Do iron chelators increase the antiproliferative effect of trichostatin A through a glucose-regulated protein 78 mediated mechanism? Veli Kilinc, Abdulkerim Bedir, Ali Okuyucu, Osman Salis, Hasan Alacam & Sedat Gulten Tumor Biology Tumor Markers, Tumor Targeting and Translational Cancer Research ISSN 1010-4283 Tumor Biol. DOI 10.1007/s13277-014-1788-1
1 23
Your article is protected by copyright and all rights are held exclusively by International Society of Oncology and BioMarkers (ISOBM). This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy Tumor Biol. DOI 10.1007/s13277-014-1788-1
RESEARCH ARTICLE
Do iron chelators increase the antiproliferative effect of trichostatin A through a glucose-regulated protein 78 mediated mechanism? Veli Kilinc & Abdulkerim Bedir & Ali Okuyucu & Osman Salis & Hasan Alacam & Sedat Gulten
Received: 20 November 2013 / Accepted: 21 February 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Histone deacetylase (HDAC) inhibitors, such as trichostatin A (TSA), and iron chelators, including deferoxamine (DFO) and phenanthroline (PHEN), appear to have anticancer effects. We hypothesized that the HDAC inhibitors and iron chelators would be synergistic with their effect on breast cancer cell line MCF7, because the HDAC inhibitors increase glucose-regulated protein 78 (Grp78) and the iron chelators reduce its expression. Although the administration of TSA alone resulted in a dose-related decrease in the cell index, it did not have an antiproliferative effect except the 62.5 and 500 nM of TSA. However, all doses of TSA produced a cytotoxic effect from the initial hours when combined with 150 μM of DFO and 25 μM of PHEN. DFO and PHEN downregulated Grp78, Grp94, and MRP1 expressions and upregulated CHOP and HO-1 expressions. TSA upregulated all the genes in various rates when used alone but resulted in decreased expression levels when combined with DFO and PHEN. Increased HDAC-1 levels in the Grp78 promoter region indicated that DFO and PHEN either promoted binding of HDAC-1 to this region or inhibited its detachment. We determined that the reduction of increased Grp78, Grp94, HO1, and MRP1 expressions, which appears to inhibit the chemotherapeutic effect of TSA, through the combination with DFO or PHEN will contribute to the anticancer effect.
Keywords MCF-7 . Trichostatin A . Deferoxamine . Phenanthroline . Grp78 . CHOP
V. Kilinc Public Health Laboratory, 55139 Kurupelit, Trabzon, Turkey A. Bedir : A. Okuyucu (*) : O. Salis : H. Alacam : S. Gulten Faculty of Medicine, Department of Medical Biochemistry, Ondokuz Mayis University, Samsun, Turkey e-mail:
[email protected]
Introduction Histone acetylation is one of the epigenetic mechanisms that regulates gene expression; it is regulated by histone acetyltransferase and histone deacetylase (HDAC) enzymes. HDAC inhibitors structurally fall into four groups (hydroksamats, cyclic peptides, aliphatic acids, and benzamides) and lead to histone acetylation [1]. HDAC inhibitors also acetylate many nonhistone proteins, and they also alter target gene expression [2]. Trichostatin A (TSA) is an antifungal agent that is a derivative of hydroksamat and is produced by Streptomyces hygroscopicus. TSA is also a strong and specific HDAC inhibitor [3]. HDAC inhibitors result in the differentiation of cancer cells, growth cessation, and apoptosis. However, in addition to their anticancer effect, HDAC inhibitors can increase the resistance of cancer cells to the treatment by induction of glucose-regulated protein 78 (Grp78) [4]. Unfolded protein response (UPR) activates the signal path when the cells encounter ER stress, such as the accumulation of misfolded proteins [5]. This path attempts to reduce ER stress by ceasing the general translation, breaking down the misfolded proteins, and increasing some chaperones and enzymes used in protein folding. If these measures are not adequate, apoptotic cell death is activated. The most critical target of UPR is induction of Grp78 since these measures are Grp78-mediated [6, 7]. Grp78 has been shown to produce resistance to a variety of anticancer drugs in some studies using overexpression or knockdown [8–12]. Iron (Fe) is an essential component of many proteins and enzymes that play a role in cell growth and reproduction [13]. Intracellular suppression of iron activates hypoxia-inducible factor-1α and various pathways and leads to cessation of the cell cycle, apoptosis, and suppression of metastasis [14]. Deferoxamine (DFO) is a chelator produced by Streptomyces pilosus, and it acts by strongly binding free Fe3+ to remove it
Author's personal copy Tumor Biol.
from the body via the urine [15]. DFO enhances DNA damage-inducible 45 messenger RNA (mRNA) expression and growth arrest, which is increased by stress and DNA damage and results in cessation of the cell cycle and/or apoptosis [16]. 1,10-Phenanthroline (PHEN), another iron chelator, is a heterocyclic organic compound. It forms a strong complex with most metal ions [17]. In this study, we hypothesized that the HDAC inhibitors (TSA) and iron chelators (DFO and PHEN) would be synergistic with their effect on breast cancer cell line MCF7, because the HDAC inhibitors increase Grp78 and the iron chelators reduce its expression. For this purpose, we designed a three-stage study. First, we determined the antiproliferative effect of TSA, DFO, and PHEN with a real-time cell analysis (RTCA) system. Second, we determined the Grp78, glucose-regulated protein 94 (Grp94), CCAAT/enhancer-binding protein homologous protein (CHOP), hemeoxygenase-1 (HO-1), and multidrug resistance-associated protein-1 (MRP-1) expression levels associated with UPR, apoptosis, and drug resistance with realtime polymerase chain reaction (RT-PCR). Finally, we investigated the effect of DFO and PHEN on the HDAC-1 bond to the Grp78 promoter region using chromatin immunoprecipitation (ChIP) assay.
Table 1 RTCA study groups Study group I
Study group II
Control 150 μM DFO (DFO) 7.81 nM TSA 15.63 nM TSA 31.25 nM TSA 62.5 nM TSA 500 nM TSA DFO+7.81 nM TSA DFO+15.63 nM TSA DFO+31.25 nM TSA DFO+62.5 nM TSA DFO+500 nM TSA
Control 25 μM PHEN (PHEN) 7.81 nM TSA 15.63 nM TSA 31.25 nM TSA 62.5 nM TSA 500 nM TSA PHEN+7.81 nM TSA PHEN+15.63 nM TSA PHEN+31.25 nM TSA PHEN+62.5 nM TSA PHEN+500 nM TSA
DFO deferoxamine, PHEN phenanthroline, TSA trichostatin A
doses of materials were added to the E-plates when the cells were in the logarithmic growth phase after 24 h. The cells were observed for 72 h. The study was conducted in triplicate, and the CI values were averaged. The effect of chemicals against time was evaluated to determine whether there was an increase or a decrease in CI in the CI graph. This evaluation was based on 150 μM of DFO in group I and on 25 μM of PHEN in group II.
Materials and methods RT-PCR Cell line and chemicals Human breast cancer cell line (MCF-7) was provided by the Alum Institute of the Ministry of Food and Livestock in the Republic of Turkey. The cells were reproduced in RPMI 1640 (Biological Industries, Israel) with the addition of 10 % fetal bovine serum (Sigma-Aldrich, USA), 100 U penicillin/0.1 mg streptomycin (Biological Industries, Israel), and 1 mM Napyruvate (Biological Industries, Israel) at 37 °C and 5 % of carbon dioxide (CO2). The cells in the flask were used for gene expression and proliferation assay when they became confluent by 70–80 %. Cell proliferation assay The kinetics of cell growth were evaluated by RTCA (xCELLigence RTCA-DP, Roche, Germany). RTCA is used for monitoring cell number, viability, and morphology. A biosensor measures the electrical impedance of the cell population. The impedance is displayed as cell index (CI) values. In the study, two study groups were established (Table 1). The materials were prepared in RPMI 1640 medium for all study groups, and only the cells grown in the RPMI 1640 medium were used as the control group. For RTCA assay, 16.000 cells/well were cultured onto E-plates. Predetermined
MCF-7 cells were cultured onto 96-well plates at 16.000 cells/ well. Following a 24-h plating phase, 10 mM of 2-deoxy-Dglucose (2-DG), 150 μM of DFO, 25 μM of PHEN, 500 nM of TSA, the combination of 150 μM of DFO and 500 nM of TSA, and the combination of 25 μM of PHEN and 500 nM of TSA were applied to the cells. The cells were taken out of the plate after 24 h, and they underwent total RNA isolation using a High Pure PCR RNA Isolation Kit (Roche Diagnostics GmbH, Germany). Complementary DNAs (cDNAs) were derived from the total RNAs using a Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Germany). The primers and probes of the studied genes were designed using the Universal Probe Library (UPL) program (Table 2). The gene expressions of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Grp78, Grp94, CHOP, HO-1, and MRP-1 were determined by quantitative RT-PCR (LightCycler 480 II, Roche Diagnostics GmbH, Germany). All trials were repeated eight times. The GAPDH gene was used as the reference gene, and the control group was used as the calibrator. ChIP assay MCF-7 cells were cultured into 25-cm2 flasks; 150 μM of DFO and 25 μM of PHEN were administered to the cells with
Author's personal copy Tumor Biol. Table 2 Primer and probe sequences used in the study
Gene
Forward primer
Reverse primer
Probe
Grp78 Grp94 CHOP HO-1 MRP-1
agcctggcgacaagagtg ctggaaatgaggaactaacagtca cagagctggaacctgaggag gggtgatagaagaggccaaga cttcgtgtctttggccttgt
tccttgggcagtattggatt tcttctctggtcattcctacacc tggatcagtctggaaaagca agctcctgcaactcctcaaa aggcgtttgagggagacac
ctccacct (probe 39) acctgctg (probe 62) catcacca (probe 9) catccagc (probe 42) catcctcc (probe 88)
GAPDH Grp78 promoter
agccacatcgctcagacac gtgaacgttagaaacgaatagcagcca
gcccaatacgaccaaatcc gtcgacctcaccgtcgccta
tggggaag (probe 60) tggtggcc (probe 49)
60–70 % confluent, and RPMI 1640 medium was applied to the control group. The ChIP assay was performed with antiHDAC1 goat IgG polyclonal antibody (sc-6299, Santa Cruz Biotechnology, Inc., USA), Chromatin Preparation Module (Thermo Scientific, USA), and a Pierce Agarose ChIP Kit (Thermo Scientific, USA) after 24 h. Quantitative PCR (Table 2) was studied with the DNA purified from input and immune precipitation using primers designed for the Grp78 promoter region using the LightCycler Probe Design Software 2.0 program (Roche Diagnostics GmbH, Germany) and the LNA probe 49 designed with the UPL program (Roche Diagnostics GmbH, Germany). PCR signals obtained after immunoprecipitation were divided by the signals from the input samples. The results are presented as percentages of input samples. Statistical analysis The level of gene expressions was analyzed by the relative expression software tool (REST, 2009, V2.0.13) program in “n” of the control group. A p value
