Disruption of Heparan and Chondroitin Sulfate ... - Wiley Online Library

Download PDF
3 downloads 0 Views 1MB Size Report
Comment
binding of midkine, pleiotrophin, and basic fibroblast growth factor. J Biol Chem 2004;279:37368–37376. 33 Jackson RA, Murali S, van Wijen AJ et al. Heparan ...
TISSUE-SPECIFIC STEM CELLS Disruption of Heparan and Chondroitin Sulfate Signaling Enhances Mesenchymal Stem Cell-Derived Osteogenic Differentiation via Bone Morphogenetic Protein Signaling Pathways KERRY J. MANTON,a DENISE F. M. LEONG,a SIMON M. COOL,a,b VICTOR NURCOMBEa,b a

Institute of Molecular and Cell Biology, Singapore; bDepartment of Orthopedic Surgery, Yong Loo Lin School of Medicine, National University of Singapore, Singapore

Key Words. Heparinase • Chondroitinase • Mesenchymal stem cell • Wnts • Osteoblast

ABSTRACT Cell surface heparan sulfate (HS) and chondroitin sulfate (CS) proteoglycans have been implicated in a multitude of biological processes, including embryonic implantation, tissue morphogenesis, wound repair, and neovascularization through their ability to regulate growth factor activity and morphogenic gradients. However, the direct role of the glycosaminoglycan (GAG) sugar-side chains in the control of human mesenchymal stem cell (hMSC) differentiation into the osteoblast lineage is poorly understood. Here, we show that the abundant cell surface GAGs, HS and CS, are secreted in proteoglycan complexes that directly regulate the bone morphogenetic protein (BMP)-mediated differentiation of hMSCs into osteoblasts. Enzymatic depletion of the HS and CS chains by heparinase and chondroitinase treat-

ment decreased HS and CS expression but did not alter the expression of the HS core proteins perlecan and syndecan. When digested separately, depletion of HS and CS chains did not effect hMSC proliferation but rather increased BMP bioactivity through SMAD1/5/8 intracellular signaling at the same time as increasing canonical Wnt signaling through LEF1 activation. Long-term culturing of cells in HS- and CS-degrading enzymes also increased bone nodule formation, calcium accumulation, and the expression of such osteoblast markers as alkaline phosphatase, RUNX2, and osteocalcin. Thus, the enzymatic disruption of HS and CS chains on cell surface proteoglycans alters BMP and Wnt activity so as to enhance the lineage commitment and osteogenic differentiation of hMSCs. STEM CELLS 2007;25:2845–2854

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION Proteoglycans (PGs) are macromolecules composed of a core protein and complex, linear, long-chain carbohydrates called glycosaminoglycans (GAGs). GAGs consist of repeating disaccharide units bearing negatively charged sulfate groups that are covalently bound to a core protein via a tetrasaccharide linkage. There are distinct types of GAGs: chondroitin sulfate (CS), dermatan sulfate, heparan sulfate (HS), heparin, keratan sulfate, and hyaluronan, most of which are important constituents of tissue matrices. Indeed, there is growing evidence that these macromolecules are pivotal in controlling organogenesis. In particular, HS and CS have been demonstrated in the extracellular matrix (ECM) [1] and on the cell surfaces of most mammalian cells and are directly involved during bone development, maturation, remodeling, and repair [2–9]. It is generally accepted that the mechanism associated with PGs involves lowaffinity but high capacity binding of a wide variety of morphogens and growth factors to the GAG side-chains, thereby affecting the bioavailability of these ligands [1, 10 –15]. Indeed, many of the soluble growth and adhesive factors involved in osteogenic differentiation require GAG side chains to facilitate their interaction to their cell surface receptors and in the biosynthesis of osteogenic proteins [9, 16]. Matrix elasticity [17],

cell shape, and cytoskeletal tension [18] have also been shown to effect lineage-specific osteogenic differentiation. Heparinase and chondroitinase are HS- and CS-degrading enzymes that cleave GAG chains at glucuronidic and glycosidic linkages, respectively [19 –21]. Many HS- and presumptively CS-bound growth factors thought to drive osteoblast growth and differentiation are sequestered into the ECM and are therefore susceptible to enzymatic degradation of their component GAG chains. It has been hypothesized that enzymes that act to degrade HS and CS chains regulate osteogenic differentiation via their control of GAG chain density and, thus, growth factor binding. In fact, truncation of HS chains by both stromal and osteoblast cells engineered to overexpress mammalian heparanase has been shown to stimulate bone formation and increase bone mass [22]. Much of this effect can be attributed to the bone morphogenetic protein (BMP)2-binding ability of GAGs. In a recent study, Jiao et al. demonstrated that HS modulates BMP2 osteogenic bioactivity by sequestering it at the cell surface where it is unable to bind to BMP receptors [16]. Once released by GAGdigesting enzymes, the free BMP is then able to influence osteoblast lineage commitment. Indeed, the activity of alkaline phosphatase, a classic osteoblastic marker [23], is increased in MC3T3-E1 preosteoblasts following heparinase treatment [22]. The other HS-dependent [24] peptide morphogenic family increasingly being recognized as crucial to osteogenesis is the

Correspondence: Victor Nurcombe, Ph.D., Stem Cells and Tissue Repair Group, Institute of Molecular and Cell Biology, Proteos, 61 Biopolis Drive, Singapore 138673. Telephone: ⫹65 6586 9714; Fax: ⫹65 6779 1117; e-mail: [email protected] Received January 26, 2007; accepted for publication July 31, 2007; first published online in STEM CELLS EXPRESS August 16, 2007. ©AlphaMed Press 1066-5099/2007/$30.00/0 doi: 10.1634/stemcells.2007-0065

STEM CELLS 2007;25:2845–2854 www.StemCells.com

HS and CS Attenuate Osteogenic Differentiation of hMSCs

2846

Table 1. Primers for quantitative PCR Gene

18S rRNA Osteopontin Osteocalcin Collagen 1A2 Alkaline phosphatase Bone sialoprotein II RUNX2 Syndecan-1 Syndecan-4

Oligo/probe

Sequence (5ⴕ to 3ⴕ)

18S_F 18S_R 18S_P OP_F OP_R OP_P OC_F OC_R OC_R Coll_F Coll_R Coll_P AP_F AP_R AP_P BSPII_F BSPII_R BSPII_P RX_F RX_R RX_P Syn1_F Syn1_R Syn1_P Syn4_F Syn4_R Syn4_P

TTCGAGGCCCTGTAATTGGA GCAGCAACTTTAATATACGCTATTGG AGTCCACTTTAAATCCTT ACATCACCTCACACATGGAAAGC GCTGACTCGTTTCATAACTGTCCT ctt c⫹Tg ⫹At⫹T ggg ⫹Ac⫹A gc⫹C gt GGTGCAGAGTCCAGCAAAGG CGCCTGGGTCTCTTCACTACC TTG T⫹GT C⫹CA AG⫹C AG⫹G A⫹GG⫹GC CTGTATTGAGTTGTATCGTGTGGTGTAT GAAGATGAAAATGAGACTGGCAAA CATT⫹CA⫹TATT⫹TT⫹CCAT⫹CT⫹TAT T⫹CC⫹CA ATGCCCTGGAGCTTCAGAAG TGGTGGAGCTGACCCTTGAG ACG T⫹GG ⫹CT⫹A A⫹GA ⫹AT⫹G T⫹CA ⫹TC AGAGGAAGCAATCACCAAAATGA TTGAGAAAGCACAGGCCATTC ct g⫹Ct ⫹T⫹Ta a⫹Tt ⫹Ttg ⫹Ct⫹C agc AGGCATGTCCCTCGGTATGTC GAAGGGTCCACTCTGGCTTTG aca c⫹Ct a⫹Cc tg⫹C ca⫹C ca⫹C cc CTGGGCTGGAATCAGGAATATTT CCCATTGGATTAAGTAGAGTTTTGC CCA ⫹AA⫹G A⫹GT⫹GA⫹T A⫹GT⫹CT⫹T TT CCACGTTTCTAGAGGCGTCACT CTGTCCAACAGATGGACATGCT TAT⫹GTA⫹GTT⫹CAT⫹GG⫹C TA⫹C T⫹GT ⫹AC

The upper case letters in the probe sequences show LNA nucleotides. Abbreviations: F, forward; P, TaqMan probe; R, reverse; rRNA, ribosomal RNA.

Wnts [25, 26]. Canonical Wnt signaling stimulates osteogenesis, including the differentiation from preosteoblasts to osteoblasts, in cultured osteoblast differentiation models. Mutations in the Wnt coreceptor LRP5 alter bone mass in humans [26], but the mechanisms responsible for such actions in bone are unclear. HS and CS fragments released by GAG-specific degrading enzymes have multiple roles that can be either stimulatory or inhibitory to cellular processes [27]. Here, we wanted to examine the effect that disruption of HS and CS chains had on human mesenchymal stem cell (hMSC) growth and osteogenic differentiation in vitro and the involvement of BMP/Wnt signals in mediating this process. By monitoring growth, cell cycle progression, osteogenic gene expression, and BMP/Wnt signaling, we demonstrate that disruption of HS and CS chains on hMSCs positively regulates osteogenic differentiation. Specifically, we show that disruption of HS and CS chains on hMSCs results in (a) increased expression of osteogenic genes, (b) increased BMP signaling through increased pSMAD 1/5/8 expression, and (c) increased Wnt signaling through enhanced LEF1 activation.

MATERIALS

AND

METHODS

Cell Culture and Enzyme Treatment hMSCs (Cambrex, Walkersville, MD, http://www.cambrex.com) were plated in maintenance medium consisting of Dulbecco’s modified Eagle’s medium (1,000 mg/l glucose), 10% fetal calf serum (FCS), 2 mM L-glutamine, and 100 U/ml penicillin-streptomycin sulfate at 37°C in a humidified atmosphere with 5% CO2 at an initial density of 6 ⫻ 103 cells per cm2. Cells reached confluence after 5– 6 days, at which point the medium was changed to osteogenic medium (maintenance medium supplemented with 10 nM dexamethasone, 25 ␮g/ml L-ascorbic acid, and 10 mM ␤-glycerophosphate). Cells were treated with 1.2 mU/ml heparinase I, II, and III or 50 mU/ml chondroitinase ABC (Sigma-Aldrich, St. Louis,

http://www.sigmaaldrich.com) for up to an additional 7 days with the medium changed every 4 days.

In Vitro Mineralization To confirm osteogenic potential, mineralization assays and alkaline phosphatase stains were performed as described previously [28]. Briefly, hMSC cultures were seeded in triplicate at 6 ⫻ 103 cells per cm2 and grown for 7–14 days in enzymes and osteogenic medium. To stain for the accumulation of calcium within the matrix, fixed cells were stained with 1% alizarin red. For phosphate nodule staining, cell monolayers were fixed and stained with 1% silver nitrate under UV light. Alkaline phosphatase staining was performed using the Fast Blue RR salt kit (Sigma-Aldrich) per the manufacturer’s instructions, and cell morphology was determined from images taken using an Olympus BX51 microscope (Olympus, Tokyo, http://www.olympus-global.com), DP70 camera, and DP Controller software V1.1.1.65.

Quantitative Reverse Transcription-Polymerase Chain Reaction hMSCs were plated in triplicate at 6 ⫻ 103 cells per cm2 in 12-well plates. After reaching confluence, the medium was supplemented with heparinase or chondroitinase at previously listed concentrations in osteogenic medium. Total RNA was extracted using a NucleoSpin RNA II kit (Clontech, Palo Alto, CA, http://www. clontech.com) according to the manufacturer’s protocol at days 3 and 7; as a control, RNA (2 ␮g) was extracted from cells grown in normal maintenance, and reverse transcription-polymerase chain reaction (PCR) was performed using reagents from Invitrogen (Carlsbad, CA, http://www.invitrogen.com). Primers and probes for quantitative real-time PCR were designed using Primer Express (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems. com) and synthesized by Sigma-Proligo (Singapore, http://www. proligo.com) (Table 1). Probe sequences were modified to dual-labeled locked nucleic acid (FAM/BHQ-1) hybridization probes. Dual-labeled minor groove binder (VIC/TAMRA) labeled 18S ribosomal RNA (rRNA) primer probes were used as control for all reactions. PCR

Manton, Leong, Cool et al. products were analyzed by agarose gel electrophoresis and sequenced to verify the specificity of the amplicon. Each PCR reaction (20 ␮l total) contained 80 ng cDNA, 300 mM forward and reverse primer, 250 ␮M probe (100 ␮M collagen2␣1 probe was the only exception), and 10 ␮l TaqMan Universal Master Mix (Applied Biosystems). Detection of 18S rRNA was performed in a similar way using 50 nM forward and 50 nM reverse primer and 100 nM probe. PCR reactions were performed in triplicate on an ABI Prism 7000 sequence detection system (Applied Biosystems) with an initial 10 minute activation step at 95°C followed by 45 cycles of 95°C for 20 seconds, 55°C for 10 seconds, 60°C for 30 seconds, and 72°C for 40 seconds. Relative expression units were calculated by normalizing the 2(⫺⌬Ct) values of the gene to the 2(⫺⌬Ct) values of 18S and multiplied by 106.

Immunoblotting hMSCs were seeded at 6 ⫻ 103 cells per cm2 and grown in maintenance medium until confluent. The medium was changed to osteogenic medium supplemented with heparinase or chondroitinase for 24 hours. If required, 0.2 ␮g/ml noggin, 4 ␮g/ml gremlin, or 50 ng/ml BMP2 (R&D Systems Inc., Minneapolis, http://www. rndsystems.com) was added to the cells with the enzymes. Cells were lysed, protein content was determined using a protein assay kit (Bio-Rad, Hercules, CA, http://www.bio-rad.com), and 20 ␮g was resolved on 8% SDS-polyacrylamide gel electrophoresis gels and blotted onto nitrocellulose membranes as described previously [28]. Membranes were blocked and incubated with specific primary antibodies followed by appropriate horseradish peroxidase-linked secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com). An enhanced chemiluminescence system (Pierce, Rockford, IL, http://www.piercenet. com) was employed to visualize immunoreactive bands. The following antibodies were used for Western blot analyses: polyclonal rabbit anti-cyclin A, anti-cyclin B1, anti-cyclin E (1:500 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com), monoclonal mouse anti-cyclin D1 (1:500 dilution; BD Biosciences, San Diego, http://www.bdbiosciences.com), monoclonal mouse anti-pERK (1:2,000 dilution), anti-pSMAD 1/5/8, polyclonal rabbit anti-ERK (1:1,000 dilution; Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com), and monoclonal mouse anti-p27 (1:1,000 dilution; Lab Vision, Fremont, CA, http://www.labvision. com). Reblotting with polyclonal rabbit anti-actin (1:7,500 dilution; Sigma-Aldrich) was performed as described previously [28].

2847

LEF1 Activation Assay C3H10T1/2 cells (American Type Culture Collection [ATCC], Manassas, VA, http://www.atcc.org) were seeded at 10,000 cells per cm2 in triplicate in 12-well plates in maintenance medium (BME medium, 10% FCS, 2 mM L-glutamine, penicillin, and streptomycin) and allowed to adhere overnight. The medium was then changed to serum-free medium, and the cells were transfected with 1.5 ␮g of TOPflash/LEF1 reporter plasmid (gift from Dr M. Jones, Institute of Medical Biology, Singapore) and 150 ng of Renilla control plasmid with Lipofectamine 2000 at a ratio of 1:3 for 4 hours. The medium was then changed to maintenance medium containing either 50 ng/ml recombinant human Wnt3a or conditioned medium (1/1 or 1/10 dilution) containing Wnt3a from L-cells stably transfected with a Wnt3a-expressing plasmid (ATCC). Heparinase or chondroitinase was added, and the cells were incubated at 37°C for an additional 20 hours. Cell lysate was extracted and the Firefly and Renilla luciferase activities determined utilizing the Dual-Luciferase Reporter Assay Kit (Promega, Madison, WI, http:// www.promega.com) as per the manufacturer’s instructions. Each condition was assayed in triplicate and read in duplicate, giving six data points that were averaged for each final reading. Error is shown as ⫾ standard deviation.

hMSC Proliferation and Viability Assays were performed to determine cell number utilizing the Guava PCA-96 System (Guava Technologies, Hayward, CA, http:// www.guavatechnologies.com) as per the manufacturer’s instructions. Briefly, cells were seeded at 3,000 cells per cm2 in 48-well plates and allowed to adhere overnight. The following day, the medium was changed to osteogenic medium supplemented with heparinase, chondroitinase, or, when required, Wnt3a conditioned medium. Cells were washed in PBS and pelleted with 0.125% trypsin, and the trypsin was neutralized, the pellet resuspended in 400 ␮l of PBS with the addition of 4 ␮l of Flex reagent and incubated for 10 minutes, and cell number and viability determined utilizing the Guava ViaCount software.

Statistical Analysis All assays were performed in triplicate and results reported as means ⫾ standard deviation. Independent sample t tests were used to determine statistical significance; the significance for all tests was set at p ⱕ .05.

Immunofluorescence Cells were fixed in 100% methanol for 5 minutes and washed in phosphate-buffered saline (PBS) and the nonspecific binding sites blocked with 1% bovine serum albumin (BSA) and 1% dried milk in PBS. Primary antibodies anti-HS 10E4 and anti-CS 2H6 (antimouse IgM) (Seikagaku, Tokyo, http://www.seikagaku.co.jp/ english) were diluted 1:100 in 1% BSA and 1% dried milk in PBS and incubated for 1 hour. After washing in 1% BSA and 1% dried milk in PBS, specific binding of primary antibodies was detected with secondary antibody (fluorescein isothiocyanate-conjugated) rat anti-mouse IgM monoclonal antibody (BD Pharmingen, San Diego, http://www.bdbiosciences.com/index_us.shtml) applied at a dilution of 1:50 for 1 hour. Cells were then washed in PBS followed by water and mounted in 4,6-diamidino-2-phenylindole/Vectashield fluorescent mounting medium (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). Slides were visualized under the fluorescence microscope.

Fibroblast Growth Factor-2 Basic Quantification hMSCs were plated in triplicate at 6 ⫻ 103 cells per cm2 in 12-well plates. After reaching confluence, the medium was supplemented with heparinase I, II, or III or chondroitinase ABC at previously listed concentrations in osteogenic medium for 3 and 7 days. Conditioned medium was collected, and the monolayers of cell were rinsed with 2 M NaCl in HEPES buffer to extract ECM-fibroblast growth factor (FGF)2. Quantification of free and ECM-bound growth factor was performed using the Quantikine FGF Basic Immunoassay Kit (R&D Systems).

www.StemCells.com

RESULTS Disruption of HS and CS Chains on the Surfaces of hMSCs Decreases HS and CS Expression To examine the effect of heparinase treatment on the HS expression of hMSCs, HS expression and localization were examined by immunofluorescence with the 10E4 anti-HS antibody. This antibody is specific for the N-sulfated glucosamine residues of HS, does not react with hyaluronan, dermatan sulfate, or DNA, and has been utilized previously to examine the localization of the HS glycosaminoglycans in murine embryos [29] and melanoma cells [30]. HS was localized to the cytoplasm of the hMSCs cultured in normal maintenance medium but to the focal adhesions and ECM following culture of the hMSCs in osteogenic medium for 7 days (Fig. 1). Following 14 days of enzymatic treatment, the localization of HS to the focal adhesions (indicated by ⴱ) becomes rather striking and comprises a pattern that is unique to the HS chain localization of osteogenic hMSCs. As expected, the expression of HS decreased following treatment with heparinase I, II, and III after 7 and 14 days. To examine the effect of chondroitinase ABC treatment on hMSC CS expression, we utilized the 2H6 anti-CS antibody; this antibody does not cross-react with hyaluronic acid, heparin, HS, chondroitin, dermatan sulfate, or keratin sulfate and has

2848

HS and CS Attenuate Osteogenic Differentiation of hMSCs

Figure 1. Disruption of heparan sulfate (HS) and chondroitin sulfate (CS) chains on the surface of human mesenchymal stem cells (hMSCs) decreases HS and CS expression. Immunofluorescence staining of HS and CS on hMSCs grown in osteogenic medium in the presence of Hep or CD for 7 and 14 days. hMSCs grown in normal maintenance medium for 4 days. The nuclei were stained with 4,6-diamidino-2-phenylindole, and the HS and CS chains were stained with anti-HS 10E4 or anti-CS 2H6 primary antibodies, respectively, and anti-mouse IgMfluorescein isothiocyanate secondary antibody. Focal adhesions are indicated by ⴱ. All photos were taken with a ⫻20 objective. Real-time polymerase chain reaction of syndecan-1 and syndecan-4 mRNA expression on hMSCs grown in osteogenic medium in the presence of Hep or CD for 7 days. Abbreviations: CD, chondroitinase ABC; Hep, heparinase I, II, and III; Norm, normal maintenance medium; Osteo, osteogenic medium.

been used previously to examine the localization of CS glycosaminoglycans in sheep rat cerebrum [31]. In this study, CS was localized to the nucleus and cytoplasm of the hMSC cultured in normal maintenance medium and both the cell cytoplasm and extracellular matrix following culture of the hMSC in osteogenic medium for 7 and 14 days (Fig. 1); expression of CS decreased following treatment with chondroitinase ABC after 7 and 14 days. To examine the specificity of the enzymes, we examined the expression of HS following treatment with chondroitinase ABC and CS following treatment with heparinase I, II, and III. CS expression was unaffected following such treatment, and HS expression was similarly unaffected following chondroitinase treatment (Fig. 1). This indicated that heparinase and chondroitinase ABC treatment specifically degrade HS and CS, respectively.

Disruption of HS and CS Chains Does Not Affect Expression or Localization of Perlecan or Syndecans Perlecan, syndecan-1, and syndecan-4 can be modified by both HS and CS chains [32]. It has also been shown that cell surface HS can be degraded by mammalian heparanase without affecting syndecan-1 core protein expression [30]. To determine

whether the bacterial heparinases I, II, and III and chondroitinase ABC could similarly degrade the HS and CS chains without affecting core protein expression, we first examined RNA expression of syndecans-1 and -4 by real-time PCR, as well as the expression and localization of perlecan by immunofluorescence. Disruption of the HS chains did not effect the expression of syndecan-1, whereas disruption of the CS chains resulted in a small twofold increase in syndecan-1 expression (Fig. 1). Disruption of the HS and CS chains resulted in a 1.5-fold increase in syndecan-4 expression (Fig. 1). Disruption of HS and CS chains did not result in any significant changes to the expression or localization of perlecan (data not shown).

Disruption of HS and CS Chains Increases the Formation of Mineralized Bone Nodules In Vitro HS has been shown to play a role in osteogenic differentiation [33]; furthermore, HS and CS chains have been shown to have a role in facilitating growth factor binding to their cell surface receptors [34, 35]. We therefore determined whether disruption of the HS and CS chains had an effect on hMSC osteogenic differentiation. hMSCs grown for 7 and 14 days in the presence of the enzymes were stained for von Kossa, alizarin red, and alkaline phosphatase. Disruption of the HS and CS chains re-

Manton, Leong, Cool et al.

2849

Figure 2. Disruption of heparan sulfate and chondroitin sulfate chains increases the formation of mineralized bone nodules in vitro. Osteogenic staining (left panel) and phase contrast morphology (right panel) of human mesenchymal stem cells (hMSCs) grown in osteogenic medium in the presence of Hep and/or CD enzymes for 7 and 14 days. hMSCs were stained for phosphate deposition by VK, calcium deposition by AR, and ALP. All photos were taken with a ⫻20 objective. Representative examples of triplicate wells are shown. Abbreviations: ALP, alkaline phosphatase; AR, alizarin red; CD, chondroitinase ABC; Hep, heparinase I, II, and III; No Enz, without enzymes; Osteo, osteogenic medium; VK, von Kossa.

sulted in a slight increase in the expression of alkaline phosphatase protein after 7 days of treatment (Fig. 2). Osteogenic differentiation is known to result in increased expression of alkaline phosphatase [36], so the increased expression of alkaline phosphatase seen following the treatment with the enzymes is a reliable indicator of the increased osteogenic differentiation. Disruption of the HS and CS chains resulted in increased alizarin red and von Kossa staining after 14 days of enzymatic treatment as compared with the cells grown in osteogenic medium without the enzymes (Fig. 2); this increased staining correlated with increased deposition of calcium and phosphate, respectively, key indicators of an increased mineralization rate in vitro. To determine whether the disruption of HS and CS chains on the surface of hMSCs had any effect on cell morphology, photomicrographs were taken of the cells in osteogenic medium following 7 and 14 days of enzymatic treatment. The disruption of the HS and CS chains on the surface of the hMSCs did not affect cell viability to any significant degree (Fig. 2). The hMSCs still formed a confluent monolayer, and following treatment with the enzymes they began to form mineralized bone nodules after 7 days; there was no observable cell death or cell lifting from the surface of the tissue culture plastic. Following 14 days of enzyme treatment, there was increased bone nodule formation as indicated by increased three-dimensional, clustered, and noncontact inhibited cell growth present in cells treated with heparinase or chondroitinase (Fig. 2).

Disruption of CS and HS Results in Increased Expression of Osteogenic Genes To investigate whether disruption of HS and CS chains on hMSCs affected the expression of osteogenic genes, we utilized quantitative real-time PCR to examine any changes in gene expression after 3 and 7 days of treatment in osteogenic medium. Expression of RUNX2, alkaline phosphatase, and osteocalcin increased following treatment of the hMSCs with chondroitinase after 3 and 7 days (p ⬍ .05; Fig. 3). Disruption of the HS chains also resulted in increased expression of RUNX2, alkaline phosphatase, and osteocalcin, but only after 7 days of treatment. The upregulation of osteogenic-associated RNA in hMSCs following disruption of the HS and CS chains by treatment with heparinase and chondroitinase enzymes indicates that osteoblast differentiation was accelerated in these cells. www.StemCells.com

Disruption of HS and CS Chains Does Not Affect the Expression of Cell Cycle Proteins As cells undergo differentiation, their rate of proliferation decreases. Cyclin A, cyclin B1, cyclin D1, and cyclin E have all been shown to be downregulated upon inhibition of cell proliferation in osteoblast cells [37–39]. To determine whether the increase in osteogenic differentiation was associated with a decrease in cell proliferation, we examined the expression of the cell cycle-related proteins cyclin D1 (G1 phase), cyclin E (G1/ S-phase), cyclin A (S/G2 phase), cyclin B1 (G2/M phase), and the Cdk inhibitor p27 after blotting. The disruption of hMSC HS and CS chains did not affect expression of either the cyclins or p27 (Fig. 3). As the formation of mineralized bone nodules requires postconfluent proliferation, the continued expression of cell cycle proteins was perhaps not unexpected. The p27 Cdk inhibitor is a marker of cell quiescence, and a proportion of hMSCs undergoing differentiation would be entering this state. Therefore, it is possible that there are two distinct cell types present in the hMSC population, namely cells that are proliferating and contributing to the postconfluent growth and cells that are differentiating and contributing to the deposition of calcium and phosphate and the formation of mineralized bone.

Disruption of HS Chains Increases pSMAD 1/5/8 Signaling BMPs are known to exert an anabolic effect on osteogenic differentiation. Therefore, to determine whether the increase in osteogenic differentiation seen upon disruption of HS and CS chains was due to increased BMP signaling, the expression of pSMAD 1/5/8 was investigated. Following 24 hours of enzyme treatment, there was increased pSMAD 1/5/8 expression in cells treated with heparinase I, II, and III as compared with the untreated control cells (Fig. 4). Treatment of the cells with chondroitinase slightly increased the expression of pSMAD 1/5/8 above control following 24 hours of treatment. Noggin and gremlin have been shown to be potent antagonists of BMP signaling. Therefore, we sought to determine whether the addition of Noggin and gremlin to the enzyme-treated hMSC cultures would inhibit the increase in pSMAD 1/5/8 signaling seen upon HS disruption. Noggin (0.2 ␮g/ml) and gremlin (4 ␮g/ml) inhibited pSMAD 1/5/8 signaling in HS and CS disrupted cells. The addition of noggin, which binds to BMPs and heparan sulfate proteoglycans (HSPGs), completely inhibited the expres-

2850

HS and CS Attenuate Osteogenic Differentiation of hMSCs

Figure 3. Disruption of heparan sulfate and chondroitin sulfate chains results in increased expression of osteogenic genes without affecting cell cycle. Human MSCs were seeded at 3,000 cells per cm2 and grown until confluent. The medium was changed to osteogenic medium supplemented with Hep or CD for 3 and 7 days with medium changed every 3rd day. Total RNA was extracted, and quantitative real-time polymerase chain reaction was performed using sequence-specific primers (Table 1) and probes as markers of osteoblast differentiation. All analyses were done in triplicate using ABI Prism 7000 SDS software (ⴱ, p ⬍ .05 [left panel]) and quantitated as REUs. Whole cell lysate (20 ␮g) was subjected to SDS-polyacrylamide gel electrophoresis and probed for p27, cyclin A, cyclin B1, cyclin D1, cyclin E, and pERK (right panel). Abbreviations: CD, chondroitinase ABC; Hep, heparinase I, II, and III; Osteo, osteogenic medium; REU, relative expression unit.

ng/ml BMP2 in combination with the enzymes resulted in even greater stimulation of the SMAD signaling pathway following HS chain disruption for 24 hours (Fig. 4). The pSMAD 1/5/8 antibody utilized here detects endogenous levels of SMAD 1 when dually phosphorylated at serines 463 and 465 as well as SMAD 5 and SMAD 8 only when phosphorylated at equivalent sites, SMAD 5 (Ser 463/465) and SMAD 8 (Ser 426/428). The antibody does not cross-react with other SMAD-related proteins. These phosphorylated sites correspond to those phosphorylated by the BMP receptors following activation by the extracellular binding of the BMPs to their cognate receptors. This results in increased SMAD translocation to the nucleus and increased promotion of osteogenic gene expression as seen previously. As there is significant crosstalk between the BMP and Ras-MAPK signaling pathways, we next examined the expression of pERK following HS and CS chain disruption. No significant effect on pERK expression following HS and CS chain disruption was detected (Fig. 4), indicating that the enhanced cell signaling is mediated predominantly through the BMP signaling pathway.

Figure 4. Disruption of heparan sulfate and chondroitin sulfate chains on human mesenchymal stem cells (hMSCs) results in increased SMAD signaling. hMSCs were seeded at 3,000 cells per cm2 and grown until confluent. The medium was changed to osteogenic medium supplemented with Hep or CD for 24 hours. BMP2, noggin, and gremlin were added with the enzymes as indicated. Whole cell lysate (20 ␮g) was subjected to SDS-polyacrylamide gel electrophoresis and probed for pSMAD 1/5/8 with actin as loading control. Abbreviations: BMP, bone morphogenetic protein; CD, chondroitinase ABC; Hep, heparinase I, II, and III; Osteo, osteogenic medium.

CS Disruption in Serum-Free Medium Decreases the Expression of Osteogenic Genes

sion of pSMAD 1/5/8 (Fig. 4). The increased pSMAD 1/5/8 signaling seen upon HS chain disruption was also inhibited, indicating that this signaling is mediated through the BMP pathway. Furthermore, the addition of gremlin, which also binds to BMPs, inhibited pSMAD 1/5/8 signaling. Addition of 50

The serum utilized in tissue culture medium is composed of many components, including endogenous levels of heparanase and chondroitinase. We therefore sought to investigate the effects of HS and CS chain disruption in serum-free medium. Following 3 and 7 days of chondroitinase treatment on hMSC in osteogenic medium without serum, there was decreased expres-

Manton, Leong, Cool et al.

2851

Figure 6. Chondroitin sulfate disruption increases the amount of FGF2 secreted by the human mesenchymal stem cell (hMSC). hMSCs were seeded at 6,000 cells per cm2 in maintenance medium and grown to confluence. Upon confluence, the medium was changed to osteogenic medium supplemented with either heparinase or chondroitinase enzyme for a further 3 or 7 days at 37°C. Conditioned medium and ECM-bound FGF2 were extracted and quantified (ⴱ, p ⬍ .05). Abbreviations: CD, chondroitinase ABC; ECM, extracellular matrix; FGF, fibroblast growth factor; Hep, heparinase I, II, and III; Osteo, osteogenic medium.

binds to the ECM produced by the cells. FGF2 is highly vulnerable to proteolytic degradation unless protected by a GAG chain. To determine whether the addition of heparinase or chondroitinase to the hMSCs increased the concentration of FGF2 that was in soluble form in the medium or bound to the ECM, we utilized enzyme-linked immunosorbent assays following 3 and 7 days of enzyme treatment on confluent cells in osteogenic medium. No FGF2 could be detected after 3 days of enzyme treatment. Treatment of hMSCs with chondroitinase increased the concentration of FGF2 that was both in soluble form in the medium and bound to the ECM as compared with control hMSCs (Fig. 6). Treatment of the cells with heparinase I, II, and III did not result in increased FGF2 either in the serum or the ECM as compared with the control (Fig. 6).

Effect of HS and CS Chain Disruption on hMSC Proliferation Figure 5. Chondroitin sulfate disruption in serum-free medium decreases the expression of osteogenic genes. Human MSCs were seeded at 3,000 cells per cm2 and grown until confluent. The medium was changed to serum-free osteogenic medium supplemented with Hep or CD for 3 and 7 days with medium changed every 3rd day. Total RNA was extracted, and quantitative real-time polymerase chain reaction was performed using sequence-specific primers (Table 1) and probes as markers of osteoblast differentiation. All analyses in REUs were done in triplicate using ABI Prism 7000 SDS software; ⴱ, p ⬍ .05. Abbreviations: CD, chondroitinase ABC; Hep, heparinase I, II, and III; Osteo, osteogenic medium; REU, relative expression unit.

sion of RUNX2, alkaline phosphatase, and osteocalcin when compared with the no enzyme-treated control hMSC (Fig. 5). Treatment of the cells with heparinase I, II, and III in serum-free medium did not result in any significant changes to gene expression when compared with untreated control cells. Thus, it can be concluded that there are components in the serum required for the increased osteogenesis seen in the differentiation studies, such as FGF2, which have been shown to bind to proteoglycans.

CS Disruption Increases the Amount of FGF2 Secreted by hMSCs The growth factor FGF2 is produced by the differentiating hMSCs and is secreted into the medium in a soluble form or www.StemCells.com

Wnt signaling, which has varying effects on hMSC proliferation and differentiation [35], is known to be dependent on glycosaminoglycan activity. Thus, the effect of HS and CS chain disruption on hMSC proliferation in the presence and absence of Wnt3a during the linear phase of cell growth was next examined. We analyzed hMSC proliferation both in the presence and absence of stably transfected L-cell conditioned medium-derived Wnt3a after 3 days of growth, during which the hMSCs are in the linear phase of proliferation. hMSCs were seeded at low density and allowed to adhere overnight. The following day, the Wnt3a conditioned medium and enzymes were added, and the cells were allowed to proliferate for a further 3 days, whereupon cell number was determined. The addition of 50 mU/ml of chondroitinase ABC to low density hMSCs resulted in virtually no cell proliferation occurring (data not shown). The addition of heparinases I, II, and III to hMSCs resulted in a slight increase in cell proliferation; however, this was not significantly more than hMSCs grown in maintenance medium alone (Fig. 7A). The addition of Wnt3a conditioned medium at a 1:10 or 1:1 dilution did not inhibit hMSC proliferation as compared with the L-cell conditioned medium control. The disruption of the HS chains on hMSCs in Wnt3a conditioned medium did not affect their proliferation (Fig. 7A). Thus, the disruption of HS or CS chains does not affect hMSC proliferation either dependently or independently of Wnt3a during the linear phase of proliferation.

2852

HS and CS Attenuate Osteogenic Differentiation of hMSCs

Figure 7. Effect of glycosaminoglycan chain disruption on human mesenchymal stem cell (hMSC) proliferation and Wnt signaling. (A): hMSCs were seeded at 3,000 cells per cm2 in maintenance medium and allowed to adhere overnight. The following day, heparinases and Wnt3a CM were added and the cells incubated for a further 3 days. Cell number was determined by Guava ViaCount. (B): C3H10T1/2 cells were transfected with TOP flash reporter plasmid and Renilla control plasmid utilizing Lipofectamine 2000. Cells were then grown in medium containing rhWnt3a and heparinases or chondroitinase ABC for an additional 20 hours. Firefly luciferase activity was then determined and normalized to the Renilla luciferase measurement (ⴱ, p ⬍ .05). Abbreviations: CD, chondroitinase ABC; CM, conditioned medium; Hep, heparinase I, II, and III.

Disruption of CS Chains Results in Increased LEF1 Activation The disruption of HS and CS chains does not affect hMSC proliferation but rather appears to be limited to osteogenic differentiation. Canonical Wnt signaling has been shown to play an important role in osteogenic differentiation [26]. To determine whether disruption of HS and CS chains affects Wnt signaling, activation of LEF1 was investigated using a luciferase reporter plasmid transfected into C3H10T1/2 mouse mesenchymal cells; this cell type was used because of the reluctance of hMSCs to be efficiently transfected in our hands. Following transfection with the LEF1 reporter and Renilla control plasmid, the medium was changed to that containing rhWnt3a and the HS and CS chains present on the surface of the C3H10T1/2 cells disrupted by the addition of chondroitinase ABC or heparinase I, II, and III enzymes for 12 hours. Disruption of CS chains resulted in a dramatic increase in LEF1 activation as compared with LEF1 activation by rhWnt3a alone (Fig. 7B; p ⬍ .05). Disruption of HS chains resulted in a slight increase in LEF1 activation as compared with LEF1 activation by rhWnt3a alone. Similar results were obtained when conditioned medium containing Wnt3a obtained from L-cells was utilized to activate the Wnt signaling pathway (data not shown). These data indicate that the release of active HS and CS fragments enhances the extracellular component of Wnt signaling possibly by disrupting the binding of factors that act to downregulate the pathway. This loss of regulatory factors allows for the upregulation seen in the

Wnt signaling pathway as shown by the upregulation in LEF1 activation.

DISCUSSION In this study, by monitoring growth, cell cycle progression, and osteogenic gene expression, we have shown that enzymatic disruption of HS and CS chains on hMSCs upregulates osteogenic differentiation, at least in part by altering the signaling normally induced by both BMPs through pSMAD 1/5/8, and Wnt signaling through LEF1. The exact roles of GAG sugar chains during the control of hMSC differentiation into the osteoblast lineage remain enigmatic; it appears that HS and CS coordinate to drive the actions of BMP and, thus, the differentiation of mesenchymal stem cells into the osteoblast lineage. Here, depletion of HS and CS chains does not alter the expression of the proteoglycan core proteins perlecan and syndecan, nor, when digested separately, does depletion of HS and CS chains affect hMSC proliferation. Indeed, such manipulation served to increase BMP bioactivity and canonical Wnt signaling. Prolonged exposure to the enzymes increased bone nodule formation, calcium accumulation, and osteoblast marker expression. Our results suggest that disruption of HS and CS chains on cell surface proteoglycans may be a normal event during the differentiation and lineage commitment of hMSCs in vivo, whereby through a loss of the regulatory processes they mediate acts to enhance osteogenic differentiation under osteogenic con-

Manton, Leong, Cool et al. ditions. Such a release of the control over cell signaling, characterized by expression of pSMAD 1/5/8 and LEF1 activation, suggests that stage-specific GAG expression acts to constrain BMP and Wnt availability to the cells. Mammalian heparanase is an HS-degrading enzyme that cleaves susceptible chain sequence at glucuronidic linkages [20, 21], resulting in HS fragments of 5–10 kDa in size; it has long been studied for its role in cancer and metastasis. However, the enzyme has been recently linked to the process of osteogenic differentiation. Recombinant human heparanase has been shown to increase alkaline phosphatase expression, alizarin red staining, and cell proliferation in murine MC3T3-E1 cells [22]; the same study employed transgenic mice to show that proteoglycans tonically suppress osteoblast function, an inhibition that can be alleviated by HS chain degradation. Whether this is due to altered rates of GAG-growth factor receptor internalization, as has been suggested [16], albeit on the basis of nonspecific chlorate treatment, remains to be confirmed. We have also found that removal of GAGs from the human osteosarcoma MG63 cell line via sodium chlorate treatment resulted in increased differentiation, as shown by increased calcium and alkaline phosphatase expression (A. Kumarasuriyar, Institute of Molecular and Cell Biology, Singapore, unpublished results). BMP-mediated developmental processes are now known to be dependent on BMP-HSPG interactions [40]. HS chains bind BMP4 and restrict its expression pattern in Xenopus embryos [41], and Drosophila mutants of the dally gene (encoding the homolog of mammalian glypican-3) fail to properly control the activities of decapentaplegic, the homolog of BMP2/BMP4 [42]. Combined knockout of glypican-3 and BMP4 results in abnormal skeletal development in vertebrates [43]. The Simpson-Golabi-Behmel syndrome, a genetic disease involving skeletal overgrowth in humans [44], is caused by mutation in the glypican-3 core protein, altering its pericellular functions. As well as this, HSPGs are known to modulate the activities of BMP antagonists such as noggin and chordin [45– 47]. Despite this suggestive genetic evidence, the direct role of HSPGs on BMP-mediated signal transduction lacks biochemical support. Nonphysiological heparin can inhibit BMP binding to its receptors [48, 49], and prolonged use of heparin as an anticoagulant therapy in humans is known to predispose patients to delayed bone fracture healing [50] as well as osteoporosis [51]. Similarly, the role of HSPGs in Wnt signaling remains poorly understood [24]. Interestingly, glypican-3 is also thought to be involved in Wnt signaling. It is bound to the cell membrane by a glycosyl-phosphatidylinositol anchor and stimulates the in vitro and in vivo growth of hepatocellular carcinoma cells by increasing autocrine/paracrine canonical Wnt signaling [52]. Coimmunoprecipitation experiments demonstrated that it is able to form activating complexes with Wnts, suggesting that glypican-3 stimulates Wnt activity by facilitating the interaction of this polypeptide with its signaling receptors. Alkaline phosphatase is a prototypic osteogenic differentiation marker. Disruption of either the HS or CS chains resulted in an increase in alkaline phosphatase mRNA expression. Osteocalcin is a late marker of osteogenic differentiation and has

REFERENCES

2853

been shown in some studies to undergo no significant increase in differentiating hMSCs [53]. Similarly, here we found very low levels of osteocalcin upregulation during the increased osteogenic differentiation. The transcription factor RUNX2 is a crucial early marker of commitment to the osteogenic lineage [54]. In our studies, we found RUNX2 to be upregulated following disruption of CS and HS chains. Further investigation of the interactions between enzymatically disrupted HS and CS chains and BMPs is now clearly warranted. Extraction of glycosaminoglycans from the soluble cell surface and matrix components of hMSCs grown in the same conditions and treated with the same enzymes as outlined in this paper is a necessary first step to be able to determine which set of core GAG-bearing core proteins is likely to be carrying the modulating activity. Second, structural characterization of the HS and CS chains, which have the capacity to influence BMP/Wnt activity, needs to be carried out. Our laboratory has recently shown that glycosaminoglycans extracted from C2C12 cells are able to bind to the heparin-binding site on BMP2 [16]. Use of refined GAG chains and fragments should then allow the further determination of the distributions and activities of those BMP and Wnt receptors involved in driving the osteogenic developmental cascade.

CONCLUSION In summary, our results show that cell surface proteoglycans mediate BMP and Wnt signaling and that a reduction of GAG chain levels increases BMP/Wnt induction of specific osteogenic markers. As HSPGs are spatially and temporally regulated during development [10, 11], our findings imply that differentially expressed HSPGs directly coordinate growth factor activities. Future experiments will be aimed at elucidating the specificities of HSPGs on such putative BMP/Wnt coordination and the roles that endogenous heparanases and sulfatases subserve in keeping the dosages of the factors physiologically relevant.

ACKNOWLEDGMENTS We are grateful to Dr. Mike Jones (IMB, Singapore) for the LEF1/TopFlash reporter plasmid, Dr. Chris Dombrowski for advice on the BMP signaling assays, Amanda Ng and Pui Yin Yit for technical assistance, and Dr. L.M. Haupt for TaqMan primer and probe design. We acknowledge grant support from Singapore’s Agency for Science, Technology and Research (A*STAR), the Biomedical Research Council of Singapore, and the Institute of Molecular and Cell Biology, Singapore.

DISCLOSURE

2

Iozzo RV. Matrix proteoglycans: From molecular design to cellular function. Annu Rev Biochem 1998;67:609 – 652. Bierbaum S, Douglas T, Hanke T et al. Collageneous matrix coatings on titanium implants modified with decorin and chondroitin sulfate: Characterization and influence on osteoblastic cells. J Biomed Mater Res A 2006;77:551–562.

www.StemCells.com

CONFLICTS

The authors indicate no potential conflicts of interest.

3 4

1

OF POTENTIAL OF INTEREST

5 6

Cool SM, Nurcombe V. The osteoblast-heparan sulfate axis: Control of the bone cell lineage. Int J Biochem Cell Biol 2005;37:1739 –1745. Cool SM, Nurcombe V. Heparan sulfate regulation of progenitor cell fate. J Cell Biochem 2006;99:1040 –1051. Grzesik WJ, Frazier CR, Shapiro JR et al. Age-related changes in human bone proteoglycan structure. Impact of osteogenesis imperfecta. J Biol Chem 2002;277:43638 – 43647. Jackson RA, McDonald MM, Nurcombe V et al. The use of heparan sulfate to augment fracture repair in a rat fracture model. J Orthop Res 2006;24:636 – 644.

2854

HS and CS Attenuate Osteogenic Differentiation of hMSCs

7

32 Deepa SS, Yamada S, Zako M et al. Chondroitin sulfate chains on syndecan-1 and syndecan-4 from normal murine mammary gland epithelial cells are structurally and functionally distinct and cooperate with heparan sulfate chains to bind growth factors. A novel function to control binding of midkine, pleiotrophin, and basic fibroblast growth factor. J Biol Chem 2004;279:37368 –37376. 33 Jackson RA, Murali S, van Wijen AJ et al. Heparan sulfate regulates the anabolic activity of MC3T3–E1 preosteoblast cells by induction of Runx2. J Cell Physiol 2007;210:38 –50. 34 Ornitz DM. FGF signaling in the developing endochondral skeleton. Cytokine Growth Factor Rev 2005;16:205–213. 35 Hu H, Hilton MJ, Tu X et al. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 2005;132:49 – 60. 36 Jaiswal N, Haynesworth SE, Caplan AI et al. Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J Cell Biochem 1997;64:295–312. 37 Pratap J, Galindo M, Zaidi SK et al. Cell growth regulatory role of Runx2 during proliferative expansion of preosteoblasts. Cancer Res 2003;63: 5357–5362. 38 Stein GS, Lian JB, Stein JL et al. Temporal and spatial parameters of skeletal gene expression: Targeting RUNX factors and their coregulatory proteins to subnuclear domains. Connect Tissue Res 2003;44(suppl 1): 149 –153. 39 Galindo M, Pratap J, Young DW et al. The bone-specific expression of Runx2 oscillates during the cell cycle to support a G1-related antiproliferative function in osteoblasts. J Biol Chem 2005;280:20274-20285. 40 Ruppert R, Hoffmann E, Sebald W. Human bone morphogenetic protein 2 contains a heparin-binding site which modifies its biological activity. Eur J Biochem 1996;237:295–302. 41 Ohkawara B, Iemura S, ten Dijke P et al. Action range of BMP is defined by its N-terminal basic amino acid core. Curr Biol 2002;12:205–209. 42 Jackson SM, Nakato H, Sugiura M et al. dally, a Drosophila glypican, controls cellular responses to the TGF-beta-related morphogen, Dpp. Development 1997;124:4113– 4120. 43 Grisaru S, Cano-Gauci D, Tee J et al. Glypican-3 modulates BMP- and FGF-mediated effects during renal branching morphogenesis. Dev Biol 2001;231:31– 46. 44 Pilia G, Hughes-Benzie RM, MacKenzie A et al. Mutations in GPC3, a glypican gene, cause the Simpson-Golabi-Behmel overgrowth syndrome. Nat Genet 1996;12:241–247. 45 Kreuger J, Perez L, Giraldez AJ et al. Opposing activities of Dally-like glypican at high and low levels of Wingless morphogen activity. Dev Cell 2004;7:503–512. 46 Kirkpatrick CA, Dimitroff BD, Rawson JM et al. Spatial regulation of Wingless morphogen distribution and signaling by Dally-like protein. Dev Cell 2004;7:513–523. 47 Paine-Saunders S, Viviano BL, Economides AN et al. Heparan sulfate proteoglycans retain Noggin at the cell surface: A potential mechanism for shaping bone morphogenetic protein gradients. J Biol Chem 2002; 277:2089 –2096. 48 Irie A, Habuchi H, Kimata K et al. Heparan sulfate is required for bone morphogenetic protein-7 signaling. Biochem Biophys Res Commun 2003;308:858 – 865. 49 Takada T, Katagiri T, Ifuku M et al. Sulfated polysaccharides enhance the biological activities of bone morphogenetic proteins. J Biol Chem 2003;278:43229 – 43235. 50 Street JT, McGrath M, O’Regan K et al. Thromboprophylaxis using a low molecular weight heparin delays fracture repair. Clin Orthop Relat Res 2000;381:278 –279. 51 Monreal M, Olive A, Lafoz E et al. Heparins, coumarin, and bone density. Lancet 1991;338:706. 52 Capurro MI, Xiang YY, Lobe C et al. Glypican-3 promotes the growth of hepatocellular carcinoma by stimulating canonical Wnt signaling. Cancer Res 2005;65:6245– 6254. 53 Catelas I, Sese N, Wu BM et al. Human mesenchymal stem cell proliferation and osteogenic differentiation in fibrin gels in vitro. Tissue Eng 2006;12:2385–2396. 54 Gilbert L, He X, Farmer P et al. Expression of the osteoblast differentiation factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) is inhibited by tumor necrosis factor-alpha. J Biol Chem 2002;277:2695–2701.

8 9

10 11 12 13 14 15 16 17 18 19 20 21

22 23 24 25 26 27 28 29 30 31

Kang SK, Putnam L, Dufour J et al. Expression of telomerase extends the lifespan and enhances osteogenic differentiation of adipose tissue-derived stromal cells. STEM CELLS 2004;22:1356 –1372. Ling L, Murali S, Dombrowski C et al. Sulfated glycosaminoglycans mediate the effects of FGF2 on the osteogenic potential of rat calvarial osteoprogenitor cells. J Cell Physiol 2006;209:811– 825. Newman P, Bonello F, Wierzbicki AS et al. The uptake of lipoproteinborne phylloquinone (vitamin K1) by osteoblasts and osteoblast-like cells: Role of heparan sulfate proteoglycans and apolipoprotein E. J Bone Miner Res 2002;17:426 – 433. Nurcombe V, Ford MD, Wildschut JA et al. Developmental regulation of neural response to FGF-1 and FGF-2 by heparan sulfate proteoglycan. Science 1993;260:103–106. Brickman YG, Ford MD, Gallagher JT et al. Structural modification of fibroblast growth factor-binding heparan sulfate at a determinative stage of neural development. J Biol Chem 1998;273:4350 – 4359. Yeo TK, Yeo KT, Wight TN. Differential transport kinetics of chondroitin sulfate and dermatan sulfate proteoglycan by monkey aorta smooth muscle cells. Arch Biochem Biophys 1992;294:9 –16. Vlodavsky I, Bar-Shavit R, Ishai-Michaeli R et al. Extracellular sequestration and release of fibroblast growth factor: A regulatory mechanism? Trends Biochem Sci 1991;16:268 –271. Gallagher JT. Heparan sulfate: Growth control with a restricted sequence menu. J Clin Invest 2001;108:357–361. Esko JD, Lindahl U. Molecular diversity of heparan sulfate. J Clin Invest 2001;108:169 –173. Jiao X, Billings PC, O’Connell MP et al. Heparan sulfate proteoglycans (HSPGs) modulate BMP2 osteogenic bioactivity in C2C12 cells. J Biol Chem 2007;282:1080 –1086. Engler AJ, Sen S, Sweeney HL et al. Matrix elasticity directs stem cell lineage specification. Cell 2006;126:677– 689. McBeath R, Pirone DM, Nelson CM et al. Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev Cell 2004;6:483– 495. Prabhakar V, Capila I, Bosques CJ et al. Chondroitinase ABC I from Proteus vulgaris: Cloning, recombinant expression and active site identification. Biochem J 2005;386:103–112. Pikas DS, Li JP, Vlodavsky I et al. Substrate specificity of heparanases from human hepatoma and platelets. J Biol Chem 1998;273: 18770 –18777. Okada Y, Yamada S, Toyoshima M et al. Structural recognition by recombinant human heparanase that plays critical roles in tumor metastasis. Hierarchical sulfate groups with different effects and the essential target disulfated trisaccharide sequence. J Biol Chem 2002; 277:42488 – 42495. Kram V, Zcharia E, Yacoby-Zeevi O et al. Heparanase is expressed in osteoblastic cells and stimulates bone formation and bone mass. J Cell Physiol 2006;207:784 –792. Rodan GA, Noda M. Gene expression in osteoblastic cells. Crit Rev Eukaryot Gene Expr 1991;1:85–98. Sedita J, Izvolsky K, Cardoso WV. Differential expression of heparan sulfate 6-O-sulfotransferase isoforms in the mouse embryo suggests distinctive roles during organogenesis. Dev Dyn 2004;231:782–794. Li X, Liu P, Liu W et al. Dkk2 has a role in terminal osteoblast differentiation and mineralized matrix formation. Nat Genet 2005;37: 945–952. Holmen SL, Zylstra CR, Mukherjee A et al. Essential role of beta-catenin in postnatal bone acquisition. J Biol Chem 2005;280:21162–21168. Varki A. Six blind men and the elephant—the many faces of heparan sulfate. Proc Natl Acad Sci U S A 2002;99:543–545. Manton KJ, Sadasivam M, Cool SM et al. Bone-specific heparan sulfates induce osteoblast growth arrest and downregulation of retinoblastoma protein. J Cell Physiol 2006;209:219 –229. David G, Bai XM, Van der Schueren B et al. Developmental changes in heparan sulfate expression: In situ detection with mAbs. J Cell Biol 1992;119:961–975. Reiland J, Sanderson RD, Waguespack M et al. Heparanase degrades syndecan-1 and perlecan heparan sulfate: Functional implications for tumor cell invasion. J Biol Chem 2004;279:8047– 8055. Oohira A, Matsui F, Watanabe E et al. Developmentally regulated expression of a brain specific species of chondroitin sulfate proteoglycan, neurocan, identified with a monoclonal antibody IG2 in the rat cerebrum. Neuroscience 1994;60:145–157.