Wei He, Qingjuan Yang, Zhihong Liu, Xiaobo Yu, and. Danke Xu. Department of Biochemistry, Institute of Radiation Medicine,. Beijing, China. Abstract: A novel ...
Analytical Letters, 38: 2567–2578, 2005 Copyright # Taylor & Francis, Inc. ISSN 0003-2719 print/1532-236X online DOI: 10.1080/00032710500369752
ELECTROCHEMICAL DNA BIOSENSORS
DNA Array Biosensor Based on Electrochemical Hybridization and Detection Wei He, Qingjuan Yang, Zhihong Liu, Xiaobo Yu, and Danke Xu Department of Biochemistry, Institute of Radiation Medicine, Beijing, China
Abstract: A novel array biosensor was developed to assay DNA fragments in which the electrochemical method was used to accomplish rapid hybridization as well as detection. The DNA capture probes were immobilized on a photolithographically gold array electrode by self-assembly and chemical conjugation technique. The target sequence was detected by coupling avidin-alkaline phosphatease to the biotinylated DNA fragments and measuring the current signal obtained from the hydrolysis of a-naphthyl phosphate. Compared with the regular hybridization, the novel electrochemical approach could significantly enhance hybridization speed. The present method was further employed to quantitatively detect the PCR products of hepatitis B virus plasmid. In addition, the array biosensor also proved able to screen multicomponent samples. Keywords: DNA array biosensor, nucleic acids detection, electrochemical hybridization
Received 19 April 2005; accepted 16 July 2005 This work was supported by the Hi-Tech Research and Development Program of China (863 Program, No. 2002-BA711A11) and National Basic Research Program of China (973 Program, No. 2004CB520804). Address correspondence to Danke Xu, Department of Biochemistry, Institute of Radiation Medicine, 27 Taiping Road, Beijing 100850, China. E-mail: xudk@nic. bmi.ac.cn 2567
2568
1.
W. He et al.
INTRODUCTION
There is currently interest in development of integrated analytical devices that incorporate multiple analytical function and analytes into small units (Ligier et al. 2002; Liu et al. 2002; Trau et al. 2002; Prix et al. 2002; Weidenhammer et al. 2001; Seong et al. 2002; Forster et al. 2001). Much of the current research interest in this field is focused on DNA analysis devices such as DNA array (Liu et al. 2002; Trau et al. 2002; Prix et al. 2002; Weidenhammer et al. 2001) and DNA microfluidic chips (Seong et al. 2002; Forster et al. 2001). These technologies have become indispensable tools in the study of gene function, gene expression, and drug discovery. In the fields of clinical diagnostics, environmental monitoring, and detection of pathogens in food, on the other hand, the requirement remains to develop fast and high-throughput electrochemical analytical method for the certain specific target gene and PCR products (Wang 2002; Palecek 2002; Drummond et al. 2003). Electrochemical transducers have received considerable attention in connection to the detection of DNA hybridization due to the high sensitivity, small dimensions, low cost, and compatibility with microfabrication technologies (Wang et al. 1996a; Wang et al. 1997a; Hashimoto et al. 1994; Lumley-Woodyear et al. 1999; Wang et al. 2001; Maruyama et al. 2002; Kerman et al. 2002; Wang et al. 2003; Ozsoz et al. 2003; Kerman et al. 2004; Ozkan et al. 2004; Xu et al. 2001; Kara et al. 2004; Palecek et al. 2002; Wang et al. 2002; Fojta et al. 2004). A microtiter plate is well-known as a traditional parallel analytical tool for immunoassay. On the other hand, DNA hybridization was mainly carried out through membrane blot due to DNA oligomer probes rather than poor absorption property on the conventional polystyrene surface of the microtiter plate. However, it is difficulty to assay the results of membrane hybridization quantitatively and automatically. It has been well-known that self-assembled monolayers (SAMs) on gold are surfaces that are structurally well defined at the molecular level. A gold-modified microtiter plate (Qian et al. 2002) was developed to immobilize a-D -mannopyranoside on the microwell through alkanethiolates, SAMs, and further to capture bacteria. In the recent decade, gold electrodes or photolithographically gold film were successfully reported to be appropriate candidates for immobilization of DNA oligomer probes and then such DNA sensing electrodes could be employed to capture complementary DNA fragments (Hashimoto et al. 1994; Maruyama et al. 2002; Kerman et al. 2002; Xu et al. 2001; Kara et al. 2004). However, there are few reports that such sensing electrodes have been integrated further so that multifunctions such as hybridization and detection or parallel analysis could be accomplished. In this report we describe the development of an array electrochemical DNA biosensor, in which a photolithographically array gold electrode is coupled to a poly(dimethylsiloxane) (PDMS) frame so that the resulting array device could be used to electrochemically hybridize with small-volume DNA samples in parallel and assay multicomponent DNA targets.
DNA Array Biosensor
2569
Compared to conventional hybridization in solution phase, heterogeneous hybridization such as DNA sensor and DNA microarray would lead to slow hybridization kinetics. However, this process could efficiently be accelerated in the presence of an applied electrostatic field (Weidenhammer et al. 2002; Wang et al. 1996b, 1997b; Marrazza et al. 1999a, 1999b) or a dc current (Heaton et al. 2002). Our goal is to explore the possibility of combining electrochemically hybridization with detection in one integrated system. The cyclic potential switched between the positive and negative potential was developed to perform hybridization in the array biosensor and then the hybrids were assayed by electrochemical detection based on alkaline phosphatase (AP) enzyme amplification since enzyme-linked methods have been shown to be highly sensitive detection approaches (Lumley-Woodyear et al. 1999; Xu et al. 2001; Palecek et al. 2002; Wang et al. 2002; Fojta et al. 2004). As a result, such an electrochemical biosensor could control and accelerate hybridization process by an electrochemical procedure. We have also used this method to quantify hepatitis B virus (HBV) amounts. Meanwhile, the present method could also be applied in multicomponent sample screen. 2. 2.1
EXPERIMENTAL SECTION Apparatus
Cyclic voltammetric and differential pulse voltammetric measurements were carried out with a Model 660 Electrochemical Workstation. (CH Instruments Inc., Austin,TX). The regular hybridization experiments were performed with a model 1339 Hybridization Incubator (Beijing Institute of New Technology Application, Beijing, China). 2.2
Reagents and Materials
Avidin-alkaline phosphatase (AV-AP) and a-naphthyl phosphate (NAPT) were purchased from Sigma (St. Louis, MO, USA). Calf thymus DNA, Ficoll 400, bovine serum albumin, and sodium dextran sulfate were obtained from Sino-American Biotechnology Co. (Beijing, China).Other chemicals were of analytical-reagent grade. The synthetic oligonucleotides were purchased from Sangon Co. (Shanghai, China); their base sequences shown here: Immobilized probe: NH2-(CH2)6-50 AGGACACGTGGGTGCTCC30 Target oligomer (begins at map position 286 of the S-gene of HBV33): Biotin-50 CTAGGGGGAGCACCCACGTGTCCTGGCCAA30 Noncomplementary oligomer: Biotin-50 AACTGGAGGAAGGTGGGGA
2570
2.3
W. He et al.
Polymerase Chain Reaction (PCR)
A 144-base pair (bp) DNA fragment from the hepatitis B virus DNA plasmid was amplified by asymmetric polymerase chain reaction (PCR) with primer biotin -50 -CGTGG TGGAC TTCTC TCAAT-30 (forward, begins at map position 256 of the S-gene of HBV) and 50 -TGATA AAACG CCGCA GACAC-30 (reverse, begins at map position 381 of the S-gene of HBV) (Fujiyama et al. 1983). The HBV-DNA template was first amplified through the asymmetric PCR technique according to the ratio 25 : 1 of the forward to the reverse primers. The thermal cycling conditions were as follows: initial denaturation at 958C for 5 min, 40 cycles at 948C for 10s, at 578C for 10s, at 728C for 30s, and a final extension at 728C for 10 min. A 2 mL sample was added to 200 mL of the hybridization buffer. For the control experiment, the noncomplementary oligomer was spiked into the hybridization buffer. The subsequent hybridization procedure was as described in Section 2.4.2.
2.4
Methods
The procedure consist of the following steps and is illustrated in Scheme 1. 2.4.1
Preparation of Array Gold Electrodes
The electrode pattern was formed on a crystal wafer substrate and 200 nm thick gold film electrodes (the dimension of each gold working electrode, 2 mm 2 mm) were prepared using vapor deposition (Xu et al. 2001). Prior to the modification, the array chip was immersed in a piranha solution (H2SO4/H2O2 : 3/1) for 30 min and then cleaned thoroughly using water and ethanol. A home-constructed poly(dimethylsiloxane) (PDMS; Dow Corning Inc.) frame was then aligned onto the electrodes such that each well would exactly match the working electrodes, as shown in Scheme 1. The 10 mL 0.02 M L-cysteamine solution prepared with 0.06 M phosphate buffer (pH 7.4) was first dropped into each well and then kept self-assembled while reacting for 1 hour. The resulting monolayer-modified gold electrodes were rinsed with the buffer twice, followed by adding 10 mL 5%(V/V) aqueous solution of glutaraldehyde into each well for a 30 min reaction. After washing them with the buffer, the electrodes were further incubated with 15 mL 20 mg/mL on the immobilized probe for 2 hours. Finally, the wells were rinsed with the phosphate buffer and then the array chip was stored in a refrigerator (48C). 2.4.2
Electrochemical Hybridization
Electrochemical hybridization experiments were performed by adding 15 mL hybridization buffer containing 2 SSC (300 mmol/L NaCl and 30 mmol/L
DNA Array Biosensor
2571
Scheme 1. Illustration of the analytical protocol. (A) Single-component analysis in parallel; (B) Multicomponent screen.
sodium citrate) and the complementary oligomer or PCR products into the microwells, followed by positioning an Ag/AgCl electrode into the microwell for hybridization electrochemically. The hybridization was performed through cyclic voltammetric procedure from 20.2 v to þ0.6 v at 100 mv/s for 30 cycles at room temperature. After the hybridization, the array electrode was washed with 2 SSC. 2.4.3
固定-CV-0.2--+0.6V
Detection
15 mL 0.5U AV-AP was first transferred into the wells for enzymatic conjugation for 15 min. Then, each microcell was washed twice with PBS, 测定-电活性物质通过亲-生 followed by adding 15 mL of 8 mmol/L NAPT solution (prepared with 方法连接，DPV检测 NaHCO3/Na2CO3 buffer, pH9.5, and 1.0 mmol/L MgCl2) into the microwells for 20 min incubation. After positioning an Ag/AgCl electrode into the microwell, the current was measured by differential pulse voltammetry (DPV) using the electrochemical working station. AP-碱性磷酸(酯)酶 NAPT-α-萘基磷酸盐 检测酶催化反应产物（催化去磷酸根成萘）
2572
2.4.4
阵列检测-专一性
W. He et al.
Multicomponent Samples Screen
For the multicomponent samples screen, four different kinds of capture probes were immobilized as Scheme 1(B) and their sequences as follows. Before hybridization, a hybridization frame was fabricated so that the sample could simultaneously be reacted with four recognizing probes in each chamber. Electrochemical hybridization procedure was same as described in Section 2.4.2. After that, the detection frame with four wells was used instead of the hybridization chamber for performing electrochemical detection, and the other procedures were the same as those in Section 2.4.3. Immobiliztion probes: P1: NH2-(CH2)6-50 -CAGCT TGGAG GCTTG AACAG-30 (as the control) P2: NH2-(CH2)6-50 -TTGAG ATCTT CTGCG ACGCG G-30 P3: NH2-(CH2)6-50 -CTGTT CAAGC CTCCA AGCTG-30 P4: NH2-(CH2)6-50 -AGGAC ACGTG TCTTG GCCAA-30 . Sample target oligomer: T1: Biotin- 50 -C CGCGT CGCAG AAGAT CTCAA -30 (complementary to P2) T2: Biotin-50 -CAGCTTGGAG GCTTG AACAG -30 (complementary to P3) T3: Biotin-50 -TTGGC CAAGA CACGT GTCCT-30 (complementary to P4) T4: Oligomer mixture containing S1 and S2 (complementary to P2 and P4). 3.
RESULTS AND DISCUSSION
Among methods using self-assembled DNA on gold, there are direct chemical adsorption (Hashimoto et al. 1994; Xu et al. 2001) and indirect chemical covalently conjugation (Maruyama et al. 2002; Kerman et al. 2002; Kara et al. 2004), respectively. In the former case, thiol-functionalized probes have to be prepared and a mixed monolayer employed to control probe density and reduce the extent of nonspecific absorption. Our previous work (Liu et al. 2001) reported the method of covalently immobilization of the DNA probes using glutaraldehyde-coupling reagents, in which cysteamine was first self-assembled on the gold surface and then the SAMs was activated through glutaraldehyde. The resulting activated SAMs were covalently coupled to DNA probes with the amino group at their 50 end. Compared to the probes with the mercapto group, the one with the amino group is facile synthesis. As a result, in this paper this method was further developed to assembly the capture DNA probes on the arrayed gold electrodes. Molecular recognition of the DNA sensor is basically based on hybridization between the single strand DNA immobilized on the transducer such
DNA Array Biosensor
2573
Figure 1. Comparison of detection results based on constant potential (A, the potential: þ500 mv) and cycling potential (B, the potential from 2200 mv to þ600 mv) hybridization with 100 ng/mL the non-complementary oligomer (a) and 100 ng/mL the target oligomer (b), respectively. Hybridization time: 4 min.
as electrodes and optic fibers and target DNA fragments of samples. In general, it usually takes a long time to perform such hybridization so that the target DNA could be coupled into the sensing surface as much as possible. However, a positive potential has been reported to use for hybridization (Wang et al. 1996b, 1997b; Marrazza et al. 1999a, 1999b) or immobilization procedure (Ge et al. 2003). In this case, DNA oligomers with negative charge would easily be appealed into the electrode hold at a positive potential. In our experiments, we established a cyclic potential scan method, in which the electrode surface potential would persistently be switched from 20.2 v to þ0.6 v. In order to compare with the hybridization under the constant potential, the same target oliogmer was hybridized to the sensor by the cyclic and constant potential, respectively. The hybrid on the sensor was further conjugated to the AP and detected by differential pulse voltammetry. It can be seen from Figure 1 that the cyclic potential could lead to higher sensitivity than the constant potential. To subtract the influence of detectable background, the peak current ratio of the signal to the background, i.e. I(signal)/I(background), was used to estimate the difference of real sensitivity. In this case, the current ratios are 3.73 for the cyclic potential and 1.88 for the constant potential, respectively. Therefore, the cyclic voltammetry was proved to produce higher hybridization efficiency than the constant potential. It has been reported (Heaton et al. 2001) that a negative potential, i.e. a repulsive potential, could result in rapid denaturation for the mismatched hybrid on the probe-modified sensor surface within a few minutes, while the fully complementary hybrid would hardly be dehybridized even after many hours of exposure to the electrostatic field. Thus, the method employing merely positive potential meant to cause the enrichment of the target fragment, but it would lead to decrease its flexibility of the fragment due to the presence of static electric force and hinder more fragment molecules to achieve hybridization. As a result, this would cause the lower
正电有利，CV比恒电压有 利-与本底比较更灵敏
2574
缩短时间，4 分钟饱和
W. He et al.
hybridization efficiency as well as higher background noise. However, perform of an additional negative potential could significantly overcome this trouble so that the fragment not hybridized would leave the electrode rapidly. Therefore, an alternating potential between the positive and negative would achieve efficient hybridization within a relative short time. The influence of hybridization time on its efficiency was further shown the advantage of this approach and the relevant results are shown in Figure 2. The hybridization efficiency would rapidly increase with time before 4 min and reach the maximum at 4 min. Then, it would gradually decrease and tend to level off. However, it has been reported that the efficiency based on the constant potential would increase with time during 30 min (Wang et al. 1996b) and the similar results have also been reported by SPR methods (Heaton et al. 2001). Compared to the constant potential as well as the regular method (without any potential), It suggested that the rapider hybridization procedure could be obtained by performing the cyclic potential. The perfect match sequence was spiked to the buffer and the concentration was 50 ng/mL. We carried out the hybridization reaction by the present method for 4 min and the regular method for 1 hour, respectively. Interestingly, the current ratio obtained by the cyclic potential exceeds those by the regular method (the current ratios were 2.45 + 0.25 and 1.98 + 0.09, respectively). It suggests that the present method owns remarkable high efficiency for hybridization. The calibration of the present sensor was first examined using the complementary target oligomer and the relation between the current ratio and the concentration is almost linear from 30 ng/mL to 3 mg/mL and the
Figure 2. Effect of hybridization time on detection signal. The cycling potential was between 2200 mv and þ600 mv; the target concentration was 150 ng/mL.
CV比正电好的 解释
DNA Array Biosensor
2575
Figure 3. Plot of the electrochemical detection signals vs. concentration of the hepatitis B plasmid.
实际样品
regression coefficient (r) was 0.997. Thus, the calibration range can be beyond two orders of magnitude and a detection limit of concentration was found to be 10 ng/mL. In order to explore the possibility of the application of the sensor to real samples, the PCR amplified product was further determined by the present method. In our experiment, the plasmid sample of hepatitis B virus was first used as the standard template and they were amplified by the asymmetric PCR reaction. The primer biotinylated group at its 50 end could produce the single-strand PCR amplicon that could further couple with AP enzyme labeled avidin. In this case, the amplicon could be assayed based on the formed electroactive product by AP enzyme catalysis. According to HBV S-gene sequence (Fujiyama et al. 1983), the capture probe on the sensor was designed to match the middle part of the sequence of the PCR amplicon. Therefore, only the amplified strand can match and bind onto the electrode by the hybridization. A series of HBV plasmid amount such as 10 pg, 100 pg, 1 ng, 10 ng, and 100 ng, were amplified, respectively, and then the product was diluted to 200 mL for the hybridization. The relation of the current ratio and the plasmid amount is shown in Fig. 3. It can be seen that the current ratio is in proportion to the amount of the template, but the relation did not exactly fit linear proportion in the concentration range. The nonlinear increase could be attributed to PCR reaction because PCR amplification efficiency would vary with the different the template amount. The array electrode was further applied to screen multicomponent samples, in which four kinds of capture probes (P1, P2, P3, and P4) were immobilized on the electrodes in each chamber respectively. As a result,
2576
W. He et al.
Figure 4. Multicomponent oligomer target sample screen. The 1 – 4 and T1 – T4 represent the immobilization probes (P1 – P4) and the target samples, respectively. The concentrations of the sample T1, T2, and T3 all were 100 ng/mL and T4 (the mixture) contained 500 ng/mL S1 and S2 oligomer targets.
samples to be assayed could simultaneously be reacted with the four capture probes for screen detection. To make a comparison clearly, the current signals were normalized and their results are shown in Fig. 4. In this experiment, target probe (T1), target probe (T2), and target probe (T3), respectively. As a result, the corresponding electrodes (electrodes 2, 3, and 4), which captured their complementary fragments, showed the reasonable positive values while the control electrode (electrode 1) kept the negative value. The mixture sample (T4) consisting of T1 and T3 also reacted with the array electrode and the result was proved to own its good selectivity. In general, it can be seen that the present method could significantly discriminate between the complementary sequence and noncomplementary sequences. Also, the electric hybridization proved to be able to assay multicomponent samples. In summary, we have developed an array DNA biosensor that was able to perform hybridization and detection electrochemically. The performance of the cyclic potential significantly promotes the hybridization process and shortens analytical time. It demonstrates that the array electrode coupling with electrochemical assay is suited for quantitative detection of PCR products. Meanwhile, it can significantly increase selectivity through the hybridization between the capture probe and the PCR fragment. The established prototype is also suited for multicomponent sample screen detection. Further miniature, automation, and high throughput research are also in progress in our laboratory.
DNA Array Biosensor
2577
REFERENCES Drummond, T.G., Hill, M.G., and Barton, J.K. 2003. Nature Biotech., 21: 1192– 1199. Fojta, M., Havran, L., Vojtiskova, M., and Palecek, E. 2004. J. Am. Chem. Soc., 126: 6532– 6533. Forster, A.H., Krihak, M., Swanson, P.D., Young, T.C., and Ackley, D.E. 2001. Biosens. Bioelectron., 16: 187– 194. Fujiyama, A., Miyanohara, A., Nozaki, C., Yoneyama, T., Ohtomo, N., and Matsubara, K. 1983. Nucleic Acids Res, 11: 4601 –4610. Ge, C., Liao, H., Yu, W., and Gu, N. 2003. Biosensors. Bioelectronics, 18: 53– 58. Hashimoto, K., Ito, K., and Ishimori, Y. 1994. Anal. Chem., 66: 3830– 3833. Heaton, R.J., Peterson, A.W., and Georgiadis, R.M. 2001. Proc. Narl. Acad. Sci. USA, 98: 3701– 3704. Kara, P., Meric, B., Zeytinoglu, A., and Ozsoz, M. 2004. Anal. Chim. Acta, 518: 69 –76. Kerman, K., Saito, M., Morita, Y., Takamura, Y., Ozsoz, M., and Tamiya, E. 2004. Anal. Chem., 76: 1877– 1884. Kerman, K., Ozkan, D., Kara, P., Meric, B., Gooding, J.J., and Ozsoz, M. 2002. Anal. Chim. Acta, 462: 39 – 47. Ligier, F.S., Breimer, M., Golden, J.P., Nivens, D.A., Dodson, J.P., Green, T.M., Haders, D.P., and Sadik, O.A. 2002. Anal. Chem., 74: 713– 719. Liu, Y., Rauch, C.B., Stevens, R.L., Lenigk, R., Yang, J., Rhine, D.B., and Grodzinski, P. 2002. Anal. Chem., 74: 3063– 3070. Liu, Z., Yang, Q., and Xu, D. 2001. Chin. J. Anal. Chem., 29: 997– 999. Lumley-Woodyear, T.de., Caruana, D.J., Campbell, C.N., and Heller, A. 1999. Anal. Chem., 71: 394– 398. Maruyama, K., Mishima, Y., Minagawa, K., and Motonaka, J. 2002. Anal. Chem., 74: 3698– 3703. Marrazza, G., Chianella, I., and Mascini, M. 1999a. Anal. Chim. Acta, 387: 297– 307. Marrazza, G., Chianella, I., and Mascini, M. 1999b. Biosensors. Bioelectronics, 14: 43 –51. Ozkan, D., Erdem, A., Kara, P., Kerman, K., Meric, B., Hassmann, J., and Ozsoz, M. 2004. Anal. Chem., 74: 5931– 5936. Ozsoz, M., Erdem, A., Kerman, K., Ozkan, D., Tugrul, B., Topcuoglu, N., Ekren, H., and Taylan, M. 2003. Anal. Chem., 75: 2181– 2187. Palecek, E. and Fojta, M. 2001. Anal. Chem., 73: 74A– 83A. Palecek, E., Kizek, R., Havran, L., Billova, S., and Fojta, M. 2002. Anal. Chim. Acta, 469: 73 – 83. Prix, L., Uciechowski, P., Bockmann, B., Giesing, M., and Schuetz, A.J. 200248: 428– 435. Qian, X., Metallo, S.J., Choi, I.S., Wu, H., Liang, M.N., and Whitesides, G.M. 2002. Anal. Chem., 74: 1805– 1810. Seong, G.H., Zhan, W., and Crooks, R.M. 2002. Anal. Chem., 74: 3372– 3377. Trau, D., Lee, T.M.H., Lao, A.I.K., Lenigk, R., Hsing, I.M., Ip, N.Y., Carles, M.C., and Sucher, N.J. 2002. Anal. Chem., 74: 3168– 3173. Wang, J. 2002. Analytica Chimica Acta, 469: 63 – 71. Wang, J., Liu, G., and Rivas, G. 2003. Anal. Chem., 75: 4667– 4671. Wang, J., Xu, D., Erdem, A., Polsky, R., and Salazar, M.A. 2002. Talanta, 56: 931– 938. Wang, J., Xu, D., Kawde, A., and Polsky, R. 2001. Anal. Chem., 73: 5576– 5581. Wang, J., Rivas, G., and Cai, X. 1997a. Electroanalysis, 9: 395– 398.
2578
W. He et al.
Wang, J., Cai, X., Rivas, G., Shiraish, H., and Dntha, N. 1997b. Biosensors. Bioelectronics, 12: 587– 599. Wang, J., Cai, X., Rivas, G., and Shiraishi, H. 1996a. Anal. Chim. Acta, 326: 141– 147. Wang, J., Cai, X., Rivas, G., Shiraishi, H., Farias, P.A.M., and Dontha, N. 1996b. Anal. Chem., 68: 2629– 2634. Weidenhammer, E.M., Kahl, B.F., Wang, L., Wang, L., Duhon, M., Jackson, J.A., Slater, M., and Xu, X. 2002. Clin. Chem., 48: 1873– 1882. Xu, D., Huang, K., Liu, Z., Liu, Y., and Ma, L. 2001. Electroanalysis, 13: 882– 887.
