed B. Dik (*) : U. Uslu Department of Parasitology, Faculty of Veterinary Medicine, Selçuk University, Konya, Turkey e-mail:
[email protected] D. Muz (*) Department of Virology, Faculty of Veterinary Medicine, Namik Kemal University, Tekirdağ, Turkey e-mail:
[email protected] M. N. Muz Department of Parasitology, Faculty of Veterinary Medicine, Namik Kemal University, Tekirdağ, Turkey
phylogenetically with GenBank ITS-1 sequences. Molecular homology of Culicoides ITS-1 gene was ranged between 62.74 and 71.39 %. The results described first molecular detection and phylogenetic analysis of Culicoides ITS-1 gene with reference to the 2012 BEF outbreak in Turkey. Keywords Culicoides . ITS-1 gene . Bovine ephemeral fever virus . Insect vector . Turkey
Introduction Culicoides (Diptera: Ceratopogonidae) are small hematophagous midges (0.5 to 3 mm) with more than 1,400 species (Capinera 2008) described worldwide. Females of some nematocerid bloodsucking flies are vectors of human and animal arboviruses and cause significant socioeconomic injuries (Carpenter et al. 2013). The significance of Culicoides in veterinary medicine is derived from their main roles affecting on potential spread of epizootic diseases (Mellor et al. 2000; Finlaison et al. 2010; Walker 2005). Bovine ephemeral fever virus (BEFV) belonging to Ephemerovirus genus of the Rhabdoviridae family causes economically important seasonal acute vectorborne disease which is the “bovine ephemeral fever” (BEF) characterized by biphasic fever, depression, lameness, recumbency, joint swelling, rear limb paralysis, nasal and ocular discharge, excessive salivation, stiffness, sudden drop in milk production, delayed estrus, reduced conception rates, midterm abortions, and spontaneous recovery in three days also known as three-day stiff-sickness through subtropical and temperate regions of the Middle East, Asia, Africa, and Australasia (Nandi and Negi 1999; Finlaison et al. 2010; Walker 2005).
4226
BEF epidemics had been reported with four- to five-year intervals in Turkey during summer and early autumn. As it was first reported in 1985 (Girgin et al. 1986), the last two outbreaks were reported in 2008 and 2012 from the Southern and Southeastern Turkey with wave-like epizootics (Erganis et al. 2010; Tonbak et al. 2013; Oğuzoğlu et al. 2013). Moreover, the 2008 outbreak of BEF took place in Israel in a simultaneous season (Erganis et al. 2010; Aziz-Boaron et al. 2012). Development of preventive veterinary medicine rules and public health measures are so important although bioecological aspects of the vector Culicoides biting midges are not perfectly understood (Muller and Standfast 1992; Murray 1997; Nandi and Negi 1999; Yeruham et al. 2010). However, BEFV was firstly isolated from Culicoides specimens’ pool in Kenya (Davies and Walker 1974), from Culicoides coarctatus, from Culicoides imicola in Zimbabwe (Blackburn et al. 1985), and from Culicoides brevitarsis in Australia (Nandi and Negi 1999). Seasonal occurrence of BEF in summer and autumn in the Mediterranean basins and Middle East has suggested the main role of insect vector in transmission. Turkey is located in a transitional geography between Europe, Asia, and the Middle East. The control of animal movements may limit BEFV epidemics, but vector arthropods can easily spread by winds among borders (Aziz-Boaron et al. 2012; Hubálek et al. 2014). Fifty-eight up-to-date Culicoides species were identified in Turkey, but their potential role of being BEF vector in any outbreak are not well defined. Hatay is the nearest part of Turkey to Israel and the Jordan Valley which suffered from windborne insect-mediated BEF epidemics originated from the Middle East as discussed by Aziz-Boaron et al. (2012) and Yeruham et al. (2005; 2010). The morphological and molecular diagnostic methods are used efficiently to detect and identify Culicoides specimens in epidemiological field studies. Several molecular tools and markers have been developed for identification and phylogenetic analysis describing their genetic relationship. The first internal transcribed spacer (ITS-1) gene of ribosomal DNA (rDNA) is suggested as good phylogenetic molecular marker useful for phylogenetic studies (Cetre-Sossah et al. 2004; Kiehl et al. 2009a; Perrin et al. 2006). This study investigated the geographical distribution and molecular analysis of Culicoides species in the Southern and Southeastern Turkey during the 2012 outbreak of bovine ephemeral fever (BEF), and midges were tested for molecular evidence of existence of viral genome. So we describe the presence of an epizootic virus in clinically BEF-suspected sentinel herds at the summer and autumn in an outbreak with special reference to Culicoides fauna.
Parasitol Res (2014) 113:4225–4232
Material and method Geography and climate Research area was selected in the Southern and Southeastern Turkey where previous BEF epidemic had been reported (Erganis et al. 2010) and because it has served potential living spaces for midges. Sampling area is located across the Syrian borderline and also at the nearest site of Turkey to Israel and the Jordan Valley in the Middle East. Culicoides specimen samples were collected from Adana (Ceyhan-Mercimek, Seyhan-Sarıhamzalı town), Hatay (Serinyol, Centrum, Şenköy), Gaziantep (Ermiş town, İbrahimli town, Nizip, Centrum), Şanlıurfa (Akçakale, Büyükminare town, Centrum), and Adıyaman (Centrum) between July and September 2012, overall ≈300 km in diameter (Fig. 1). The research area including 13 settlements is located under Köppen climate classification “Csa” subtypes (Kottek et al. 2006). The climate during the field study had high humidity and temperature during the subtropic season (Table 1). Two of five cities (Adana, Hatay) located in the Mediterranean region had also higher humidity and temperature whereas the other sampling sites (Adıyaman, Gaziantep, Şanlıurfa) had the highest temperature in semiarid region features.
Collection of Culicoides species and morphological identification Onderstepoort-type 220 W blacklight traps with suction fan plugs and collector units were used to catch Culicoides specimens from 13 sites in the Southern and Southeastern Anatolia regions of Turkey. Light traps were operated near a cattle in open paddocks closed to the sunset. Night lighting circuit system across paddocks got off until sunrise to increase the number of captured midges. All traps were operated from dusk until dawn. Trap collector units were tipped out to specimen tubes and transferred to the laboratory in cold chain. All specimens encountered, females were identified at species level under stereomicroscope, 100 to 500 specimens, were grouped by species, origin, and date and stored in capped tubes. Identification of Culicoides species was performed based on wing-spot pattern and other morphological features as described previously (Dik et al. 2006a; Mehlhorn et al. 2009a). After morphological identification samples were stored at −80 °C until genetic analysis. Herds In this survey, 35 acute febrile BEF symptomatic cattles from 12 different herds and more than 10,000 Holstein-breed cattles
Parasitol Res (2014) 113:4225–4232
4227
Fig 1 Culicoides trapping sites
were sampled. Blood sampling was obtained simultaneously with Culicoides specimen collection. EDTA-treated field blood samples collected from Şanlıurfa (n=16) and Hatay (n=19) were sent to the laboratory in cold chain. All animals were treated with non-steroidal anti-inflammatory drugs and antibiotics against secondary infections with intravenous electrolyte support. Extraction, PCR amplification, and sequencing The molecular detection of Culicoides specimens and the existence of viral genome from midges and blood samples were investigated by PCR method. The identified Culicoides samples were homogenized in phosphate-buffered cold solution (Sigma, USA) within 1–250 specimens pools. Buffy coats were used for the purpose of RNA extraction from blood samples. RNA extraction was carried out from the supernatant by a commercial kit (QIAGEN, RNeasy Mini Kit, Germany), and then a reverse transcription reaction was performed by using complementary DNA (cDNA) synthesis kit (RevertAid
first strand cDNA synthesis kit, Fermentas) according to the manufacturer’s instructions. A total genomic DNA of Culicoides samples was obtained by a phenol-chloroform extraction method as described previously (Sambrook et al. 1989). Bovine ephemeral fever virus G gene (envelope glycoprotein) was amplified using previously reported specific primers [G1F: ATGTTCAAGGTCCTCATAATTACC, G1R: TAAT GATCAAAGAACCTATCATC (Wang et al. 2001), G3/ 761 F: TTGAGGATGGAGAATGGTGG, G3/1581R: TACAACAGCAGATAAAAC (Hsieh et al. 2006), G681F: ATGGGAGGCTCCAGATATCGGG, G1310R: GCTTCG TTCCGGAGCTTCCT (Kato et al. 2009)] in PCR. Culicoides internal transcribed spacer 1 (ITS-1) gene specific primers [PanCulF: GTAGGTGAACCTGCGGAAGG, PanCulR: TGCGGTCTTCATCGACCCAT (Cetre-Sossah et al. 2004)] were used as internal control of both RNA extraction and reverse transcription polymerase chain reaction (RT-PCR) and for the purpose of molecular analysis of Culicoides spp. from genomic DNA. Hot Start Taq DNA Polymerase kit
Table 1 Geographic trap locations, meteorological, and field data in this survey Time period of sampling
July
Origin of samples
Specimen
Adana (35 E 18 37 N 01) Hatay (36 E 12 36 N 52) Gaziantep (37 E 22 37 N 05) Adıyaman (38 E 17 37 N 46) Şanlıurfa (38 E 46 37 N 08) Total
August
1,238
Average temperature (°C) 28.1
1,834
217
Average temperature (°C) 28.5
27.2
71
851
27.7
77 955 4,955
Specimen
September
7,145
Average temperature (°C) 25.9
8,600
27.8
1,072
25.5
2,977
50
27.4
392
22.8
1,293
31.0
-
30.5
154
25.6
231
31.9
3,769
31.2
3,020
26.7
7,744
4,107
Specimen
Total
11,783
20,845
4228
(Maxima Hot Start Taq DNA Polymerase, Fermentas) was used in a total reaction volume of 50 μl consisting of 10 μl of cDNA template (~0.1 μg), 10 times buffer, 3 mM MgCl2, 0.2 mM dNTP mix, 0.3 μM of each primer, and 2 U hot start Taq polymerase. PCR condition was used according to the primer pairs’ literatures above. DNA bands were visualized with a UV transilluminator (UVP Inc., USA). PCR products were purified using a commercial purification kit (Sigma, USA) and sequenced in an Applied Biosystems’ DNA analyzer. Sequences were evaluated and aligned using BLAST web service and BioEdit (v.7.2.4), respectively. Phylogenetic analysis was conducted by the neighbor-joining method with bootstrapping of 1,000 replicates using MEGA 6.0 software (Tamura et al. 2013).
Results Morphological identification and geographical distribution of Culicoides species During field surveillance, light traps were operated 31 times in outbreak-reported zones (Adana, 8; Adıyaman, 3; Gaziantep, 7; Hatay, 9; Şanlıurfa, 6). A total of 20,845 Culicoides specimens (20,569 ♀♀, 276 ♂♂) were collected, and 11 species (Culicoides badooshensis, Culicoides circumscriptus, Culicoides gejgelensis, C. imicola, Culicoides kibunensis, Culicoides longipennis, Culicoides newsteadi, Culicoides nubeculosus, Culicoides odiatus, Culicoides punctatus, Culicoides schultzei) were identified among Culicoides samples (Table 2). C. kibunensis was identified as a new species for this region. From Adana, 8,600 specimens were collected (8,496 ♀♀, 104 ♂♂), 7,744 from Şanlıurfa (7,744 ♀♀), 2,977 from Hatay (2,946 ♀♀, 31 ♂♂), 1,293 from Gaziantep (1,163 ♀♀, 130 ♂♂), and 231 from Adıyaman (220 ♀♀, 11 ♂♂). Percentages of specimens captured in the field survey were the following: C. schultzei s.s., 86.51 %; C. imicola s.s., 8.91 %; C. nubeculosus komp., 2.61 %; and C. circumscriptus, 1.24 %, and other species were recorded too less. The most prevalent field species were determined as C. schultzei complex with a number of 18,032 specimens, C. imicola complex, 1,857; C. nubeculosus complex, 545; and C. circumscriptus with 259,. Other Culicoides specimens caught were quite less like C. punctatus with two and C. kibunensis with only one specimen (Table 2). While all captured specimens from Adana and Şanlıurfa were described at species level, the six specimens from Adıyaman, four specimens from Gaziantep, and 19 specimens from Hatay due to their unspotted wings could not be described at Culicoides species level. Excluding these unspotted winged Culicoides species, the species variety was ranked as follows:
Parasitol Res (2014) 113:4225–4232
11, nine, eight, six, and five from Adıyaman, Gaziantep, Hatay, Şanlıurfa, and Adana, respectively. Investigation of BEFV genome from Culicoides species Culicoides specimens were sorted to 155 groups according to their origin, species, and collection date. A total of 410 RNA samples were obtained and converted to cDNA by RT-PCR. The 13 blood samples (13/35) from Şanlıurfa (n=6) and Hatay (n=7) were found as BEFV positive. All tested Culicoides specimens were found as BEFV negative by PCR whereas they were found ITS-1 gene PCR positive. Molecular identification and phylogenetic analyses of Culicoides species based on ITS-1 gene The obtained ITS-1 products were sequenced and phylogenetically analyzed. New sequences were recorded in GenBank as C. schultzei, C. circumscriptus, and C. nubeculosus with accession number of KJ818241-KJ818243. The lengths of ITS-1 sequences were 384 bp for C. schultzei, 507 bp for C. circumscriptus, and 412 bp for C. nubeculosus. The sequences were closely related to each other with a similarity rate ranged between 62.74 and 71.39 %. C. schultzei has 62.74 and 70.95 % similarity rates with C. circumscriptus and C. nubeculosus, respectively, whereas C. circumscriptus showed a 71.39 % similarity rate with C. nubeculosus. In order to look at the possible similarity within the same specimens of Culicoides obtained from GenBank, C. schultzei ITS-1 sequences from Israel were analyzed with our obtained C. schultzei sequence and a similarity between 75.38 and 76.71 % was show, whereas a higher similarity was found in C. circumscriptus sequences from France with our obtained C. circumscriptus sequence by 99.11 % rate. Comparison of our obtained C. nubeculosus sequence with UK and France originated from C. nubeculosus sequences; similarity rate was 89.35 and 89.9 %, respectively. The phylogenetic tree was constructed with two different methods: maximum likelihood (data not shown) and neighbor joining (Fig. 2) using 14 ITS-1 sequences from GenBank. The results of both methods were shown in similar groups. The obtained three sequences in this study were branched in three different branches with the same specimen patterns. Their taxonomic status in the phylogenetic tree was found parallel with morphological identification.
Discussion Turkey is located between Europe, Asia, and the Middle East with suitable ecogeography for dispersion of vector insects. So increasing numbers of studies were reported on Culicoides
Parasitol Res (2014) 113:4225–4232 Table 2 Distribution of the Culicoides specimens collected from the Southern and Southeastern Turkey
4229
Culicoides species
Adana
Şanlıurfa
Hatay
Gaziantep
Adıyaman
Total
C. badooshensis C. circumscriptus C. gejgelensis C. imicola C. kibunensis
– 10 – 187 –
– 6 1 20 –
– 86 37 904 –
2 157 2 715 –
34 – 2 31 1
36 259 42 1,857 1
C. longipennis C. newsteadi C. nubeculosus komp C. odiatus C. punctatus C. schultzei Culicoides spp. Total
6 – 8 – – 8,389 – 8,600
1 – 274 – – 7,442 – 7,744
3 – 110 2 – 1,816 19 2,977
– 2 149 4 – 258 4 1,293
8 15 4 1 2 127 6 231
18 17 545 7 2 18,032 29 20,845
et al. 1992; Dik 1993; Tilki and Dik 2003; Dik et al. 2010, 2012). C. circumscriptus and C. schultzei were reported without any exception; C. imicola, C. longipennis, C. odiatus, and Culicoides pulicaris were reported in most of the studies. On the other hand, Culicoides dewulfi, Culicoides bulbostylus, Culicoides furcillatus, Culicoides kurensis, Culicoides
fauna of Turkey during the last 25 years while most of them were restricted in several regions (Tilki and Dik 2003; Dik et al. 2006a, 2006b). Results of previous studies were the following: 58 species were identified for Culicoides midge fauna of Turkey (Turgut 2011), and 36 species identified for the Southern and Southeastern Turkey (Navai 1977; Burgu
KF178259-C.nubeculosus-France
Fig 2 Phylogenetic tree among internal transcribed spacer 1 (ITS1) sequences of Culicoides from Turkey. Neighbor-joining method was used with bootstrap value (1,000 replicates) on branches. The marked sequences were analyzed in this study whereas other sequences were obtained from GenBank: KF178258KF178259 (Augot et al. 2013) AY861144- AY861151AY861152- AY861156AY861163 (Perrin et al. 2006) from France; FN263292FN263295- FN263298 (Kiehl et al. 2009b) from Germany; AJ417982 from UK; JN408474JN408475- JN408480 (Morag et al. 2012) from Israel; AB462261- AB462275 from Japan; EU306662 from India
98 95
KF178258-C.nubeculosus-France AJ417982-C.nubeculosus-UK C.nubeculosus-TR72912
52
C.schultzei-TR72811 89
48
JN408475-C.schultzei-Israel 100 JN408474-C.schultzei-Israel
100
AB462275-C.punctatus-Japan FN263298-C.pulicaris-Germany AY861151-C.newsteadi-France
91
AY861156-c.pulicaris-France
100
AY861163-C.circumscriptus-France
57 100
C.circumscriptus-TR72910
98 AY861144-C.imicola-France 89
JN408480-C.imicola-Israel AB462261-C.brevitarsis-Japan
51
AY861152-C.obsoletus-France 76
FN263292-C.obsoletus-Germany 86 FN263295-C.obsoletus-Germany
EU306662-Culexpipiens 0.1
4230
maritimus, Culicoides montanus, and Culicoides minutissimus were reported only by Navai (1977) from these regions. Also Culicoides denisoni, Culicoides fascipennis, Culicoides ibericus, C. newsteadi, Culicoides pumilus, C. punctatus, Culicoides tauricus, Culicoides parroti, Culicoides picturatus, and Culicoides subneglectus were reported in few field studies (Dik 1993; Dik et al 2012; Dik et al 2010; Burgu et al. 1992). In this survey, 11 Culicoides specimens were recorded from five cities. More than 20,000 Culicoides specimens were collected, and this is the highest number recorded in Turkey up to date. Ten Culicoides species were identified, and C. kibunensis was recorded as a new species for Southeastern Turkey. To avoid misidentification and to correct identification of vector species are epidemiologically important implications. So the knowledge of which species could act as vector is essential to assess for the disease control of epidemics (Perrin et al. 2006). The morphological identification of Culicoides specimens can be difficult, and an expert is essential. For the molecular detection and identification of Culicoides specimens, many PCR-based methods have been developed. The ITS-1 gene of Culicoides genome is suggested as a reliable and useful region for diagnosis and genetic investigations of midges (Cetre-Sossah et al. 2004; Kiehl et al. 2009a; Perrin et al. 2006). The ITS-1 gene was also used as a reliable marker in correct molecular identification of Culicoides species in this study. The climatic conditions of the Southern and Southeastern Turkey have similar features with the Mediterranean basin and Middle East. Insect vectors can be transported by winds leading to the circulation and transmission of infectious diseases and emerges epidemics among neighboring countries. C. imicola has been reported one of the vectors of BEF in the Mediterranean basin and Middle East countries; also, C. schultzei could have a role in transmission (Mellor et al. 2000; Aradaib and Ali 2004). Culicoides marksi, C. brevitarsis, and Culex annulirostris were suggested as potential vectors in experimental investigations of BEF (Kirkland 1992). BEFV was detected from an infected cattle in previous outbreaks (Erganis et al. 2010; Tonbak et al. 2013; Oğuzoğlu et al. 2013) but not from vectors in Turkey. Here more than 20,000 midges were assayed in pools, but BEFV genome could not be detected while 37.14 % BEFV positivity was found in a cattle. C. schultzei was found the most dominant species followed by C. imicola in BEFV endemic regions. The possibility of BEF vector is a priori for both Culicoides species and is in progress. It was reported previously by Kirkland (1992) that BEFV is not enduring and uneasy to isolate from vectors although at once isolated from numerous C. brevitarsis and some mosquito specimens. It was suggested that wind-borne insect vectors have a role on the spread of BEF between geographically
Parasitol Res (2014) 113:4225–4232
distant areas and could be responsible for new outbreaks (Aziz-Boaron et al. 2012). BEF was first identified in the middle of 1980s in the Southern Turkey (Girgin et al. 1986), and continuation of the outbreaks was reported. Economic injuries were reported after epidemics, and despite its economic importance, little is known about host-vector epidemiology of BEF. It is important that the closest region of Turkey to Israel and the Jordan Valley is Hatay. The outbreaks of BEF in Turkey and bluetongue disease in Northwestern Europe were thought to have originated from Culicoides species in which they played the role of a vector in continental transmission of the both viruses (Clausen et al. 2009; Dik et al. 2012). Results of the German monitoring program revealed that the putative intercontinental AfroAsiatic vector of bluetongue virus (BTV) which is the C. imicola has not managed to enter the Western Europe. But in Germany, Culicoides obsoletus was reported the absolute predominant species, and C. dewulfi has an increasing significance as a vector for BTV besides C. obsoletus in the Netherlands. On the other hand, BTV vector species C. obsoletus and C. pulicaris are reported from the Northern border of the Mediterranean Sea until South Scandinavia (Mehlhorn et al. 2008). Comparably, C. imicola has been reported one of the vectors of BEF in the Mediterranean basin and Middle East countries (Mellor et al. 2000; Aradaib and Ali 2004), but C. schultzei was found extraordinary but predominant species in the BEF disease endemic outbreak in the region of Turkey. Results of these researches bring to mind that the effect of globalization such as the intensive worldwide import and export of animals may be a primary result of sudden outbreak of BEF disease similarly described by Mehlhorn et al. (2008). Unbounded animal movements which are criminal offenses under the Turkish government laws reported in Southeastern Turkish rural borderlines started a parallel time period with immigration of defectors from Syria to Turkey in 2011. The possibility of cattle smugglers may graze the herds from South Syria to the North more than 250 km only in short weeks, so this may increase susceptibility to disease commonly in animals. Most of them may be slaughtered but somewhat alive. In this case, other options instead of wind-borne insect-mediated BEFV transmission may switch with unbounded animal movements. As a result of globalization which is a “biological threat” similar viruses like BEF, African horse sickness, Rift Valley fever, or Dengue fever perhaps have already knocked at the doors of the fortress of Europe, where sufficient potential vectors are waiting for the arriving pests (Mehlhorn et al. 2009a). As there is a thought of northward migration of Culicoides specimens from Africa and the Middle East to Turkey and Europe through winds, globalization and animal transportation are very probably effective on emerging outbreaks of many virus diseases
Parasitol Res (2014) 113:4225–4232
in Turkey and Europe as discussed by Mehlhorn et al. (2009b).
Conclusions Culicoides-borne viral diseases cause economic losses to husbandry, and less data described the distribution, population dynamics, and host-vector epidemiology of these insects. This is the first investigation for Culicoides identification in parallel time to BEF epidemic. Culicoides species were identified in the 2012 outbreak of BEF in the Southern and Southeastern Turkey. Excluding unspotted winged species, 11 Culicoides species were recorded. One of the uncertain vector species for BEFV, the C. imicola was found second dominant species after Culicoides schultzei which was another suspected vector although all midges were found BEFV PCR negative. The geographical distribution and molecular analysis of Culicoides specimens based on ITS-1 gene were studied firstly in Turkey, and new ITS-1 gene sequence information are recorded. Results showed current ITS-1 gene sequences placed with their European and Middle Eastern partners on same branches. The status of the vector insects are not certain in hostvector epidemiology of BEFV in Turkey. Culicoides, therefore, are world players in the epidemiology of many important arboviral diseases. The occurrence of the disease in epidemics separated by long intervals has resulted in a cattle population that is highly susceptible to the disease. This survey was investigated during a regional epizootic in a small capacity of herds, and based on the results, needed steps should be taken to determine the pattern of spread and to prevent and manage any outbreaks. Acknowledgements This research was partially funded by Selcuk University Scientific Research Council, res.no: 12401031. Researchers thank to Prof.Dr. Osman Erganis supply of BEFV as positive control.
References Aradaib I, Ali N (2004) Current status and future prospects of epizootic haemorrhagic disease of deer—a review. Veterinarski Arhiv 74:68– 83 Augot D, Ninio C, Akhoundi M, Lehrter V, Couloux A, Jouet D, Depaquit J (2013) Characterization of two cryptic species, Culicoides stigma and C. parroti (Diptera: Ceratopogonidae), based on barcode regions and morphology. J Vector Ecol doi:10.1111/j. 1948-7134.2013.12039 Aziz-Boaron O, Klausner Z, Hasoksuz M, Shenkar J, Gafni O, Gelmanc B, David D, Klement E (2012) Circulation of bovine ephemeral fever in the Middle East—strong evidence for transmission by winds and animal transport. Vet Microbiol 158:300–307 Blackburn NK, Searle L, Phelps RJ (1985) Viruses isolated from Culicoides (Diptera: Ceratopogonidae) caught at the veterinary research farm, Mazowe, Zimbabwe. J Entomol Soc S Afr 48:331–336
4231 Burgu İ, Urman HK, Akça Y, Yonguç A, Mellor PS, Hamblin C (1992) Serologic survey and vector surveillance for bluetongue in southern Turkey. Walton TE, Ousburn BI, Eds. Bluetongue, African horse sickness and related arboviruses, Boca Raton: CRC Press, Florida, p: 168–174 Capinera JL (2008) Biting midges, Culicoides spp. (Diptera: Ceratopogonidae), Encyclopedia of entomology, Springer Science & Business Media, Springer; 2nd edition, ISBN-10: 1402062427, http:// www.springerreference.com/docs/html/chapterdbid/85541.html Carpenter S, Groschup MH, Garros C, Felippe-Bauer ML, Purse BV (2013) Culicoides biting midges, arboviruses and public health in Europe. Antivir Res 100:102–113 Clausen PH, Stephan A, Bartsch S, Jandowsky A, Hoffmann-Köhler P, Schein E, Mehlitz D, Bauer B (2009) Seasonal dynamics of biting midges (Diptera: Ceratopogonidae, Culicoides spp.) on dairy farms of Central Germany during the 2007/2008 epidemic of bluetongue. Parasitol Res 105(2):381–386 Cetre-Sossah C, Baldet T, Delecolle JC, Mathieu B, Perin A, Grillet C, Albina E (2004) Molecular detection of Culicoides spp. and Culicoides imicola, the principal vector of bluetongue (BT) and African horse sickness (AHS) in Africa and Europe. Vet Res 35: 325–337 Davies FG, Walker AR (1974) The isolation of ephemeral fever virus from cattle and Culicoides midges in Kenya. Vet Rec 95:63–64 Dik B (1993) Adana, İçel ve Antalya yörelerinde bulunan Culicoides Latreille, 1809 (Diptera: Ceratopogonidae) türlerinin tespiti. Türk Vet Hek Derg 5:48–55 Dik B, Yagcı Ş, Linton YM (2006a) A review of species diversity and d i s t r i b u t i o n o f C u l ic o i d es L a t r e i l l e , 1 8 0 9 ( D i p t e r a : Ceratopogonidae) in Turkey. J Nat Hist 40:1947–1967 Dik B, Karatepe M, Karatepe B, Yağcı Ş (2006b) Niğde yöresi CulicoidesLatr, 1809 (Diptera: Ceratopogonidae) türleri. Turkiye Parazitol Derg 30:121–124 Dik B, Yaman M, Uslu U (2010) Hatay yöresi Culicoides (Diptera: Ceratopogonidae) Türleri. Kafkas Üniv. Vet Fak Derg 16:255–258 Dik B, Yavru S, Uslu U, Yapıcı O, Esin E (2012) Determination of Culicoides species (Diptera: Ceratopogonidae) and suspect vectors of epizootic haemorrhagic disease virus and bluetongue virus in Culicoides specimens by RT-PCR in southern and western Anatolia. Rev Med Vet 163:505–510 Erganis O, Yavru S, Sayin Z, Bulut O, Hasoksuz M, Ozdarendeli A, Balevi A, Kav K, Avci O, Akyel U, Toslak M (2010) The development of vaccine for bovine ephemeral fever infection In: 9th National Veterinary Microbiology Congress. Republic of North Cyprus, Lefkose Finlaison DS, Read AJ, Kirkland PD (2010) An epizootic of bovine ephemeral fever in New South Wales in 2008 associated with long-distance dispersal of vectors. Aust Vet J 88: 301–306 Girgin H, Yonguç AD, Akçora A, Aksak E (1986) Türkiye'de ilk bovine ephemeral fever salgını. Etlik Vet Mikrob Enst Derg 5:5–14 Hsieh YC, Wang SY, Lee YF, Chen SH, Mak PO, Chu CY (2006) DNA sequence analysis of glycoprotein G gene of bovine ephemeral fever virus and development of a double oil emulsion vaccine against bovine ephemeral fever. J Vet Med Sci 68:543–548 Hubálek Z, Rudolf I, Nowotny N (2014) Arboviruses pathogenic for domestic and wild animals. Adv Virus Res 89:201–275 Kato T, Aizawa M, Takayoshi K, Kokuba T, Yanase T, Shirafuji H, Tsuda T, Yamakawa M (2009) Phylogenetic relationships of the G gene sequence of bovine ephemeral fever virus isolated in Japan, Taiwan and Australia. Vet Microbiol 137:217–223 Kiehl E, Walldorf V, Klimpel S, Al-Quraishy S, Mehlhorn H (2009a) The European vectors of bluetongue virus: are there species complexes, single species or races in Culicoides obsoletus and C. pulicaris detectable by sequencing ITS-1, ITS-2 and 18S-rDNA? Parasitol Res 105:331–336
4232 Kiehl E, Walldorf V, Klimpel S, Al-Quraishy S, Mehlhorn H (2009b) Genebank accession numbers of sequences of Culicoides species vectors of bluetongue virus in Germany. Parasitol Res. doi:10.1007/ s00436-009-1449-2 Kirkland PD (1992) The epidemiology of bovine ephemeral fever in South-Eastern Australia: evidence for a mosquito vector. “Bovine ephemeral fever and related rhabdoviruses”, Eds: St George TD, Uren MF, Young PL, Hoffmann D, Proceedings of the 1st international symposium held in Beijing, PRC 33-37. Kottek M, Grieser J, Beck C, Rudolf B, Rubel F (2006) World map of the Köppen-Geiger climate classification updated. Meteorol Z 15:259–263 Mehlhorn H, Walldorf V, Klimpel S, Schmahl G (2008) Outbreak of bluetongue disease (BTD) in Germany and the danger for Europe. Parasitol Res doi:. doi:10.1007/s00436-008-1100-7 Mehlhorn H, Walldorf V, Klimpel S, Schaub G, Kiel E, Liebisch G, Liebisch A, Werner D, Bauer C, Clausen H, Bauer B, Geier M, Bätza H, Conraths F, Hoffmann B, Beer M (2009a) Bluetongue disease in Germany (2007–2008): monitoring of entomological aspects. Parasit Res 105:313–319 Mehlhorn H, Walldorf V, Klimpel S, Schmahl G, Al-Quraishy S, Walldorf U, Mehlhorn B, Bätza HJ (2009b) Entomological survey on vectors of blue tongue virus in Northrhine-Westfalia (Germany) during 2007 and 2008. Parasitol Res 105:321–329 Mellor PS, Boorman J, Baylis M (2000) Culicoides biting midges: their role as arbovirus vectors. Ann Rev Entomol 45:307–340 Morag N, Saroya Y, Braverman Y, Klement E, Gottlieb Y (2012) Molecular identification, phylogenetic status, and geographic distribution of Culicoides oxystoma (Diptera: Ceratopogonidae) in Israel. PLoS One. doi:10.1371/journal.pone.0033610 Muller MJ, Standfast HA (1992) Investigation of the vectors of bovine ephemeral fever virus in Australia. “Bovine ephemeral fever and related rhabdoviruses”, Eds: St George TD, Uren MF, Young PL, Hoffmann D, Proceedings of the 1st international symposium held in Beijing, PRC 29-32 Murray MD (1997) Possible vectors of bovine ephemeral fever in the 1967/68 epizootic in northern Victoria AustVet J 75: 220
Parasitol Res (2014) 113:4225–4232 Nandi S, Negi BS (1999) Bovine ephemeral fever: a review. Comp Immunol Microbiol Infect Dis 22:81–91 Navai S (1977) Biting midges of the genus Culicoides(Diptera: Ceratopogonidae) from Southwest Asia. University of Maryland, Ph. D. Thesis, p 202 Oğuzoğlu TC, Ertürk A, Çizmeci ŞG, Koç BT, Akça Y (2013) A report on bovine ephemeral fever virus in turkey: antigenic variations of different strains of EFV in the 1985 and 2012 outbreaks using partial glycoprotein gene sequences. Transbound Emerg Dis. doi:10.1111/ tbed.12187 Perrin A, Cetre-Sossah C, Mathiew B, Baldet T, Delecolle JC, Albina E (2006) Phylogenetic analysis of Culicoides species from France based on nuclear ITS1-1 rDNA sequences. Med Vet Entomol 20: 219–228 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. In: Sambrook J, Fritsch EF, Maniatis T (eds) A Laboratory manual. Cold Spring Harbor Laboratory Press, New York Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729 Tilki N, Dik B (2003) Farklı renkteki ışıkların Culicoides(Diptera: Ceratopogonidae) türlerinin yakalanmaları üzerine etkileri. Türkiye Parazitol Derg 27:144–147 Tonbak S, Berber E, Yoruk MD, Azkur AK, Pestil Z, Bulut H (2013) A large-scale outbreak of bovine ephemeral fever in Turkey, 2012. J Vet Med Sci. doi:10.1292/jvms.13-0085 Yeruham I, Yadin H, Abramovitch I, Shama Z (2005) Bovine ephemeral fever in a dairy cattle herd in the Jordan Valley. Vet Rec 156:284–286 Yeruham I, Van Ham M, Stram Y, Friedgut O, Yadin H, Mumcuoğlu KY, Braverman Y (2010) Epidemiological investigation of bovine ephemeral fever outbreaks in Israel. Vet Med Int. doi:10.4061/ 2010/290541 Walker JP (20059 Bovine ephemeral fever in Australia and the world. Curr Top Microbiol Immunol 292,57–80 Wang FI, Hsu AM, Huang KJ (2001) Bovine ephemeral fever in Taiwan. J Vet Diagn Invest 13:462–467
