Domain-Containing Tyrosine Phosphatase-1 Proliferation and ...

Negative Regulation of Myeloid Cell Proliferation and Function by the SH2 Domain-Containing Tyrosine Phosphatase-11 Qin Dong,* Katherine A. Siminovitch,†‡ Lea Fialkow,* Takeyasu Fukushima,* and Gregory P. Downey2* The SH2 domain containing tyrosine phosphatase SHP-1 has been implicated in the regulation of a multiplicity of signaling pathways involved in hemopoietic cell growth, differentiation, and activation. A pivotal contribution of SHP-1 in the modulation of myeloid cell signaling cascades has been revealed by the demonstration that SHP-1 gene mutation is responsible for the overexpansion and inappropriate activation of myelomonocytic populations in motheaten mice. To investigate the role of SHP-1 in regulation of myeloid leukocytes, an HA epitope-tagged dominant negative (interfering) SHP-1 (SHP-1C453S) was expressed in the myelo-monocytic cell line U937 using the pcDNA3 vector. Overexpression of this protein in SHP-1C453S transfectants was demonstrated by Western blot analysis and by detection of decreased specific activity. Growth, proliferation, and IL-3-induced proliferative responses were substantially increased in the SHP-1C453S-overexpressing cells relative to those in control cells. The results of cell cycle analysis also revealed that the proportion of cells overexpressing SHP-1C453S in S phase was greater than that of control cells. The SHP-1C453S-expressing cells also displayed diminished rates of apoptosis as detected by flow cytometric analysis of propidium iodide-stained cells and terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling assay. While motility and phagocytosis were not affected by SHP-1C453S overexpression, adhesion and the oxidative burst in response to PMA were enhanced in the SHP-1C453S compared with those in the vector alone transfectants. Taken together, these results suggest that SHP-1 exerts an important negative regulatory influence on cell proliferation and activation while promoting spontaneous cell death in myeloid cells. The Journal of Immunology, 1999, 162: 3220 –3230.

L

eukocytes of myeloid lineage, including neutrophils, monocytes, and macrophages, contribute to host defense primarily through destruction of pathogenic microorganisms. This functional role is achieved through a series of rapid and coordinated responses that include chemotaxis, phagocytosis, secretion of a variety of granules/vesicles, and production of reactive oxygen intermediates (1, 2). These responses are initiated by the interaction of cell surface receptors with specific ligands found on microbial targets or in the inflammatory milieu and the consequent induction of intracellular signaling pathways that couple such activating stimuli to physiological responses (1–3). Paradoxically, these same cellular and biochemical events may also damage host tissues, as is evident in arthritis, ischemia-reperfusion, sepsis, acute lung injury, and other conditions associated with unregulated activation of the inflammatory response (4 –7). Thus, to maintain homeostasis and minimize tissue damage, leukocyte microbicidal Departments of *Medicine and †Immunology and Molecular and Medical Genetics, Division of Respirology, University of Toronto, and ‡The Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Ontario, Canada Received for publication July 30, 1998. Accepted for publication December 11, 1998. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by operating grants from the Medical Research Council of Canada (to G.P.D. and K.A.S.) and by the Ontario Thoracic Society (to G.P.D.). G.P.D. is the recipient of a Career Scientist Award from the Ontario Ministry of Health, K.A.S. is a Research Scientist of the Arthritis Society of Canada, and L.F. is the recipient of a Scientist Award from the National Council of Scientific and Technological Development, Brazil. 2 Address correspondence and reprint requests to Dr. Gregory P. Downey, Clinical Sciences Division, Room 6264 Medical Sciences Building, University of Toronto, 1 Kings College Circle, Toronto, Ontario, Canada M5S 1A8. E-mail address: [email protected]

Copyright © 1999 by The American Association of Immunologists

responses must be tightly regulated by processes including selective triggering and rapid termination of activation cascades once the initial stimulus has been removed. One of the earliest biochemical events evoked by myeloid cell receptor engagement is the phosphorylation of cellular proteins on serine, threonine, and tyrosine residues (8 –10). Increases in tyrosine phosphorylation can be elicited by a variety of soluble and particulate stimuli and correlate temporally with the appearance of cellular responses (11–13). The importance of tyrosine phosphorylation to leukocyte function is underscored by the observation that inhibitors of protein tyrosine kinases block many microbicidal responses, including adherence (14), chemotaxis (15), phagocytosis (16), and production of reactive oxygen intermediates (13, 17, 18). Phosphorylation of tyrosine residues is regulated by the competing activities of protein tyrosine kinases and protein tyrosine phosphatases (PTP).3 In neutrophils, activation of tyrosine kinases occurs following treatment with chemotactic peptides (19), cytokines (20, 21), and multiple other ligands (22) and is pivotal to the increased tyrosine phosphorylation observed following stimulation with these agents. Alternatively, decreases in the activity of tyrosine phosphatases may also contribute to an increase in cellular tyrosine phosphorylation following stimulation. Thus, for example, stimulation with the chemoattractant FMLP or with phorbol esters is associated with decreases in global neutrophil phosphotyrosine phosphatase activity, although the identity of the particular phosphatases responsible for this effect has not been determined (23, 24). Similarly, inhibition of tyrosine phosphatases with 3 Abbreviations used in this paper: PTP, protein tyrosine phosphatase; SHP-1, SH2containing phosphatase-1; HA, hemagglutinin; TUNEL, terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling.

0022-1767/99/$02.00

The Journal of Immunology

3221

vanadate or its peroxides has been shown to potentiate FMLPinduced superoxide production in intact cells (25) and to activate a respiratory burst in electroporated cells (26, 27), providing additional evidence that a reduction of phosphatase activity may lead to microbicidal responses in neutrophils. While the importance of PTPs in regulating neutrophil function is widely acknowledged, little is known about the role of specific tyrosine phosphatases in modulating the outcome of myeloid leukocyte signal transduction pathways. Of particular interest in this regard is the SHP-1 cytosolic PTP, an SH2 domain-containing phosphatase expressed in leukocytes of myelo-monocytic lineages including HL-60 cells (28), THP-1 cells (29), and human peripheral blood neutrophils (30). SHP-1 has now been implicated in the negative regulation of a broad spectrum of growth-promoting receptors, including receptor tyrosine kinases such as c-Kit (31, 32), CSF-1 receptor (33), TrkA (34), and epidermal growth factor (35) receptors; cytokine receptors such as IL-3 (31), IFN-a/b (36), and erythropoietin (37, 38) receptors; and receptors of the immune system containing the immune receptor tyrosine-based inhibitory motif such as CD22 (39) and FcgRIIB (39, 40). SHP-1 inhibitory effects on receptor tyrosine kinases are mediated by direct dephosphorylation of the activated receptors (31, 33, 35, 41), while its suppression of cytokine receptor signaling is mediated by binding of the phosphatase to noncatalytic subunits of the receptors and dephosphorylation of the associated Janus family tyrosine kinase (36, 37). In some instances, the negative modulatory effects of SHP-1 on receptor signaling have been linked to its capacity to interact with multiple receptor and cytosolic signaling effectors. For example SHP-1 down-regulates Ag receptor signaling in T cells by interactions and/or dephosphorylation of TCR components, the Lck (42, 43) and ZAP-70 (44) protein tyrosine kinases, and the guanine exchange factor, Vav (45). Similarly, in B cells, SHP-1 binds and probably dephosphorylates the B cell Ag receptor (45), FcgRIIB (46), Vav (47), and CD22 (39, 48). While SHP-1 roles in myeloid cell biology are not yet well defined, the pivotal role for SHP-1 in regulatory development and function of this lineage is highlighted by the enormous myelo-monocytic expansion found in motheaten (me/me) and motheaten viable (mev/mev) mice, in which expression of the PTP activity is essentially abrogated (49 –51). Accordingly, as a step toward delineating the role of tyrosine phosphatases in initiation and/or modulation of myeloid leukocyte responses, we explored the roles of SHP-1 in myeloid cell signaling by assessing the impact of overexpressing an enzymatically inactive mutant of SHP-1 (SHP-1C453S) on specific functions of the myelo-monocytic cell line U937. In this report we demonstrate that interference with the action of SHP-1 results in enhanced proliferation and diminished apoptosis as well as enhanced adhesion and oxidant production, suggesting that the function of SHP-1 is predominantly signal terminating or down regulating in myeloid cells.

(Hilden, Germany). Lipofectamine and G418 were obtained from Life Technologies (Burlington, Canada).

Materials and Methods

SHP-1 immunoprecipitation and phosphatase assay

Reagents HEPES, FMLP, PMA, cytochalasin B, zymozan, scopoletin, horseradish peroxidase, and propidium iodide were obtained from Sigma (St. Louis, MO). Calcein-AM was obtained from Molecular Probes (Eugene, OR). H2O2 was purchased from Caledon Laboratories (Toronto, Canada). Recombinant human IL-3 was obtained from R&D Systems (Minneapolis, MN). [3H]Thymidine was obtained from Amersham (Aylesbury, U.K.). Protein A/G Plus agarose was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Zymosan A BioParticles (Texas Red conjugate) was obtained from Molecular Probes. The in situ cell death detection kit was purchased from Boehringer Mannheim (Mannheim, Germany). Plasmid Mini/Midi/Maxi Prep and PCR purification kits were obtained from Qiagen

Antibodies A glutathione S-transferase (GST) fusion protein of wild-type murine SHP-1 encompassing its two SH2 domains (amino acids 1–296) was generated as previously described (50). The recombinant protein was used to generate polyclonal Abs to SHP-1, which were affinity purified and have been shown to be suitable for immunoblotting and immunoprecipitation (37, 40). An mAb to SHP-1 was obtained from Transduction Laboratories (Lexington. KY). Monoclonal anti-hemagglutinin (anti-HA) was purchased from BABCO (Richmond, CA). Anti-phosphotyrosine Ab 4G10 and the malachite green tyrosine phosphatase kit were purchased from Upstate Biotechnology (Lake Placid, NY). Anti-phospho Erk Abs were obtained from New England Biolabs (Beverly, MA). Abs to the b-chain of IL-3R (clone 3D7) were obtained from Dr. Angel Lopez, Cytokine Receptor Laboratory, The Hanson Center for Cancer Research, Institute of Medical and Veterinary Science (Adelaide, Australia).

Cell culture U937 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in RPMI 1640 medium supplemented with 10% heat-inactivated FBS (Life Technologies).

Construction of mutant SHP-1 A catalytically inactive mutant form of SHP-1 (SHP-1C453S), previously shown to act in a dominant negative fashion (52), was HA tagged using PCR with synthetic oligonucleotides encoding the desired amino acid residues (59 primer, 59-ATCAAGCTTATGTACCCATACGATGTTCCTGA CTATGCGGTGAGGTCGTTTC ACCGG-39; 39 primer, 39-CCCTCCA GATATGTGGCCG-59). The regions of SHP-1C453S that had been subjected to mutagenesis or HA tagging were sequenced in their entirety using the dideoxynucleotide chain termination method (Sequenase, Pharmacia, Baie d’Urfe, Canada). The HindIII/XbaI of fragment the HA-tagged SHP-1C453S was subcloned into the pcDNA3 eukaryotic expression vector for transfection as described below.

Transfection The pcDNA3 (empty vector) or pcDNA3 containing HA-tagged SHP1C453S was transfected into monocytic cell line U937 cells using cationic liposomes (Lipofectamine). Two micrograms of plasmid DNA per 5 3 106 cells was used for transfection. Clones were selected in RPMI 1640 medium supplemented with 1 mg/ml G418 using limiting dilution in 96-well plates and were expanded in tissue culture flasks. The expression of the recombinant mRNAs of HA-tagged SHP-1C453S was initially confirmed using RT-PCR with primers bracketing the HA tag sequence and the 59 portion of SHP-1 (see below). Overexpression of HA-tagged SHP-1C453S protein was identified using Western blotting with an anti-HA mAb.

RT-PCR Total RNA was isolated from the transfected U937 cells using the guanidinium isothiocyanate-cesium chloride protocol (53, 54). 59 primers (59ATCAAGCTTATGTACCCATACGATGTTCCTGACTATGCGGTGAG GTCGTTTCACCGG-39) and 39 primers (39-CCCTCCAGATATGTGG CCG-59) were used to amplify a 400-bp fragment of mRNA of SHP-1 encoding the HA tag using the Gene Amp RNA PCR kit (Perkin-Elmer/ Cetus, Branchburg, NJ). The PCR products were analyzed by electrophoresis using 1% agarose gels and were visualized by ethidium bromide staining. Amplification of a nucleotide sequence encoding IL-1a (PAW109 RNA, Perkin-Elmer/Cetus) included with the kit, was used as a positive control.

Transfected cells were resuspended in 1 ml of ice-cold lysis buffer, (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 mg/ml aprotinin, and 10 mg/ml leupeptin). Lysates were centrifuged at 15,000 3 g for 15 min, and supernatants were mixed with 10 ml of polyclonal antiSHP-1 or anti-HA mAb at 4°C for 2 h and then incubated with 50 ml of protein G/A Plus agarose rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with monoclonal anti-HA or anti-SHP-1 Abs. Tyrosine phosphatase activity was measured in antiSHP-1 (polyclonal) immunoprecipitates using the malachite green phosphatase assay with phosphopeptide (RRLIEDAEpYAARG, Upstate Biotechnologies). The activity was normalized to the amount of immunoreactive SHP-1 protein as determined by Western blotting of the

3222

SHP-1 REGULATION OF MYELOID CELL FUNCTION

immunoprecipitates with anti-SHP-1 mAbs followed by densitometric analysis as described below. The intensity of the SHP-1 band in each sample was determined using IP Lab Gel-D10. The latter was calibrated by running varying amounts of recombinant GST-SHP-1 fusion protein on the same blot to ensure that samples were in the linear range of the x-ray film. The specific SHP-1 activities were calculated by dividing the phosphatase activity (OD from malachite green assay) by the intensity of the SHP-1 band from Western blots.

CD45 immunoprecipitation and phosphatase assay Cells were resuspended in 1 ml of ice-cold lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 mg/ml aprotinin, and 10 mg/ml leupeptin). Lysates were centrifuged at 15,000 3 g for 15 min, and supernatants were mixed with 10 ml of anti-CD45 mAb (clone GAP 8.3, American Type Tissue Collection) at 4°C for 2 h and then incubated with 50 ml of protein G/A Plus agarose, with rotating overnight at 4°C. The washed beads were analyzed by SDS-PAGE and Western blotting with anti-CD45 mAbs. Tyrosine phosphatase activity was measured in antiCD45 immunoprecipitates using para-nitrophenylphosphate as the substrate as previously described (55).

Stimulation of cell and assay for tyrosine phosphorylation The transfected cells were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h, followed by stimulation of 1 3 106 cells with IL-3 (50 ng/ml) at 37°C for 1–10 min. The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 mg/ml aprotinin, 10 mg/ml leupeptin, and 1 mM sodium vanadate). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using a bicinchoninic acid protein kit (Pierce, Rockford, IL), and equal amounts of protein were subjected to SDS-PAGE and Western blotting with anti-phosphotyrosine (4G-10) mAb.

Immunoprecipitation of the IL-3R b subunit and analysis of tyrosine phosphorylation U937 cells transfected with either empty vector or with HA-SHP-1C453S were washed and incubated in RPMI 1640 medium without serum (serum starvation) for 24 h. Subsequently 2 3 107 cells were stimulated with IL-3 (100 ng/ml) at 37°C for 10 min. The cells were pelleted by centrifugation and resuspended in lysis buffer (50 mM Tris-HCl (pH 7.5), 10% (v/v) glycerol, 1% (v/v) Nonidet P-40, 150 mM NaCl, 5 mM EDTA, 1 mM sodium vanadate, 10 mM sodium fluoride, 1 mM sodium molybdate, 40 mg/ml PMSF, 10 mg/ml aprotinin, 10 mg/ml soybean trypsin inhibitor, 10 mg/ml leupeptin, and 0.7 mg/ml pepstatin) followed by centrifugation at 10,000 3 g for 15 min in a microfuge. The amount of protein in supernatant was measured using a BCA protein kit (Pierce), and supernatants containing equal amounts of protein were mixed with 10 mg of an mAb (3D7) against human IL-3 b subunit (bc) and incubated with rotation for 2 h at 4°C. Fifty microliters of a slurry of protein G/A Plus agarose was then added to each sample and incubated with rotation overnight at 4°C. The beads were washed four times in lysis buffer, boiled in Laemmli sample buffer, and analyzed by SDS-PAGE and Western blotting with antiphosphotyrosine mAb (4G-10, Upstate Biotechnology).

SDS-PAGE and Western blotting analysis The cell pellets were resuspended in lysis buffer (PBS (pH 7.4), 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 mg/ml aprotinin, and 10 mg/ml leupeptin). Lysates were centrifuged at 15,000 rpm for 15 min. The amount of protein in the supernatant was measured using bicinchoninic acid protein kit (Pierce). Equal amounts of protein were loaded onto each lane sample and separated by SDS-PAGE using either 4 –20% gradient or 8 or 10% linear polyacrylamide gels and subsequently transferred to nitrocellulose membrane (Protran, Schleicher & Schuell, Toronto, Canada). Immunoblots were blocked in PBS (pH 7.4) containing 2% skim milk, 0.5% Tween-20, or 0.1% Tris buffer (pH 9.0) containing 0.25% gelatin and 10% ethanol amine (for tyrosine phosphorylation only) and incubated with mAbs (anti-HA, anti-SHP-1, or anti-phosphotyrosine as indicated) for 2 h at room temperature. The washed membranes were incubated with horseradish peroxidase-conjugated anti-mouse Ig and developed using enhanced chemiluminescence according to the manufacturer’s instructions (Amersham).

or IL-3 (50 ng/ml). [3H]thymidine (1 mCi/ml) was added at the specified times over a 24-h period followed by incubation for an additional 8 h before analysis. Experiments were performed in triplicate. Cell numbers were counted in triplicate at 24-h intervals for a period of 72 h using a hemocytometer.

Cell cycle analysis Cells (2 3 105) from each clone were serum starved for 24 h followed by addition of 20% FBS for an additional 3 h. The cells were fixed in 75% ethanol for 30 min and stained in propidium iodide buffer containing PBS, 1.2% Nonidet P-40, 50 mg/ml propidium iodide, and 1 mg/ml RNase for 30 min. Cell cycle analysis (G0/G1, S, G2/M) was conduced according to published methods (56) using flow cytometry.

Analysis of apoptosis For flow cytometric analysis, cells serum starved for 24 h were resuspended in 1.5 ml of hypotonic fluorochrome solution (50 mg/ml propidium iodide, 0.1% sodium citrate, and 0.1% Triton X-100) for 30 min and analyzed by flow cytometry to detect apoptotic cells. For in situ detection of apoptosis, cells were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 30 min and permeabilized by incubation in permeabilization solution (0.1% sodium citrate and 0.1% Triton X-100) for 2 min on ice. Cells were then incubated with the terminal deoxynucleotidyltransferase-mediated fluorescein-dUTP nick end-labeling (TUNEL) reaction mixture (Boehringer Mannheim) at 37°C for 60 min, viewed by fluorescence microscopy using a Leitz OrthoPlan microscope (Leitz, Rockleigh, NJ) and photographed using Elite 100 (Eastman Kodak, Rochester, NY) film.

Measurement of oxidative burst Cells (1 3 106) were placed in sterile polypropylene microfuge tubes that had been previously coated with FBS and incubated in 2 ml sodium buffer (140 mM NaCl, 4 mM KCl, 10 mM glucose, 10 mM HEPES, 1 mM MgCl2, and 1 mM CaCl2, pH 7.4, at 37°C) containing 1027 PMA or 0.1% DMSO (vehicle control), 10.4 mM scopoletin, 9.6 U/ml horseradish peroxidase, and 4 mM sodium azide at 37°C for 2 h (57). A reduction in fluorescence of scopoletin was quantified by a Hitachi F-2000 fluorescence spectrophotometer (Hitachi, Hialeah, FL), using an excitation wavelength of 365 nm and an emission wavelength of 473 nm. Standard curves were generated using known amounts of H2O2.

Phagocytosis The phagocytic ability of U937 cells was assayed by incubating opsonized zymosan with cells in the presence of the permeant fluid phase marker Lucifer Yellow as previously described (58). Cells (3 3 105) were allowed to settle on glass coverslips for 30 min at room temperature. To synchronize phagocytosis, the serum-opsonized zymosan (6 3 105 particles) was added to cells and allowed to bind for 10 min at 4°C. The temperature was then rapidly raised to 37°C, and incubation proceeded for 10 min in the presence of 2 mg/ml Lucifer Yellow. The coverslips were cooled in an ice-water bath, and the number of phagosomes was counted using a fluorescence microscope (Nikon, Melville, NY).

Chemotaxis Chemotaxis was measured using a micro-Boyden chamber (Neuroprobe, Cabin John, MD). The chamber consists of two wells separated from each other by filter paper. The chemoattractant (1024–1027 M FMLP in HEPES-buffered RPMI with 1% BSA at pH 7.4) was placed in the bottom well, a 0.45-mm pore size trap filter placed above, followed by a 3-mm chemotaxis filter. The top chamber was secured in place, and the cells were added in HEPES-buffered RPMI with 1% BSA (3 3 105 cells/well). The chamber was incubated at 37°C for 2 h; the trap filter was removed, fixed, and stained with hematoxylin; and the number of cells present was counted.

Flow cytometric analysis of CD18 expression Cells (1 3 106) were fixed with 1.6% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20% goat serum for 30 min to block nonspecific binding. Cells were washed and then incubated with 10 mg/ml anti-CD18 Ab (IB4) for 1 h at 4°C, washed, and incubated with FITC-labeled goat anti-mouse IgG Ab. Cells were washed, resuspended in PBS, and analyzed by flow cytometry (FACStar, Becton Dickinson, Mountain View, CA). The geometric mean of the FL-1 channel was recorded.

Growth kinetics and DNA synthesis

Flow cytometric analysis of Fcg receptor expression

Cells (1 3 10 /ml) from each clone were seeded in 12-well tissue culture plates and serum starved for 24 h followed by addition of either 20% FBS

Cells (1 3 106) were fixed with 1.6% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20% goat serum for 30 min

5


3223

FIGURE 1. Identification of HA-SHP-1C453S mRNA in U937 cells. Total RNA was obtained from transfected U937 cells, reverse transcribed into cDNA, and amplified using RT-PCR using primers designed to amplify a 400-bp fragment of HA-SHP-1C453S or a 300-bp fragment of IL-1a (positive control). Samples of the final reaction mixture were analyzed by electrophoresis through 1% agarose gels with ethidium bromide staining. Lane 1, Negative control (no RNA). Lane 2, No reverse transcriptase. Lane 3, PAW109 RNA (positive control). Lanes 4 – 8, U937 cells transfected with pcDNA3 vector containing HA-SHP-1C453S. Lane 9, U937 cells transfected with pcDNA3 vector alone.

to block nonspecific binding. Cells were washed twice; then incubated with mouse anti-human FcgRI (32.2 (Fab9)2, Medarex, Lebanon, NH), mouse anti-human FcgRII (IV.3, Medarex) or mouse anti-human FcgRIII (3G8, F(ab9)2, Medarex) for 2 h at 4°C, washed, and incubated with secondary FITC-labeled goat anti-mouse Ab. Cells were washed twice, resuspended in PBS, and analyzed by flow cytometry (FACStar, Becton Dickinson) as described above. The geometric mean of the FL-1 channel was recorded.

Adhesion assay U937 cells (2 3 107) were labeled with 1.5 mM calcein-AM for 20 min at 37°C with gentle agitation followed by washing and resuspension in sodium buffer. Subsequently cells were pretreated with or without blocking anti-CD18 Abs (IB4; 44 mg/ml) for 1 h at 4°C, then added to 24-well tissue culture plates (5 3 105 cells/well) precoated with FBS and incubated for an additional 2 h at 37°C in 5% CO2 in a humidified incubator. Each assay was performed in quadruplicate. After incubation, cells were fixed with paraformaldehyde (1.6%) for 40 min at room temperature and then wells were washed twice with PBS using a gravity washing device. Calcein was extracted by adding methanol to the remaining adherent cells followed by vigorous pipetting. Fluorescence was detected using a Hitachi F-2000 fluorescence spectrophotometer with an excitation wavelength of 490 nm and an emission wavelength of 520 nm. All values were normalized to the number of cells added determined by measuring the mean fluorescence of three separate aliquots of 5 3 105 calcein-AM-labeled cells by methanol extraction.

Results Stable overexpression of HA-SHP-1C453S in U937 cells The tyrosine phosphatase SHP-1 has been implicated in the regulation of signaling pathways involved in growth, differentiation, and activation of cells of hemopoietic lineage. To investigate the functional importance of SHP-1 in myeloid leukocytes, we derived stable clones of a myelo-monocytic cell line U937 expressing recombinant SHP-1, enzymatically inactivated by substitution of the highly conserved cysteine residue in the catalytic domain for serine (SHP-1C453S). To distinguish recombinant from endogenous SHP-1, the protein was tagged with an HA epitope at the NH2 terminus. The construct was ligated into the pcDNA3 vector and transfected into U937 cells, and a total of 21 G418-resistant clones were isolated and expanded. Clones expressing HA-SHP-1C453S were identified by RT-PCR using primers bracketing a 400-bp fragment encompassing the HA tag and NH2 terminus of SHP-1. As illustrated in Fig. 1, this analysis revealed a PCR product of the

FIGURE 2. Identification of HA-SHP-1C453S protein in U937 cells. a and b, Equal amounts of protein from whole cell lysates of U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S10) or empty vector (vector) were separated by SDS-PAGE gels and subjected to immunoblotting with anti-HA Abs (a) or affinity-purified antiSHP-1 Abs (b). c and d, U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10) or empty vector (vector) were resuspended in lysis buffer (PBS (pH 7.4) containing 1% Nonidet P-40, 1 mM PMSF, 0.5 mM benzamidine, 10 mg/ml aprotinin, and 10 mg/ml leupeptin) and subjected to immunoprecipitation with anti-SHP-1 (c) or antiHA (d) Abs. The immunoprecipitates were analyzed by SDS-PAGE gels and subjected to immunoblotting with anti-HA Abs (c) or affinity purified anti-SHP-1 Abs (d).

predicted size to be present in clones transfected with pcDNA3 containing the HA- SHP-1C453S insert but absent in clones transfected with vector alone. However, as estimated by the amount of amplification product detectable, the levels of HA-SHP-1C453S mRNA expression were variable among the transfectants. The presence and quantity of recombinant HA-SHP-1C453S in the various G418-resistant clones were next evaluated by Western blotting with anti-HA Ab. This analysis revealed HA-SHP-1C453S expression in 16 of 21 clones, but, as for mRNA, expression of recombinant protein varied among clones (data not shown). The three clones showing highest levels of HA-SHP-1C453S protein,

3224


designated C453S-2, C453S-9, and C453S-10 respectively, were selected for further study (Fig. 2a). As shown in Fig. 2b, expression of HA-SHP-1C453S led to an increase in the total amount of immunoreactive SHP-1 as determined by immunoblotting whole cell lysates using polyclonal anti-SHP-1 Abs that recognize both endogenous and recombinant (HA-SHP-1C453S) protein. To ensure that incorporation of an HA tag on the amino terminus of SHP-1 did not alter its immunoreactivity, the protein was purified by immunoprecipitation with an anti-HA Ab, and its reactivity with antiSHP-1 Ab was assessed by Western blotting. As illustrated in Fig. 2c, the results of this analysis confirmed that the recombinant protein was recognized by anti-SHP-1 Abs and also that immunoprecipitation using anti-HA Ab did not nonspecifically purify endogenous SHP-1. To estimate the proportion of total (i.e., endogenous plus recombinant) SHP-1 protein represented by the catalytically inactive HA-SHP-1C453S, the amount of total immunoreactive SHP-1, as determined by densitometric analysis of anti-SHP-1 immunoblots was compared in cells transfected with the HA-SHP-1C453S construct vs vector alone. As shown in Fig. 2b, this analysis revealed levels of SHP-1 expression to be between 1.5- and 2-fold higher in the HA-SHP-1C453S-transfected compared with vector alone-transfected cells. The HA-SHP-1C453S-overexpressing and control clones were also compared with respect to levels of SHP-1 phosphatase activity. To this end, aliquots of anti-SHP-1 immunoprecipitated proteins were first quantified by immunoblotting analysis with anti-SHP-1 mAb (Fig. 3a), and the capacity of the immunoprecipitated proteins to dephosphorylate a phosphopeptide substrate in vitro was evaluated. As shown in Fig. 3b, the activity of SHP-1 was diminished by approximately 50% in each of the three HA-SHP-1C453S-overexpressing clones studied compared with activity detected in vector alone and untransfected clones (wildtype). In addition, estimations of the sp. act. of SHP-1 (obtained by correcting the enzymatic activity for the amount of immunoreactive SHP-1 protein) revealed overexpression of HA-SHP-1C453S to be associated with an almost 50% decrease in SHP-1 sp. act. compared with that detected in clones transfected with vector alone (Fig. 3c). Expression of HA-SHP-1C453S enhances cell proliferation and DNA synthesis As SHP-1 has been shown to play key roles in the regulation of signaling pathways involved in cell growth, the impact of expressing catalytically inactive SHP-1 on the growth of U937 cells was assessed by comparing the growth kinetics of two clones overexpressing HA-SHP-1C453S and those of two clones transfected with vector alone. As illustrated in Fig. 4, a and b, following 24-h serum starvation followed by reintroduction of serum, both proliferation and thymidine incorporation were substantially increased in clones expressing HA-SHP-1C453S compared with those in control cells. Cell cycle analysis by flow cytometry using propidium iodide staining demonstrated that a higher proportion of cells in clones overexpressing HASHP-1C453S were in S phase after serum stimulation compared with control cells (Fig. 4, d–f). As serum contains a plethora of factors that potentially promote cell proliferation, it was of interest to study the effects of a single stimulating agent to ascertain whether reduction of SHP-1 activity would still be associated with enhanced proliferation. As SHP-1 has been shown to bind to the b-chain of IL-3R (59) and to suppress IL-3dependent cell growth in other cell types (31), the effects of HA-SHP-1C453S overexpression on IL-3-induced proliferation were also investigated. For these experiments, cells were serum

FIGURE 3. Interference with SHP-1 function in U937 cells transfected with HA-SHP-1C453S. Total immunoreactive SHP-1 was purified from U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10), empty vector (vector), or untransfected controls by immunoprecipitation with polyclonal anti-SHP-1 Abs as described in Materials and Methods. a, The immunoprecipitates were analyzed by SDS-PAGE gels and immunoblotting with anti-SHP-1 mAbs. Note that equal amounts of immunoreactive SHP-1 (endogenous wild-type and HA-SHP-1C453S recombinant) in each of the immunoprecipitates. b, In vitro phosphatase assay using anti-SHP-1 immunoprecipitates from each of the clones as indicated using a phosphopeptide (RRLIEDAEpYAARG) as the substrate and the malachite green phosphatase assay kit (Upstate Biotechnology). c, In vitro phosphatase assay as described above with anti-SHP-1 immunoprecipitates normalized for the amount of SHP-1 protein present in each of the immunoprecipitates (i.e., sp. act.). SHP-1 phosphatase activity (OD) was divided by the intensity of the corresponding SHP-1 band in immunoblots quantitated using IPLab Gel-D10.

starved for 24 h followed by incubation in serum-free medium containing 50 ng/ml IL-3 and 1 mCi/ml [3H]thymidine for 8 h. As illustrated in Fig. 4c, [3H]thymidine incorporation in response to IL-3 stimulation was again increased in clones overexpressing HA-SHP-1C453S relative to that in control clones.


3225

FIGURE 4. Expression of HA-SHP-1C453S in U937 cells enhances cell proliferation. a, Cells (1 3 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. Cell number was counted in triplicate using a hemocytometer at 24-h intervals over a period of 72 h. b, Cells (1 3 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. The amount of [3H]thymidine incorporation was measured during 8-h epochs over a period of 24 h (i.e., from 0 – 8, 8 –16, and 16 –24 h) by addition of 1 mCi/ml [3H]thymidine to the appropriate wells at the beginning of the epoch. c, Cells (1 3 105) from each clone were serum starved for 24 h followed by the addition of 50 ng/ml rIL-3 and incubated for and additional 24 h. Finally, thymidine incorporation was measured during the ensuing 8 h by addition of 1 mCi/ml of [3H]thymidine. d–f, Cells (2 3 105) were serum starved for 24 h followed by the addition of 20% FBS for 3 h. The cells were fixed and stained in a buffer containing 1.2% Nonidet P-40, 50 mg/ml propidium iodide, and 1 mg/ml RNase followed by cell cycle analysis using flow cytometry. The values for the peaks corresponding to G0/G1, S, and G2/M are indicated.

Expression of HA-SHP-1C453S decreases apoptosis Expansions of cell populations following various growth stimuli are known to reflect the net effects of both proliferation and death rate. Accordingly, the possible relevance of SHP-1 to regulation of cell death was studied by comparing rates of apoptosis in clones overexpressing HA-SHP-1C453S and control clones. Apoptosis was examined after 24 h of serum starvation by both flow cytometry using propidium iodide staining and terminal deoxynucleotidyl transferase in situ labeling. As shown in Fig. 5, a and b, the results of both assays revealed diminished rates of apoptosis in clones overexpressing HA-SHP-1C453S compared with control cells, suggesting that reduced rates of death might contribute to enhanced growth of the HA-SHP-1C453S cell population. Expression of HA-SHP-1C453S potentiates the oxidative burst The microbicidal function of myeloid cells is dependent on their ability to produce reactive oxygen intermediates such as O2zbe2 and H2O2 and to secrete lytic enzymes. The production of reactive oxygen intermediates is, in turn, mediated by a multicomponent enzyme complex, termed the NADPH oxidase, that is known to be functional in U937 cells (60). To determine the importance of SHP-1 in the regulation of this important effector function, the production of H2O2 was compared in clones overexpressing HA-SHP-1C453S and in controls. As illustrated in Fig. 6, clones overexpressing HA-SHP-1C453S displayed in-

creased oxidant production compared with controls after treatment with the phorbol ester PMA, a direct activator of protein kinase C and a potent agonist of the NADPH oxidase (58). The effects on oxidant production of other agonists including the formyl peptide FMLP, the phagocytic stimulus-opsonized zymosan, and cross-linking of FcgRI receptors (61) were also studied in these cells, but none of these agents induced a significant increase in oxidant production in either the control or HA-SHP-1C453S-overexpressing clones (not illustrated). Expression of HA-SHP-1C453S enhances cell adhesion Adhesive interactions between leukocytes and endothelial cells are paramount in the emigration of circulating PMN from the blood into inflamed tissues (62, 63). To determine the importance of SHP-1 in regulation of this important leukocyte function, HASHP-1C453S-overexpressing and control cells were compared with respect to their adhesion to serum-coated plastic following treatment with the phorbol ester PMA, FMLP, or C5a, known stimuli for leukocyte adhesion (64 – 66). Fig. 7, a and b, illustrate that clones overexpressing HA-SHP-1C453S displayed increased adhesion to serum-coated plastic compared with controls. As adhesion of myeloid leukocytes to extracellular matrix proteins is mediated predominantly by b2 integrins (67, 68), the HA-SHP-1C453S-overexpressing cells and control clones were also evaluated for surface expression of CD18 by flow cytometry using IB4, a mAb that

3226


FIGURE 6. Expression of HA-SHP-1C453S in U937 cells increases oxidant production in U937 cells. Equal numbers of U937 cells transfected with HA-SHP-1C453S (clones C453S-2, C453S-9, and C453S-10) or empty vector (vector) were stimulated with 1027 M PMA for 2 h at 37°C in buffer containing 10.4 mM scopoletin, 9.6 U/ml horseradish peroxidase, and 4 mM sodium azide for 2 h. A reduction in fluorescence of scopoletin was measured by a fluorescence spectrophotometer (Hitachi F-2000) with an excitation wavelength of 365 nm and an emission wavelength of 473 nm. Standard curves were generated using known amounts of H2O2.

FIGURE 5. Expression of HA-SHP-1C453S in U937 cells diminishes apoptosis. a, Cells (1 3 105) from each clone were serum starved for 24 h followed by the addition of 20% FBS. After an additional 24 h, cells were fixed and stained using propidium iodide, and the apoptotic cells (hypodiploid) were quantified by flow cytometry. b, In situ detection of apoptosis using the TUNEL reaction. Cells treated as outlined above were fixed in 4% paraformaldehyde, permeabilized, and stained using the TUNEL reaction. The samples were visualized by fluorescence microscopy using a Leica Orthoplan fluorescence microscope with a 63 Plan-Apo objective and photographed using Tri-X pan film. The photograph in the upper panels was intentionally overexposed to allow the visualization of the (weak) autofluorescence of the U937 cells to ensure that cells were present in the photographic field.

recognizes the common b-chain (CD18) (69). As illustrated in Fig. 7c, this analysis revealed CD18 expression to be relatively increased in the clones overexpressing HA-SHP-1C453S. To ensure that the enhanced adhesion of the HA-SHP-1C453S-overexpressing clones was, in fact, b2 integrin mediated, adhesion was assayed in the presence of the blocking anti-CD18 Ab, IB4. As shown in Fig. 7b, this analysis revealed adhesiveness of HA-SHP-1C453S-overexpressing cells to be diminished in the presence of IB4 to a level indistinguishable from that detected in clones transfected with vector alone. In addition, the basal adhesion of the clones transfected with vector alone was diminished by this Ab, suggesting that a portion of the basal adhesion of these U937 cells was mediated by b2 integrins. Given these alterations in surface expression of b2 integrins, which function in both adhesion and phagocytosis, we next sought to determine whether overexpression of HA-SHP-1C453S induced alterations in the expression of other phagocytic receptors, includ-

ing FcgRI, -RII, and -RIII, which are known to be expressed on myeloid cells. Fig. 8 illustrates that in clones overexpressing HASHP-1C453S there was a small, but significant, increase in expression of Fcg RII but no alteration in the level of expression of FcgRI or -RIII. This enhanced surface expression of FcgRII had no effect on phagocytosis of serum-opsonized zymosan (not shown). The effect of HA-SHP-1C453S overexpression on cell motility as assayed by chemotaxis through methylcellulose/nitrocellulose filters in response to FMLP, recombinant C5a, and zymosan-activated serum, was also studied. However, no significant difference was observed between clones overexpressing HA-SHP-1C453S and controls with respect to this important functional property (data not shown).

Discussion The primary purpose of the current study was to delineate the relevance of the SHP-1 tyrosine phosphatase to the regulation of myeloid cell function. Our results indicate that SHP-1 plays an important role in the negative regulation of myeloid cell proliferation and programmed cell death. Additionally, SHP-1 participates in the modulation of cell adhesion and the production of reactive oxygen intermediates, two properties key to the microbicidal functioning of mature myeloid cells. These observations suggest that SHP-1 facilitates the down-regulation and/or termination of myeloid cell activation cascades and imply a role for SHP-1 in minimizing microvascular sequestration of leukocytes and unregulated release of leukocyte-derived cytotoxic compounds that may occur in pathological contexts. Although on first consideration the magnitude of some of these individual effects may appear to be small (e.g., adhesion and oxidant production), their cumulative physiological effect may be much larger when exerted in vivo over prolonged periods of time. This conclusion is consistent with the clinical sequelae of SHP-1 deficiency as evidenced by the phenotype of motheaten and viable motheaten mice in which SHP-1 activity is essentially absent (49 –51, 70). These animals die prematurely as a consequence of a hemorrhagic interstitial pneumonitis associated with intraalveolar accumulation of macrophages and neutrophils in the distal lung units (71, 72) and with enhanced production of TNF-a by the alveolar macrophages (72, 73). Our recent data revealing high levels of SHP-1 expression in human peripheral blood


3227

FIGURE 8. Effects of expression of HA-SHP-1C453S on surface expression of Fcg receptors in U937 cells. Surface expression of FcgRI, FcgRII, and FcgRIII was quantified using subtype-specific mAbs and flow cytometry as described in Materials and Methods. The level of expression of each of the Fc receptors was compared between the overexpressing HA-SHP1C453S clone 10 and clones transfected with vector alone and with untransfected cells. p, p , 0.05, compared between vector and clone C453S-10 and between untransfected cells and clone C453S-10.

FIGURE 7. Expression of HA-SHP-1C453S in U937 cells increases adhesion and surface expression of CD18. a and b, The adhesion of U937 cells transfected with HA-SHP-1C453S (clone C453S-10) or empty vector (vector) to serum-coated plastic was assayed as described in Materials and Methods in the absence (a) or the presence of blocking concentrations (44 mg/ml) of the anti-CD18 Ab IB4. In a, adhesion in the absence or the presence of 1026 M FMLP, 1027 M PMA, and 1026 M C5a is illustrated. c, Surface expression of CD18 as determined by flow cytometry using an anti-CD18 Ab and indirect immunofluorescence. The geometric mean of fluorescence was calculated for each group and compared statistically. p, p , 0.05 for vector vs cells from the C453S-9 clone.

neutrophils (30) also emphasizes the potential importance of this signal terminating molecule to the regulation of neutrophil-mediated tissue inflammation and damage. Together these observations support the contention that unregulated leukocyte activation plays a fundamental etiological role in the pathogenesis of human diseases characterized by pulmonary inflammation and underscore the importance of signaling effectors and pathways that constrain the inflammatory process. For the purposes of this study, an enzymatically inactive dominant negative form of recombinant SHP-1 was expressed in U937 cells, a myelomonocytic cell line that exhibits some of the functional attributes of human peripheral blood leukocytes. We also attempted to express wild-type SHP-1 in these cells, but were unable to isolate stable overexpressing transfectants, possibly because of detrimental effects to cell growth/viability. To address the issue of specificity, clones overexpressing HA-SHP-1C453S and wild-type controls cells were also compared with respect to the activity of another tyrosine phosphatase, CD45, but this PTP ac-

tivity was found to be comparable in the mutant and wild-type cell populations (data not shown). We have also recently observed that bone marrow-derived neutrophils from motheaten and viable motheaten mice are hyperadhesive compared with cells from congenic controls wild-type mice (G. P. Downey and K. A. Siminovitch, manuscript in preparation). Together these data suggest that the phenotypic alterations observed in the HA-SHP-1C453S-transfected U937 cell lines also occur in vivo in conjunction with loss of SHP-1 function and are thus relevant to the normal regulation of myeloid cell function. The capacity of SHP-1 to down-regulate mitogenic signaling cascades has been demonstrated in many cellular systems and involves modulation of a diversity of receptors. Enhanced expression of SHP-1 has been shown, for example, to attenuate IL-3-induced tyrosine phosphorylation in DA-3 cells (31), a finding that appears to reflect IL-3-induced SHP-1 binding to the IL-3R b-chain and consequent b-chain dephosphorylation (31). Similarly, impaired SHP-1 activity is associated with hyperproliferative responses to IL-3 and erythropoietin in DA3 cells (74) and with IL-2-independent growth of transformed T cells (75). This latter effect again appears to reflect the capacity of SHP-1 to associate with a cytokine receptor (i.e., the IL-2R) and to dephosphorylate the b-chain of the activated receptor, leading, in turn, to diminished phosphorylation of the associated Janus family tyrosine kinases JAK1 and JAK3 (75). These observations thus indicate a pivotal role for SHP-1 in down-regulating activation signals transduced through the IL-2 and IL-3 receptors, as is again consistent with the profound expansion of granulocytes and macrophages found in SHP1-deficient motheaten mice. The motheaten phenotype appears to also reflect the capacity of SHP-1 to inhibit proliferative signals evoked through a number of other growth factor receptors. These include, for example, the c-Kit tyrosine kinase receptor, which transduces a hyperproliferative response to Kit ligand in motheaten bone marrow progenitor cells and appears subject to SHP-1-mediated suppression in relation to its role in promoting macrophage and granulocyte development (32, 43). Along similar lines, macrophages from motheaten mice show enhanced proliferative responses to granulocyte-macrophage CSF (76) and CSF-1 and display CSF-1R hyperphosphorylation in response to CSF-1 stimulation (33). These effects appear to reflect the capacity of SHP-1 to directly dephosphorylate activated receptors (31, 33, 35, 41) and/or dephosphorylate the associated Janus tyrosine kinases (36, 37), or other components of receptor signaling complexes (39,

3228 40, 42– 45, 47, 48, 77). Based on these findings, the effects of HA-SHP-1C453S overexpression on protein tyrosine phosphorylation were directly investigated in the current study. However, no differences were detected between the HA-SHP-1C453S transfectants and wild-type cells with respect to either IL-3-induced global or IL-3R b-chain tyrosine phosphorylation (data not shown). Thus, the biochemical basis for the altered physiologic properties of the HA-SHP-1C453S cells remain unclear. However, SHP-1 has been shown to bind to a plethora of other signaling effectors, including, for example, Grb-2 (33), Cbl, STAT3, STAT5a, STAT5b, Shc, the p85 subunit of phosphoinositide 3-kinase, Vav, and the Ras-GTPase-activating protein (78). SHP-1 has also been recently shown to associate with a 130-kDa tyrosyl-phosphorylated species (P130) in macrophages that is comprised of two transmembrane glycoproteins, PIR-B/p91A and the signal regulator protein family member brain Ig-like molecule with tyrosine-based activation motifs (79). These latter proteins may be substrates for SHP-1 because they are hyperphosphorylated in macrophages from motheaten viable mice. However, further investigations are currently underway to determine which of these various SHP-1-protein interactions accounts for the effects of SHP-1 on myeloid cell behavior. The association of impaired SHP-1 function with a diminution in cell death rate, as observed in the current study, has important implications for the regulation of the inflammatory process. In an inflammatory response evoked by bacterial infection, for example, prolongation of phagocytic cell survival might be expected to facilitate the killing of invading microbes. By contrast, in the context of inflammatory-mediated tissue damage such as the systemic inflammatory response syndrome (80), the persistence of tissue neutrophilia might be deleterious. Accordingly, regulation of the survival/death rates of inflammatory cells is likely to have significant physiologic ramifications (81). Involvement of SHP-1 in the regulation of myeloid cell apoptosis also raises the possibility that a reduction in spontaneous apoptosis contributes to the granulocyte and macrophage expansion observed in motheaten mice. A role for SHP-1 in the regulation of lymphocyte apoptosis also appears likely in view of the pivotal role for SHP-1 in regulating signaling through the Ag receptors and various Ag receptor comodulators. This possibility is supported by recent data from our group linking SHP-1 to the regulation of activation-induced cell death of peripheral T cells (82). At present, however, the mechanisms by which SHP-1 realizes its effects on spontaneous or induced apoptotic signaling cascades remain unclear. The hyperadhesiveness of the HA-SHP-1C453S-overexpressing clones suggests that SHP-1 is also involved in regulating the adherence properties of leukocytes. The enhanced surface expression of the b2 integrin common b-chain in concert with the blocking effects of an anti-CD18 mAb suggest that the enhanced adhesiveness of these clones is mediated by effects on the b2 integrins. Myeloid cell hyperadhesiveness might also contribute to the massive accumulation of myeloid cells in the tissues of motheaten mice (49 –51), particularly since the inflammatory infiltration in these mice can be partially ameliorated by treatment with antiCD11b (5C6) Ab (83). However, the mechanism(s) by which SHP-1 influences CD11/CD18 function and cell adhesion remain to be elucidated, particularly since the role of tyrosine phosphorylation in modulating b2 integrin functions remains uncertain (84, 85). In this regard, it is noteworthy that SHP-1 has recently been shown to associate with tyrosine-phosphorylated PECAM-1 (86) and with several molecules found in adhesion complexes, including paxillin, vimentin, and filamentous actin in CSF-1-stimulated macrophages (78). The relevance of these observations in relation to the role of SHP-1 in cell adhesion, however, are not clear. Interestingly, several other protein tyrosine phosphatases have also

SHP-1 REGULATION OF MYELOID CELL FUNCTION been implicated in the regulation of cell-cell and cell-substrate adhesion (87, 88). For example, the closely related PTP SHP-2 appears to play an important role in b1 integrin-mediated activation of mitogen-activated protein kinase (89), and the leukocyte tyrosine phosphatase CD45 is required for the maintenance of integrin-mediated adhesion in murine bone marrow macrophages (90). Together, these data suggest that modulation of cell adhesion represents another mechanism by which SHP-1 influences myeloid cell behavior. In addition to the other functional changes associated with HASHP-1C453S overexpression, oxidant production was increased in the transfected cells. This observation suggests the involvement of SHP-1 in regulating leukocyte NADPH oxidase, a multicomponent enzyme complex that transfers a single electron from NADPH to molecular oxygen, resulting in the production of superoxide (O2 2 ) (91). Although the signaling pathways leading to activation of NADPH oxidase remain to be clarified, tyrosine phosphorylation appears to be relevant to the process, as increases in tyrosine phosphorylation correlate temporally with activation of the oxidase (13). Additionally, inhibitors of protein tyrosine kinases block the production of reactive oxygen intermediates (13, 18). There is also evidence that PTPs negatively regulate activation of NADPH oxidase; inhibition of tyrosine phosphatases with vanadate or its peroxides has been shown to potentiate FMLP-induced superoxide production in whole cells and to activate a respiratory burst in electroporated cells (25–27). Taken together, these observations indicate that tyrosine phosphatases, including SHP-1, are likely to play important roles in regulation of the leukocyte NADPH oxidase. In conclusion, our studies demonstrate that the SH2 domain containing tyrosine phosphatase SHP-1 plays a pivotal role in the regulation of a multiplicity of signaling pathways regulating the growth, differentiation, and activation of myeloid leukocytes. Unregulated release of leukocyte-derived cytotoxic compounds has been implicated in a variety of disorders characterized by inflammatory tissue injury such as arthritis, ischemia reperfusion injury, and acute lung injury (4 –7), and the potential for SHP-1 to limit leukocyte activation in these circumstances therefore suggests pivotal roles for SHP-1 in relation to a broad spectrum of disease pathophysiology. By extension, reduced activity of signal-terminating molecules such as SHP-1 may result in an imbalance of inflammatory cascades so as to predispose to potentially catastrophic consequences, such as the systemic inflammatory response syndrome and acute lung injury.

References 1. Sha’afi, R., and T. Molski. 1988. Activation of the neutrophils. In Progress in Allergy, Vol. 42. E. L. Becker, ed. Karger, Basel, p. 1– 64. 2. Downey, G. P., T. Fukushima, L. Fialkow, and T. K. Waddell. 1995. Intracellular signaling in neutrophil priming and activation. Semin. Cell Biol. 6:345. 3. Gerard, C., and N. P. Gerard. 1994. The pro-inflammatory seven-transmembrane segment receptors of the leukocyte. Curr. Opin. Immunol. 6:140. 4. Parrillo, J. E. 1993. Pathogenic mechanisms of septic shock. N. Engl. J. Med. 328:1471. 5. Fujishima, S., and N. Aikawa. 1995. Neutrophil-mediated tissue injury and its modulation. Intensive Care Med. 21:277. 6. Kurose, I., L. W. Argenbright, R. Wolf, L. Lianxi, and D. N. Granger. 1997. Ischemia/reperfusion-induced microvascular dysfunction: role of oxidants and lipid mediators. Am. J. Physiol. 272:H2976. 7. Hawkins, C. L., and M. J. Davies. 1997. Oxidative damage to collagen and related substrates by metal ion/hydrogen peroxide systems: random attack or site-specific damage. Biochim. Biophys. Acta 1360:84. 8. Babior, B. M. 1988. Protein phosphorylation and the respiratory burst. Arch. Biochem. Biophys. 264:361. 9. Dusi, S., M. Donini, V. Della Bianca, and F. Rossi. 1994. Tyrosine phosphorylation of phospholipase C-g2 is involved in the activation of phosphoinositide hydrolysis by Fc receptors in human neutrophils. Biochem. Biophys. Res. Commun. 201:1100.

The Journal of Immunology 10. Greenberg, S., P. Chang, and S. C. Silverstein. 1993. Tyrosine phosphorylation is required for Fc receptor-mediated phagocytosis in mouse macrophages. J. Exp. Med. 177:529. 11. Huang, C., G. Laramee, and J. Casnellie. 1988. Chemotactic factor induced tyrosine phosphorylation of membrane associated proteins in rabbit peritoneal neutrophils. Biochem. Biophys. Res. Commun. 151:794. 12. Gomez-Cambronero, J., C. Huang, V. Bonak, E. Wang, and J. Casnellie. 1989. Tyrosine phosphorylation in human neutrophil. Biochem. Biophys. Res. Commun. 162:1478. 13. Berkow, R. L., R. W. Dodson, and A. S. Kraft. 1989. Human neutrophils contain distinct cytosolic and particulate tyrosine kinase activities: possible role in neutrophil activation. Biochim. Biophys. Acta 997:292. 14. McGregor, P. E., D. K. Agrawal, and J. D. Edwards. 1994. Attenuation of human leukocyte adherence to endothelial cell monolayers by tyrosine kinase inhibitors. Biochem. Biophys. Res. Commun. 198:359. 15. Gaudry, M., A. C. Caon, C. Gilbert, S. Lille, and P. H. Naccache. 1992. Evidence for the involvement of tyrosine kinases in the locomotory responses of human neutrophils. J. Leukocyte Biol. 51:103. 16. Kobayashi, K., K. Takahashi, and S. Nagasawa. 1995. The role of tyrosine phosphorylation and Ca21 accumulation in Fcg-receptor-mediated phagocytosis of human neutrophils. J. Biochem. 117:1156. 17. Grinstein, S., and W. Furuya. 1991. Tyrosine phosphorylation and oxygen consumption induced by G proteins in neutrophils. Am. J. Physiol. 260:C1019. 18. Kusunoki, T., H. Higashi, S. Hosoi, D. Hata, K. Sugie, M. Mayumi, and H. Mikawa. 1992. Tyrosine phosphorylation and its possible role in superoxide production by human neutrophils stimulated with FMLP and IgG. Biochem. Biophys. Res. Commun. 183:789. 19. Ptasznik, A., E. R. Prossnitz, D. Yoshikawa, A. Smrcka, A. E. Traynor-Kaplan, and G. M. Bokoch. 1996. A tyrosine kinase signaling pathway accounts for the majority of phosphatidylinositol 3,4,5-trisphosphate formation in chemoattractant-stimulated human neutrophils. J. Biol. Chem. 271:25204. 20. Berton, G., L. Fumagalli, C. Laudanna, and C. Sorio. 1994. b2 integrin-dependent protein tyrosine phosphorylation and activation of the FGR protein tyrosine kinase in human neutrophils. J. Cell Biol. 126:1111. 21. Corey, S., A. Eguinoa, K. Puyana-Theall, J. Bolen, L. Cantley, F. Mollinedo, T. Jackson, P. Hawkins, and L. R. Stephens. 1993. Granulocyte macrophagecolony stimulating factor stimulates both association and activation of phosphoinositide 3OH-kinase and Src-related tyrosine kinase(s) in human myeloid derived cells. EMBO J. 12:2681. 22. Asahi, M., T. Taniguchi, E. Hashimoto, T. Inazu, H. Maeda, and H. Yamamura. 1993. Activation of protein-tyrosine kinase p72syk with concanavalin A in polymorphonuclear neutrophils. J. Biol. Chem. 268:23334. 23. Kraft, A. S., and R. L. Berkow. 1987. Tyrosine kinase and phosphotyrosine phosphatase activity in human promyelocytic leukemia cells and human polymorphonuclear leukocytes. Blood 70:356. 24. Kansha, M., K. Takeshige, and S. Minakami. 1993. Decrease in the phosphotyrosine phosphatase activity in the plasma membrane of human neutrophils on stimulation by phorbol 12-myristate 13-acetate. Biochim. Biophys. Acta 1179: 189. 25. Lloyds, D., and M. B. Hallett. 1994. Neutrophil “priming” induced by orthovanadate: evidence of a role for tyrosine phosphorylation. Biochem. Pharmacol. 48: 15. 26. Grinstein, S., W. Furuya, D. J. Lu, and G. B. Mills. 1990. Vanadate stimulates oxygen consumption and tyrosine phosphorylation in electropermeabilized human neutrophils. J. Biol. Chem. 265:318. 27. Mitsuyama, T., K. Takeshige, and S. Minakami. 1993. Tyrosine phosphorylation is involved in the respiratory burst of electropermeabilized human neutrophils at a step before diacylglycerol formation by phospholipase C. FEBS Lett. 322:280. 28. Uchida, T., T. Matozaki, K. Matsuda, T. Suzuki, S. Matozaki, O. Nakano, K. Wada, Y. Konda, C. Sakamoto, and M. Kasuga. 1993. Phorbol ester stimulates the activity of a protein tyrosine phosphatase containing SH2 domains (PTP1C) in HL-60 leukemia cells by increasing gene expression. J. Biol. Chem. 268: 11845. 29. Knutson, K. L., Z. Hmama, P. Herrera-Velit, R. Rochford, and N. E. Reiner. 1998. Lipoarabinomannan of Mycobacterium tuberculosis promotes protein tyrosine dephosphorylation and inhibition of mitogen-activated protein kinase in human mononuclear phagocytes; role of the Src homology 2 containing tyrosine phosphatase 1. J. Biol. Chem. 273:645. 30. Brumell, J., C. K. Chan, J. Butler, N. Borregaard, K. Siminovitch, S. Grinstein, and G. P. Downey. 1997. Regulation of SHP-1 during activation of human neutrophils: role of protein kinase C. J. Biol. Chem. 272:875. 31. Yi, T., and J. Ihle. 1993. Association of hematopoietic cell phosphatase with c-Kit after stimulation with c-Kit ligand. Mol. Cell. Biol. 13:3350. 32. Paulson, R. F., S. Vesely, K. A. Siminovitch, and A. Bernstein. 1996. Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1. Nat. Genet. 13:309. 33. Chen, H. E., S. Chang, T. Trub, and B. G. Neel. 1996. Regulation of colonystimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 16:3685. 34. Vambutas, V., D. R. Kaplan, M. A. Sells, and J. Chernoff. 1995. Nerve growth factor stimulates tyrosine phosphorylation and activation of Src homology-containing protein-tyrosine phosphatase 1 in PC12 cells. J. Biol. Chem. 270:25629. 35. Tomic, S., R. U. Greise, R. Lammers, A. Kharitonenkov, E. Imyanitov, A. Ullrich, and F. Bohmer. 1995. Association of SH2 domain protein tyrosine phosphatases with the epidermal growth factor receptor in human tumor cells: phosphatidic acid activates receptor dephosphorylation by PTP1C. J. Biol. Chem. 270:21277.

3229 36. David, M., H. E. Chen, S. Goelz, A. C. Larner, and B. G. Neel. 1995. Differential regulation of the a/b interferon-stimulated Jak/Stat pathway by the SH2 domaincontaining tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 15:7050. 37. Klingmu¨ller, U., U. Lorenz, L. C. Cantley, B. G. Neel, and H. F. Lodish. 1995. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 80:729. 38. Klingmu¨ller, U. 1997. The role of tyrosine phosphorylation in proliferation and maturation of erythroid progenitor cells-signals emanating from the erythropoietin receptor. Eur. J. Biochem. 249:637. 39. Law, C. L., S. P. Sidorenko, K. A. Chandran, Z. Zhao, S. H. Shen, E. H. Fischer, and E. A. Clark. 1996. CD22 associates with protein tyrosine phosphatase 1C, Syk, and phospholipase C-g(1) upon B cell activation. J. Exp. Med. 183:547. 40. Nadler, M. J. S., B. Chen, J. S. Anderson, H. H. Wortis, and B. G. Neel. 1997. Protein-tyrosine phosphatase SHP-1 is dispensable for FcgRIIB-mediated inhibition of B cell antigen receptor activation. J. Biol. Chem. 272:20038. 41. Vogel, W., R. Lammers, J. Huang, and A. Ullrich. 1993. Activation of a phosphotyrosine phosphatase by tyrosine phosphorylation. Science 259:1611. 42. Binstadt, B. A., K. M. Brumbaugh, C. J. Dick, A. M. Scharenberg, B. L. Williams, M. Colonna, L. L. Lanier, J. P. Kinet, R. T. Abraham, and P. J. Leibson. 1996. Sequential involvement of Lck and SHP-1 with MHC-recognizing receptors on NK cells inhibits FcR-initiated tyrosine kinase activation. Immunity 5:629. 43. Lorenz, U., A. D. Bergemann, H. N. Steinberg, J. G. Flanagan, X. Li, S. J. Galli, and B. G. Neel. 1996. Genetic analysis reveals cell type-specific regulation of receptor tyrosine kinase c-Kit by the protein tyrosine phosphatase SHP1. J. Exp. Med. 184:1111. 44. Plas, D. R., R. Johnson, J. T. Pingel, R. J. Matthews, M. Dalton, G. Roy, A. C. Chan, and M. L. Thomas. 1996. Direct regulation of ZAP-70 by SHP-1 in T cell antigen receptor signaling. Science 272:1173. 45. Pani, G., M. Kozlowski, J. C. Cambier, G. B. Mills, and K. A. Siminovitch. 1995. Identification of the tyrosine phosphatase PTP1C as a B cell antigen receptorassociated protein involved in the regulation of B cell signaling. J. Exp. Med. 181:2077. 46. D’Ambrosio, D., K. L. Hippen, S. A. Minskoff, I. Mellman, G. Pani, K. A. Siminovitch, and J. C. Cambier. 1995. Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by FcgRIIB1. Science 268:293. 47. Kon-Kozlowski, M., G. Pani, T. Pawson, and K. A. Siminovitch. 1996. The tyrosine phosphatase PTP1C associates with Vav, Grb2, and mSos1 in hematopoietic cells. J. Biol. Chem. 271:3856. 48. Doody, G. M., L. B. Justement, C. C. Delibrias, R. J. Matthews, J. Lin, M. L. Thomas, and D. T. Fearon. 1995. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP. Science 269:242. 49. Tsui, H. W., K. A. Siminovitch, L. de Souza, and F. W. Tsui. 1993. Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat. Genet. 4:124. 50. Kozlowski, M., I. Mlinaric-Rascan, G. S. Feng, R. Shen, T. Pawson, and K. A. Siminovitch. 1993. Expression and catalytic activity of the tyrosine phosphatase PTP1C is severely impaired in motheaten and viable motheaten mice. J. Exp. Med. 178:2157. 51. Bignon, J. S., and K. A. Siminovitch. 1994. Identification of PTP1C mutation as the genetic defect in motheaten and viable motheaten mice: a step toward defining the roles of protein tyrosine phosphatases in the regulation of hemopoietic cell differentiation and function. Clin. Immunol. Immunopathol. 73:168. 52. Somani, A. K., J. S. Bignon, G. B. Mills, K. A. Siminovitch, and D. R. Branch. 1997. Src kinase activity is regulated by the SHP-1 protein-tyrosine phosphatase. J. Biol. Chem. 272:21113. 53. MacDonald, R. J., G. H. Swift, A. E. Przybyla, and J. M. Chirgwin. 1987. Isolation of RNA using guanidinium salts. Methods Enzymol. 152:219. 54. Groppe, J. C., and D. E. Morse. 1993. Isolation of full-length RNA templates for reverse transcription from tissues rich in RNase and proteoglycans. Anal. Biochem. 210:337. 55. Fialkow, L., C. K. Chan, and G. Downey. 1997. Regulation of protein tyrosine phosphatase activity in neutrophils: modulation by oxidants. J. Immunol. 158: 5409. 56. Hogg, D., C. Guidos, D. Bailey, A. Amendola, T. Groves, J. Davidson, R. Schmandt, and G. Mills. 1994. Cell cycle dependent regulation of the protein kinase TTK. Oncogene 9:89. 57. Waddell, T. K., L. Fialkow, C. K. Chan, T. K. Kishimoto, and G. P. Downey. 1994. Potentiation of the oxidative burst of human neutrophils. A signaling role for L-selectin. J. Biol. Chem. 269:18485. 58. Downey, G. P., J. R. Butler, H. Tapper, L. Fialkow, A. Salteil, B. Rubin, and S. Grinstein. 1998. Importance of the MEK/MAP kinase pathway in neutrophil microbicidal responsiveness. J. Immunol. 160:434. 59. Bone, H., U. Dechert, F. Jirik, J. W. Schrader, and M. J. Welham. 1997. SHP1 and SHP2 protein-tyrosine phosphatases associate with bc after interleukin-3induced receptor tyrosine phosphorylation. Identification of potential binding sites and substrates. J. Biol. Chem. 272:14470. 60. Obermeier, H., A. Sellmayer, U. Danesch, and M. Aepfelbacher. 1995. Cooperative effects of interferon-g on the induction of NADPH oxidase by retinoic acid or 1,25(OH)2-vitamin D3 in monocytic U937 cells. Biochim. Biophys. Acta 1269: 25. 61. Durden, D. L., H. M. Kim, B. Calore, and Y. Liu. 1995. The FcgRI receptor signals through the activation of hck and MAP kinase. J. Immunol. 154:4039. 62. Granger, D. N., and P. Kubes. 1994. The microcirculation and inflammation: modulation of leukocyte-endothelial cell adhesion. J. Leukocyte Biol. 55:662.

3230 63. Springer, T. A. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301. 64. Lundgren-Akerlund, E., E. Berger, and K.-E. Arfors. 1992. Effect of divalent cations on adhesion of polymorphonuclear leukocytes to matrix molecules in vitro. J. Leukocyte Biol. 51:603. 65. Albelda, S. M., C. W. Smith, and P. A. Ward. 1994. Adhesion molecules and inflammatory injury. FASEB J. 8:504. 66. Firestein, G. S., D. A. Bullough, M. D. Erion, R. Jimenez, M. Ramirez-Weinhouse, J. Barankiewicz, C. W. Smith, H. E. Gruber, and K. M. Mullane. 1995. Inhibition of neutrophil adhesion by adenosine and an adenosine kinase inhibitor: the role of selectins. J. Immunol. 154:326. 67. Brown, E. J., and F. P. Lindberg. 1996. Leucocyte adhesion molecules in host defence against infection. Ann. Med. 28:201. 68. Bevilacqua, M. P., R. M. Nelson, G. Mannori, and O. Cecconi. 1994. Endothelialleukocyte adhesion molecules in human disease. Annu. Rev. Med. 45:361. 69. Wright, S. D., P. E. Rao, W. C. Van Voorhis, L. S. Craigmyle, K. Iida, M. A. Talle, E. F. Westberg, G. Goldstein, and S. C. Silverstein. 1983. Identification of the C3bi receptor of human monocytes and macrophages by using monoclonal antibodies. Proc. Natl. Acad. Sci. USA 80:5699. 70. Shultz, L. D., P. A. Schweitzer, T. V. Rajan, T. Yi, J. N. Ihle, R. J. Matthews, M. L. Thomas, and D. R. Beier. 1993. Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 73:1445. 71. Shultz, L. D., and C. L. Sidman. 1987. Genetically determined murine models of immunodeficiency. Annu. Rev. Immunol. 5:367. 72. Thrall, R. S., S. N. Vogel, R. Evans, and L. D. Shultz. 1997. Role of tumor necrosis factor-a in the spontaneous development of pulmonary fibrosis in viable motheaten mutant mice. Am. J. Pathol. 151:1303. 73. Shultz, L. D., D. R. Coman, C. L. Bailey, W. G. Beamer, and C. L. Sidman. 1984. “Viable motheaten,” a new allele at the motheaten locus. I. Pathology. Am. J. Pathol. 116:179. 74. Yang, W., M. Tabrizi, K. Berrada, and T. Yi. 1998. SHP-1 phosphatase C-terminus interacts with novel substrates p32/p30 during erythropoietin and interleukin-3 mitogenic responses. Blood 91:3746. 75. Migone, T. S., N. A. Cacalano, N. Taylor, T. Yi, T. A. Waldmann, and J. A. Johnston. 1998. Recruitment of SH2-containing protein tyrosine phosphatase SHP-1 to the interleukin 2 receptor; loss of SHP-1 expression in human T-lymphotropic virus type I-transformed T cells. Proc. Natl. Acad. Sci. USA 95:3845. 76. Jiao, H., W. Yang, K. Berrada, M. Tabrizi, L. Shultz, and T. Yi. 1997. Macrophages from motheaten and viable motheaten mutant mice show increased proliferative responses to GM-CSF: detection of potential HCP substrates in GMCSF signal transduction. Exp. Hematol. 25:592. 77. Smith, K. G. C., D. M. Tarlinton, G. M. Doody, M. L. Hibbs, and D. T. Fearon. 1998. Inhibition of the B Cell by CD22: a requirement for Lyn. J. Exp. Med. 187:807.

SHP-1 REGULATION OF MYELOID CELL FUNCTION 78. Yeung, Y. G., Y. Wang, D. B. Einstein, P. S. W. Lee, and E. R. Stanley. 1998. Formation of multimeric cytosolic complexes of signaling proteins and cytoskeletal components in macrophages. J. Biol. Chem. 273:17128. 79. Timms, J. F., K. Carlberg, H. Gu, H. Chen, S. Kamatkar, M. J. S. Nadler, L. R. Rohrschneider, and B. G. Neel. 1998. Identification of major binding proteins and substrates for the SH2-containing protein tyrosine phosphatase SHP-1 in macrophages. Mol. Cell. Biol. 18:3838. 80. Rinaldo, J. E., and J. W. Christman. 1990. Mechanisms and mediators of the adult respiratory distress syndrome. Clin. Chest Med. 11:621. 81. Savill, J., and C. Haslett. 1995. Granulocyte clearance by apoptosis in the resolution of inflammation. Semin. Cell. Biol. 6:385. 82. Zhang, J., A.-K. Somani, S. Watt, G. Mills, and K. A. Siminovitch. 1999. The SHP-1 tyrosine phosphatase inhibits antigen receptor-induced apoptosis of activated peripheral T cells. J. Immunol. In press. 83. Koo, G. C., H. Rosen, A. Sirotina, X. D. Ma, and L. D. Shultz. 1993. Anti-CD11b antibody prevents immunopathologic changes in viable motheaten bone marrow chimeric mice. J. Immunol. 151:6733. 84. Valmu, L., and C. G. Gahmberg. 1995. Treatment with okadaic acid reveals strong threonine phosphorylation of CD18 after activation of CD11/CD18 leukocyte integrins with phorbol esters or CD3 antibodies. J. Immunol. 155:1175. 85. Hellberg, C., D. Eierman, A. Sjo¨lander, and T. Andersson. 1995. The Ca21 signaling capacity of the b2-integrin on HL60-granulocytic cells is abrogated following phosphorylation of its CD18-chain: relation to impaired protein tyrosine phosphorylation. Exp. Cell Res. 217:140. 86. Cao, M. Y., M. Huber, N. Beauchemin, J. Famiglietti, S. M. Albelda, and A. Veillette. 1998. Regulation of mouse PECAM-1 tyrosine phosphorylation by the Src and Csk families of protein-tyrosine kinases. J. Biol. Chem. 273:15765. 87. Fashena, S. J., and K. Zinn. 1995. Cell-cell signaling: the ins and outs of receptor tyrosine phosphatases. Curr. Biol. 5:1367. 88. Barford, D., Z. Jia, and N. K. Tonks. 1995. Protein tyrosine phosphatases take off. Nat. Struct. Biol. 2:1043. 89. Tsuda, M., T. Matozaki, K. Fukunaga, Y. Fujioka, A. Imamoto, T. Noguchi, T. Takada, T. Yamao, H. Takeda, F. Ochi, et al. 1998. Integrin-mediated tyrosine phosphorylation of SHPS-1 and its association with SHP-2: roles of Fak and Src family kinases. J. Biol. Chem. 273:13223. 90. Roach, T., S. Slater, M. Koval, L. White, E. C. McFarland, M. Okumura, M. Thomas, and E. Brown. 1997. CD45 regulates Src family member kinase activity associated with macrophage integrin-mediated adhesion. Curr. Biol. 7:408. 91. Smith, R. M., and J. T. Curnette. 1991. Molecular basis of chronic granulomatous disease. Blood 77:673.