980 Journal of Food Protection, Vol. 68, No. 5, 2005, Pages 980–985
Distribution of Listeria monocytogenes Subtypes within a Poultry Further Processing Plant† M. E. BERRANG,1* R. J. MEINERSMANN,1 J. F. FRANK,2 D. P. SMITH,1 1U.S.
AND
L. L. GENZLINGER2
Department of Agriculture, Agricultural Research Service, Russell Research Center, Athens, Georgia 30605; and 2Department of Food Science and Technology, University of Georgia, Athens, Georgia 30602, USA MS 04-520: Received 15 November 2004/Accepted 5 February 2005
ABSTRACT Samples from environmental sites and raw product in a chicken further processing plant were collected every 6 weeks for 12 months. Each sample site was examined before and after a complete production shift. All samples were examined for the presence of Listeria monocytogenes, which was detected in floor drains on the raw product side of the plant preoperation and in drains on both raw and cooked sides following 8 h of processing operation. L. monocytogenes also was detected in raw product and once in fully cooked product but never on cooked product contact surfaces. One hundred sixty-one isolates were collected from 75 positive samples. All isolates were subtyped using a sequence-based method, and 14 unique subtypes were detected through the course of the study. Four of these types were found repeatedly and appeared to be resident in the plant. Three of the four resident strains were detected on raw product at some point during the year-long study, suggesting that raw product may be one source of L. monocytogenes in the processing plant environment. These data highlight the need for research to investigate why some types of L. monocytogenes persist in a processing plant environment but others do not.
Listeria monocytogenes is recognized as an important foodborne pathogen. Although relatively uncommon, foodborne listeriosis has a high mortality rate in susceptible individuals. The pathogen has been found in association with poultry further processing plants and can contaminate fully cooked ready-to-eat poultry. A 2002 outbreak of listeriosis in the United States that resulted in eight deaths and three miscarriages or stillbirths was traced to fully cooked poultry meat products (1). Unlike Salmonella or Campylobacter, L. monocytogenes does not enter the broiler slaughter plant in large numbers with the live bird (8). Prevalence of L. monocytogenes on broiler carcasses can increase during passage through the slaughter and processing plant (8, 10, 11, 26). However, after the implementation of the U.S. Department of Agriculture pathogen reduction ruling (hazard analysis critical control point) in poultry slaughter establishments, Berrang et al. (4) were unable to consistently detect high prevalence of L. monocytogenes on chilled carcasses. Therefore, we focused on further processing as the most important area of concern for L. monocytogenes. L. monocytogenes can be present in the further processing plant environment and thus sets the stage for potential contamination of meat after thermal processing and before packaging. Although information exists on the use of molecular subtyping to track L. monocytogenes in meat processing plants, much of that work was conducted outside * Author for correspondence. Tel: 706-546-3551; Fax: 706-546-3066; E-mail:
[email protected]. † Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.
the United States and/or in plants that were not producing ready-to-eat poultry products (3, 7, 9, 14–16, 21, 22). In an earlier study (5), we examined 40 environmental sites within a poultry further processing plant and detected L. monocytogenes in more than half of them. Examination of isolates by subtyping revealed that multiple types of L. monocytogenes were present in the environment of this specific plant. Those data and the work of others (12, 14, 20, 22) indicate that L. monocytogenes can be present in floor drains and other sites in a further processing plant, which can be sources of contamination for product contact surfaces and even fully cooked product. The objectives of the current study were to (i) gain information relative to how L. monocytogenes may be entering a commercial poultry further processing plant, (ii) determine where the pathogen can be found within the plant (possibly leading to contamination of product contact surfaces), and (iii) establish whether certain strains can become long-term residents in the plant environment. We sampled incoming raw product and environmental surfaces and sites in a commercial plant every 6 weeks through the course of 12 months. All surfaces and sites were examined before the start of a processing shift (after sanitation) and again after the completion of one entire shift. All isolates detected were subjected to a DNA sequence–based subtyping method for comparison. MATERIALS AND METHODS Further processing plant. All samples were collected from one of three processing lines in a commercial poultry further processing plant. The line sampled was primarily used for boneless whole muscle product, which was marinated in a vacuum tumbler, fully cooked, mechanically diced, and then frozen. On two occasions during the study, we took samples when raw comminuted
J. Food Prot., Vol. 68, No. 5
product was being used to make a formed product, which was then cooked and frozen. Most of the raw product entering the line was from one slaughter plant, which was located several miles from the further processing plant. Boneless raw product was transported from the slaughter-and-debone plant to the further processing plant by refrigerated truck. Areas of the plant where raw product was received and prepared were physically separated by walls and doors from areas where cooked product was handled. Raw product could move to the cooked side only by passing through the oven. Separate crews with different smock colors worked on each side of the plant. Air flow was directed from the cooked side to the raw side of the plant. Nevertheless, there was a limited amount of unavoidable transfer of personnel and equipment from one side to the other. Such transfer was accompanied by foot dips, hand and tool wash stations, and employee smock changes. Sampling plan. Sampling was conducted nine times during a 12-month period, about once every 6 weeks. The line was sampled between completion of the night sanitation shift and start of the day’s production run. Environmental sample sites included floor drains and condensate drip tubes from overhead coolers on both the raw and cooked sides of the plant. These nonproduct contact sample sites were chosen based on results from an earlier study in the same plant, which identified these areas as likely to harbor L. monocytogenes (5). On the raw side of the plant, two floor drains and two condensate drip tubes were examined. On the cooked side of the plant, three floor drains and three condensate drip tubes were examined. Further sampling was conducted on five cooked product contact surfaces. One technician was dedicated to sampling the cooked product contact surfaces, the second was dedicated to environmental sample sites on the cooked side, and the third was dedicated to environmental sample sites on the raw side. The same samples sites were reexamined after an entire 8-h processing shift was completed. During the course of the processing shift, a sample was collected from each batch of raw product entering the line and added to a series of pooled samples. During the last five sample trips, extra environmental samples were taken on both the raw and cooked side of the plant during operation to search for L. monocytogenes. Samples and methodology. Each floor drain was examined as a two-part sample consisting of the drain cover and the pipe below the floor surface. The covers were removed and the underside of the grate and the drain bowl was swabbed using a sterile sponge (18-oz Speci-Sponge, Nasco, Fort Atkinson, Wis.). A second sterile sponge was then fitted into a sterile clamp, which was attached to an aluminum pipe about 32 in. (81 cm) long. The clamp apparatus was used to insert the sponge into the drain pipe as deep as possible (to the trap or to the limit of the pipe length). The sponge was then used to swab the inner surface of the drain pipe. Condensate drip tubes from overhead coolers were swabbed with a sterile cotton-tipped applicator (Becton Dickinson Microbiology Systems, Sparks, Md.), which was inserted and used to swab the inner surface of the tube. Each sponge was premoistened with 10 ml of Dey-Engley (DE) neutralizing broth (Becton Dickinson), and each applicator was premoistened with 1 ml of DE neutralizing broth. Each of the five cooked-product contact surfaces was sampled by a sterile sponge premoistened with 10 ml of DE neutralizing broth. One sponge width across each cooked-product contact surface was sampled. Contact surfaces were chosen to include areas between the cooking step and packaging. Sample sites included three product control paddles on the conveyor between the oven and spiral cooler, the stainless steel transfer slide used to
LISTERIA IN A POULTRY PLANT
981
move product from the spiral cooler exit conveyor into the dicer, the product contact surface of the transfer slide used to move product from the dicer into the freezer, the product contact surface of the transfer slide used to move product from the freezer into the shaker, and the product contact surface of the transfer slide used to move product from the shaker into the metal detector immediately prior to packaging in plastic-lined wholesale boxes. Weep from cut-up boneless raw product (thighs or breasts) was sampled. A sterile sponge premoistened with 10 ml of phosphate-buffered saline was placed into weep that remained in each combo bin after it was emptied onto the line. On two sample days, comminuted raw product was being used as the starting point. In these cases, a sterile sponge was used to wipe excess raw product off the inside of the bin after it was emptied onto the line. All raw product samples collected between start up and morning break were pooled, samples between morning break and lunch were pooled, samples between lunch and afternoon break were pooled, and samples between afternoon break and shift end were pooled. For each sample day, this protocol resulted in four pooled raw product samples including up to 10 sponges each. Culture microbiology. Within 15 min of collection of surface samples and within 1 h of collection of raw product samples, 50 ml of sterile Listeria enrichment broth (UVM formulation, Oxoid Ltd., Basingstoke, Hampshire, UK) was added to each sample sponge in its bag and 9 ml was added to each cotton-tipped applicator in its tube. All samples were then covered with ice for the duration of the processing shift and for transport to the laboratory. Upon arrival at the laboratory later that same day, all samples were handled following the Food Safety and Inspection Service methodology for L. monocytogenes (13). Samples were preenriched in Listeria enrichment broth for 18 to 24 h at 308C. An aliquot (0.1 ml) of each preenriched sample was transferred to a 10-ml tube of Fraser broth (Oxoid) and incubated at 358C for 24 to 48 h. After 24 h, cultures from all darkened tubes of Fraser broth were streaked onto the surface of modified Oxford (MOX) agar (Remel, Lenexa, Kans.) plates; Fraser broth tubes that were not dark after 24 h were allowed to incubate for another 24 h and then reexamined. A loop was used to sweep through 5 to 10 small black colonies on the MOX plates characteristic of L. monocytogenes. Presumptive Listeria isolates were tested for beta hemolyis by streaking on horse blood overlay plates. At least two betahemolytic colonies from each positive sample were used to confirm the suspect isolates as L. monocytogenes by positive Gram reaction, positive reaction on a CAMP (Christie, Atkins, Munch, Petersen) test, formation of acid from rhamnose but not xylose or mannitol, positive catalase reaction, and tumbling motility under a wet mount. All confirmed L. monocytogenes isolates were frozen using cryopreservation beads (Prolab Diagnostics, Richmond Hill, Ontario, Canada) at 2808C for further examination by sequencebased typing. Sequence-based typing. Cai et al. (6) suggested sequencing of actA for subtyping of L. monocytogenes. In a previous study (18), we found that sequencing of actA was as discriminatory as a multilocus sequence typing scheme using 11 housekeeping genes. All isolates were grown from frozen storage and subjected to a typing method based on the DNA sequence of actA. One loopful of cells was taken from an overnight culture of each strain grown on brain heart infusion plates at 358C. The cells were washed once in 0.5 ml of sterile distilled water, resuspended in 0.5 ml of sterile distilled water, and then placed in a 1008C dry bath for 10 min for lysis. One microliter of the lysed cells was used for PCR in a 50-ml reaction mixture containing 0.5 U Am-
— —
— —
C D
— — — —
— —
— —
— —
— —
— —
— —
— —
C, F —
— —
— —
— —
D
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
— —
Drain 5 Cover Pipe
— A
D —
— —
— —
Drain 4 Cover Pipe
— —
— —
Cook side Drain 3 Cover Pipe — —
— — H — — — — — — — — — — F — — — — — F — — — — — — — J — — — — —
— — —
— — —
— — —
— — —
— — —
— — —
— — —
BERRANG ET AL.
— —
— — — — — — — — —
C
—
—
— D, ut — — — — — — M G — — — — — —
— D
—
— —
F, G F
N N
A A, F
Post
— C
— —
— C, K
F F
Pre
— —
F —
L F, L
H A, D
Post
C, L A
— —
— —
— —
Pre
— —
C, F —
C, K D, L
A, G, D D, F, H
Post
— —
A, D —
— —
A —
Pre
— —
— —
— D, E
H —
Post
— —
— —
— G
D —
Pre
9
— —
— —
— —
ut, ut D
Post
8
—
— —
— —
— —
— D
A A, D
Pre
7
—
— —
— —
— —
— C, H
— A, G
Post
6
—
— —
— —
— —
C —
A A
Pre
5
—
I —
— —
— —
— D, ut
G —
Post
4
—
3
Other samplese Morning Hose Afternoon Door handle Drain Puddle
— —
— Dd
— —
— —
— —
— —
— —
— —
D D
F H, D
Pre
— —
— —
— C, A
A A
Post
— E
— —
— —
A A
Pre
— —
— —
Drain 6b Cover Pipe
— —
— —
Post
2
— B
— —
Drain 2 Cover Pipe
Raw productc Morning Before break After break Afternoon Before break After break
— —
Pre
Raw side Drain 1 Cover Pipe
Sample type
1
Sampling trips:
TABLE 1. L. monocytogenes subtypes detected in samples from a chicken further processing plant that were obtained pre- and postoperation during a 12-month perioda
982 J. Food Prot., Vol. 68, No. 5
LISTERIA IN A POULTRY PLANT
— — — F — —
Pre Post
— — — —
Post
Pre
8
— — — —
— —
Post
Pre
7 6 Pre
983
plitaq DNA polymerase (Applied Biosystems, Foster City, Calif.), a final concentration of 13 buffer supplied by the manufacturer, forward primer (GACCTAATAGCAATGTT), and reverse primer (GTAAAACTAGAATCTAGCGA). Thermal cycling was carried out in a Mastercycler Gradient (Eppendorf Corp., Hamburg, Germany) using the following conditions: denaturing at 948C for 15 s, annealing at 528C for 30 s, and extension at 728C for 60 s. After 40 cycles, the product was recovered and purified using the Qiagen PCR purification system (Qiagen, Valencia, Calif.) according the manufacturer’s instructions. The same primers were used for the sequencing reaction using the Big Dye Terminator version 1.1 cycle sequencing kit (Perkin-Elmer, Boston, Mass.) at one-twelfth reaction strength. Sequence was determined on an ABI 3100 Capillary Automated DNA Sequencer (Perkin-Elmer). A minimum of one forward and one reverse reaction was carried out for each PCR product, and SEQUENCHER version 3.1.2 (Gene Codes Corporation, Ann Arbor, Mich.) was used to resolve ambiguous bases. DNA sequences were aligned using ClustalX (24). A total of 660 sequence characters were analyzed except in several isolates that lacked a 105-bp direct repeat. An absolute distance matrix for all the sequences was generated using the computer program PAUP* 4.0b10 (23), and all sequences that were identical were assigned the same letter code.
9
Post
J. Food Prot., Vol. 68, No. 5
— —
Post
C — — — Subtypes (A–N) were determined based on actA sequences; ut, untypeable. Sampled on trips 7, 8, and 9. c Composite sample from all raw product used on line between breaks in processing. d Subtype D detected in fully cooked product between trips 2 and 3. e Extra samples taken to search for L. monocytogenes in various sites within plant. b
— — Other samplese Morning Cooler frame Oven drain
a
— — — — — — — — — — — —
Pre Sample type
TABLE 1. Continued
1
Post
Pre
2
Post
Pre
3
Post
Pre
4
Post
Pre
5
Sampling trips
RESULTS AND DISCUSSION L. monocytogenes was cultured from environmental samples obtained during every trip to the plant (Table 1). Most of the isolates were found in floor drains. The extra samples taken yielded at least one isolate in four of the five sample trips during which they were collected. On seven of the nine sampling trips, L. monocytogenes was also detected in at least one of the pooled samples from raw product. L. monocytogenes was not detected on any cooked product contact surface or in any condensate drip tubes before or after operation. During the course of this study, a total of 161 isolates of L. monocytogenes were obtained from 75 positive samples. The isolates were separated into 14 discrete subtypes labeled alphabetically A through N. The sequences were subjected to analysis by the neighborjoining algorithm using absolute difference distances. Two major groups were observed (Fig. 1) that are characteristic of L. monocytogenes in lineage I and lineage II (6, 18). Four isolates that were confirmed as L. monocytogenes by culture methods were untypeable because of failure to produce PCR product. In an earlier study conducted in the same plant, 15 subtypes were isolated from environmental samples collected on 1 day. In that study, L. monocytogenes was detected in condensate drip tubes, on floor surfaces, and within floor drains (5). In the current study, more drains on the raw side were contaminated with L. monocytogenes than were drains on the side of the plant where cooked product was handled. This finding suggests that physical barriers and personnel controls were working to separate the raw and cooked side of the plant and limit contamination of the cooked side. Drains on the cooked side were never positive prior to operation of the plant, whereas drains on the raw side were positive prior to operation on seven of the nine sampling trips. When a drain was positive before operation, it was always positive after operation; however, the same subtype was not always detected after a shift was completed. More
984
BERRANG ET AL.
J. Food Prot., Vol. 68, No. 5
FIGURE 1. Cluster analysis of L. monocytogenes isolates. The dendrogram was produced by the neighbor-joining algorithm using the absolute nucleic acid base differences as the distance. Clusters that are characteristic of lineage I and lineage II are indicated.
than one subtype of L. monocytogenes could be detected together in a floor drain. As many as five distinct subtypes were found in association within a single drain (pipe and cover) on one sample day. L. monocytogenes was detected in cooked side floor drains only postoperation. Preoperational sanitation may have lowered the numbers to below detectable levels but not eliminated the organism. Alternatively, the drains may have been seeded during the shift by personnel, product, or equipment transfer from the raw side to the cooked side. In all but two cases (subtype A on trip 1 and subtype F on trip 4), the subtype detected in drains on the cooked side was also detected somewhere on the raw side on that same day. We detected subtype A in floor drains and/or their covers on seven of the nine trips and from raw product on trip 8. Type D also was found in floor drains (both cooked and raw sides) on seven of the nine trips. Type D was first detected in association with raw product in the afternoon of trip 2. Later that same day, type D was detected in a drain on the cooked side of the plant. In the time between sample trips 2 and 3, plant quality assurance personnel detected L. monocytogenes in fully cooked product. When the cooked product isolate was typed, it was indistinguishable from type D previously detected on raw product and in drains on the cooked side. Subsequently, type D was repeatedly isolated from floor drains on six of the remaining
seven trips. Temporal relationships are difficult to ascertain from sampling done at 6-week intervals. Nevertheless, these data suggest that type D entered the plant with raw product, became a resident in the plant, and eventually was detected in association with fully cooked product. We applied the same method of sequence-based typing to L. monocytogenes isolates collected from the production line in a previous study (5) and found that types A, C, D, F, and to a lesser degree G, K, and N had been isolated more than 1 year before the onset of the current 12-month project. This finding impacts our thinking relative to when these types (including type D) may have first entered the plant. However, the question remains as to whether these persistent types are resident and continually present in the plant or are being periodically reintroduced from a common source. A plant persistent type may be defined as one that can be reisolated from multiple sites over an extended period of time. Only the four most common persistent types (A, C, D, and F) and no transient types were detected on the side of the plant where cooked product was handled. Three of these four most common types (A and D detected on seven trips and C detected on six trips) were also detected in raw product at some point (type D three times). A total of nine types were detected in raw product during this study, but only A, C, and D were persistent in the plant through the course of 1 year. Although there are many po-
J. Food Prot., Vol. 68, No. 5
tential sources of L. monocytogenes in a further processing plant (25), the current data and those from previous studies (7, 11, 12, 14, 19) suggest that incoming raw product is an important source. Many types of L. monocytogenes may trickle into the plant with raw product, with only some of them becoming persistent. Whether persistence is due to entry into the plant in higher numbers or more frequently or to some physiological difference or adaptation is not known. Other researchers have reported the detection of persistent strains of L. monocytogenes within meat processing plants (3, 7, 16, 21). It is not clear why some strains are persistent or become resident in the plant. Autio et al. (2) noted that strains of L. monocytogenes that were characterized as persistent within a plant were genetically distinct from those that were isolated only sporadically. Genetic differences may result in phenotypic differences that affect an organism’s ability to survive or thrive in the environment of a poultry further processing plant. L. monocytogenes can form biofilms and adhere to surfaces. Lunden et al. (17) found that strains characterized as persistent adhered to surfaces more rapidly than did other strains. More research is needed to compare biofilm formation of persistent and transient strains of L. monocytogenes. More research is also required to determine the role that the local environment plays in providing a steady source of L. monocytogenes to continuously contaminate a plant despite efforts at control.
LISTERIA IN A POULTRY PLANT
9.
10.
11.
12.
13.
14.
15.
16.
17.
ACKNOWLEDGMENTS The authors are grateful to Mark N. Freeman and Julie Ehlers for expert technical assistance.
18.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
Anonymous. 2002. Public health dispatch: outbreak of listeriosis— northeastern United States, 2002. Morb. Mortal. Wkly. Rep. 51:950– 951. Autio, T., R. Keto-Timonen, J. Lunden, J. Bjorkroth, and H. Korkeala. 2003. Characterization of persistent and sporadic Listeria monocytogenes strains by pulsed-field electrophoresis (PFGE) and amplified fragment length polymorphism (ALFP). Syst. Appl. Microbiol. 26:539–545. Autio, T., J. Lunden, M. Fredriksson-Ahomaa, J. Bjorkroth, A. M. Sjoberg, and H. Korkeala. 2002. Similar Listeria monocytogenes pulsotypes detected in several foods originating from different sources. Int. J. Food Microbiol. 77:83–90. Berrang, M. E., C. E. Lyon, D. P. Smith, and J. K. Northcutt. 2000. Incidence of Listeria monocytogenes on pre-scald and post-chill chicken. J. Appl. Poult. Res. 9:546–550. Berrang, M. E., R. J. Meinersmann, J. K. Northcutt, and D. P. Smith. 2002. Molecular characterization of Listeria monocytogenes isolated from a poultry further processing facility and from fully cooked product. J. Food Prot. 65:1579. Cai, S., D. Y. Kabuki, Y. Kuaye, T. G. Cargioli, M. S. Chung, R. Nielsen, and M. Wiedmann. 2002. Rational design of DNA sequence-based strategies for subtyping Listeria monocytogenes. J. Clin. Microbiol. 40:3319–3325. Chasseignaux, E., M. T. Toquin, C. Ragimbeau, G. Salvat, P. Colin, and G. Ermel. 2001. Molecular epidemiology of Listeria monocytogenes isolates collected from the environment, raw meat and raw products in two poultry and pork processing plants. J. Appl. Microbiol. 91:888–899. Cox, N. A., J. S. Bailey, and M. E. Berrang. 1997. The presence of Listeria monocytogenes in the integrated poultry industry. J. Appl. Poult. Res. 6:116–119.
19.
20.
21.
22.
23.
24.
25.
26.
985
Dauphin, G., C. Ragimbeau, and P. Malle. 2001. Use of PFGE typing for tracing contamination with Listeria monocytogenes in three coldsmoked salmon processing plants. Int. J. Food Microbiol. 64:51–61. Fenlon, D. R., J. Wilson, and W. Donachie. 1996. The incidence and level of Listeria monocytogenes contamination of food sources at primary production and initial processing. J. Appl. Bacteriol. 81: 641–650. Franco, C. M., E. J. Quinto, C. Fente, J. L. Rodriguez-Otero, L. Dominguez, and A. Cepeda. 1995. Determination of the principal sources of Listeria spp. contamination in poultry meat and a poultry processing plant. J. Food Prot. 58:1320–1325. Gudbjornsdottir, B., M. L. Suihko, P. Gustavson, G. Thorkelsson, S. Salo, A. M. Sjoberg, O. Niclasen, and S. Bredholt. 2004. The incidence of Listeria monocytogenes in meat, poultry and seafood plants in the Nordic countries. Food Microbiol. 21:217–225. Johnson, J. L. 1998. Isolation and identification of Listeria monocytogenes from meat, poultry and egg products. U.S. Department of Agriculture Food Safety and Inspection Service microbiology laboratory guidebook, 8-1-8-18, 3rd ed. U.S. Department of Agriculture, Food Safety and Inspection Service, Washington, D.C. Lawrence, L. M., and A. Gilmour. 1995. Characterization of Listeria monocytogenes isolated from poultry products and from the poultry processing environment by random amplification of polymorphic DNA and multilocus enzyme electrophoresis. Appl. Environ. Microbiol. 61:2139–2144. Lunden, J. M., T. J. Autio, and H. J. Korkeala. 2002. Transfer of persistent Listeria monocytogenes contamination between food-processing plants associated with a dicing machine. J. Food Prot. 65: 1129–1133. Lunden, J. M., T. J. Autio, A. M. Sjoberg, and H. J. Korkeala. 2003. Persistent and non persistent Listeria monocytogenes contamination in meat and poultry processing plants. J. Food Prot. 66:2062–2069. Lunden, J. M., M. K. Miettinen, T. J. Autio, and H. J. Korkeala. 2000. Persistent Listeria monocytogenes strains show enhanced adherence to food contact surface after short contact times. J. Food Prot. 63:1204–1207. Meinersmann, R. J., R. W. Phillips, M. Wiedmann, and M. E. Berrang. 2004. Multilocus sequence typing of Listeria monocytogenes by use of hypervariable genes reveals clonal and recombination histories of three lineages. Appl. Environ. Microbiol. 70:2193–2203. Miettinen, M. K., L. Palmu, K. J. Bjorkroth, and H. Korkeala. 2001. Prevalence of Listeria monocytogenes in broilers at the abattoir, processing plant and retail level. J. Food Prot. 64:994–999. Samelis, J., and J. Metaxopoulos. 1999. Incidence and principal sources of Listeria spp. and Listeria monocytogenes contamination in processed meats and a meat processing plant. Food Microbiol. 16:465–477. Senczek, D., R. Stephan, and F. Untermann. 2000. Pulsed field get electrophoresis (PFGE) typing of Listeria strains isolated from a meat processing plant over a 2-year period. Int. J. Food Microbiol. 62:155–159. Suihko, M. L., S. Salo, O. Niclasen, B. Gudbjornsdottir, G. Torkelsson, S. Bredholt, A. M. Sjoberg, and P. Gustavson. 2002. Characterization of Listeria monocytogenes isolates from the meat, poultry and seafood industries by automated ribotyping. Int. J. Food Microbiol. 72:137–146. Swofford, D. L. 1998. PAUP*: phylogenic analysis using parsimony (*and other methods), version 4.0b4. Sinauer Associates, Sunderland, Mass. Thomson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680. Tompkin, R. B., V. N. Scott, D. Bernard, W. Sveum, and K. S. Gombas. 1999. Guidelines to prevent post-processing contamination from Listeria monocytogenes. Dairy Food Environ. Sanit. 19:551–562. Whyte, P., K. McGill, C. Monahan, and J. D. Collins. 2004. The effect of sampling time on the levels of micro-organisms recovered from broiler carcasses in a commercial slaughter plant. Food Microbiol. 21:59–65.
