Cloning by functional complementation of a mouse cDNA encoding a ...

The EMBO Journal vol.11 no.6 pp.2151 -2157, 1992

Cloning by functional complementation of a cDNA encoding a homologue of CDC25, a Saccharomyces cerevisiae RAS activator Enzo Martegani, Marco Vanoni, Renata Zippel, Paola Coccetti, Riccardo Brambilla, Cristina Ferrari, Emmapaola Sturani and Lilia Alberghina Dipartimento di Fisiologia e Biochimica Generali, Sezione di Biochimica Comparata, Universita degli Studi di Milano, via Celoria 26, 20133 Milano, Italy Communicated by F.Blasi

In the yeast Saccharomyces cerevisiae genetic and biochemical evidence indicates that the product of the CDC25 gene activates the RAS/adenylyl cyclase/protein kinase A pathway by acting as a guanine nucleotide protein. Here we report the isolation of a mouse brain cDNA homologous to CDC25. The mouse cDNA, called CDC25Mm, complements specifically point mutations and deletion/disruptions of the CDC25 gene. In addition, it restores the cAMP levels and CDC25-dependent glucoseinduced cAMP signalling in a yeast strain bearing a disruption of the CDC25 gene. The CDC25Mm-encoded protein is 34% identical with the catalytic carboxy terminal part of the CDC25 protein and shares significant homology with other proteins belonging to the same family. The protein encoded by CDC2S m, prepared as a glutathione S-transferase fusion in Escherichia coli cells, activates adenylyl cyclase in yeast membranes in a RAS2-dependent manner. Northern blot analysis of mouse brain poly(A) + RNA reveals two major transcripts of 1700 and 5200 nucleotides. Transcripts were found also in mouse heart and at a lower level in liver and spleen. Key words: CDC25 complementation/mouse GNRP/RAS activator -

Introduction originally identified as the transforming of Harvey and Kirstein sarcoma viruses (Barbacid, 1987). Members of the RAS (proto)oncogene family have since been identified in several eukaryotic species including budding and fission yeast, Drosophila and mammals (Barbacid, 1987; Broach and Deschenes, 1990). RAS genes encode membrane-bound, low molecular weight guanine nucleotide binding proteins with low intrinsic GTPase activity. They act as molecular switches cycling between an active (GTP bound) and an inactive (GDP bound) state. The balance between the GTP and GDP bound state is governed by the opposite action of proteins activating the intrinsic RAS GTPase activity (GTPase Activating Proteins, GAPs) and of proteins promoting the replacement of GTP for GDP in the RAS guanine nucleotide binding site (Guanine Nucleotide Releasing Proteins, GNRPs) (reviewed in Bourne et al., 1991). Mutations that increase the levels of GTP bound RAS,

RAS

genes were

genes

©) Oxford University Press

mouse

by decreasing its GTPase activity or increasing GDP/GTP exchange, result in constitutive activation of the protein and in a failure to arrest growth properly upon nutrient starvation in budding yeast and in oncogenic transformation in higher eukaryotes. Conversely, mutations increasing the levels of GDP-RAS, such as cdc25 in Saccharomyces cerevisiae, result in a growth defect (Sigal et al., 1986; Walter et al., 1986; Gibbs et al., 1987; Feig and Cooper, 1988). In S. cerevisiae RAS proteins exert their effect primarily, if not exclusively, through the adenylyl cyclase/protein kinase A pathway; the effector system of and the signal(s) mediated by mammalian ras proteins remains elusive. Nevertheless S. cerevisiae and mammalian ras can substitute each other in the respective heterologous systems (DeFeo Jones et al., 1985; Kataoka et al., 1985) and expression of mammalian GAP can complement mutations in the corresponding yeast gene IRA] (Ballester et al., 1989; Tanaka et al., 1990). Genetic and biochemical evidences indicate that in budding yeast the CDC25 gene product is the major and possibly unique RAS GNRP (Robinson et al., 1987; Powers et al., 1989; Jones et al., 1991), although a growing family of CDC25-like proteins is present in budding yeast. All these proteins, i.e. the products of the SDC25 (Damak et al., 1991), LTE] (Wickner et al., 1987) and BUD5 (Chant et al., 1991; Powers et al., 1991) genes of S. cerevisiae show a significant homology with the carboxy terminal region of the CDC25 protein. In addition the carboxy terminal region of SDC25 can substitute for CDC25 function in vivo and activate RAS protein in vitro (Crechet et al., 1990b; Damak et al., 1991). BUD5, a protein involved in the selection of the budding site (Chant et al., 1991), may also interact with RAS proteins upon overexpression. BUD5 overexpression in the presence of a wild type RAS gene in fact can rescue the dominant tem,perature D 19 Ala22 sensitive growth defect of strains bearing the RAS2 allele, most likely by directly interacting with and titrating out the mutant RAS protein. Inability to complement cdc25 mutations indicates that the BUD5 encoded protein is unable to catalyse the GDP/GTP exchange of RAS proteins (Powers et al., 1991). The ste6 gene product of Schizosaccharomyces pombe is also an upstream regulatory of S.pombe ras proteins and a remarkable degree of conse'rvation of amino acid sequence is found between CDC25 of S. cerevisiae and ste6 of S.pombe in spite of the large evolutionary distance between these two yeasts (Russel and Nurse, 1986; Hughes et al., 1990). Another cDNA encoding for a protein homologous to CDC25 has been recently cloned in Drosophila (Simon et al., 1991). Little information is available about the ras-GNRPs of mammals. A ras-specific GNRP has been recently purified from mammalian brain (Huang et al., 1990). Whether this protein is structurally and functionally related to CDC25 is still unknown. In order to isolate and characterize mammalian cDNAs encoding protein(s) functionally and/or structurally homologous to the CDC25 protein, we decided to use a direct 2151

E.Martegani et al.

functional complementation assay. We thus constructed a mouse brain cDNA library in a yeast expression vector and screened this library for plasmid mediated suppression of the growth lesion of a cdc25-1 strain at 37°C. Here we report the isolation of a mouse cDNA encoding a 54 kDa protein able to substitute specifically for the CDC25 function in budding yeast. This protein shares a high degree of homology with the last 300 carboxy terminal amino acids of the yeast CDC25 protein indicating a strong evolutionary conservation.

Results Isolation of mouse cDNA clones suppressing the temperature sensitive growth lesion of cdc25-1 mutants A mouse brain cDNA library was constructed in the yeast episomal expression vector pGR56 (see Materials and methods). The cDNA library was used to transform the cdc25-1 ura3 strain TC7 (Martegani et al., 1986a). Out of >50 000 Ura+ transformants screened, more than 100 colonies growing at the restrictive temperature (Ts+) were obtained and most of them exhibited a plasmid-dependent ability to grow at 37°C. From these independent transformants 30 plasmids were rescued which following retransformation into the original cdc25- 1 mutant, were able to suppress the Ts- phenotype. Restriction analysis showed, however, that all the original Ts+ transformants contained the same plasmid, pCDC25/12, containing a cDNA insert of -1300 nt. To investigate the mechanism of pCDC25/12 activity regarding direct replacement of CDC25 or CDC25-independent activation of the adenylyl cyclase pathway, the plasmid was transformed into yeast mutants defective in other genes of the pathway. Table I shows that plasmid pCDC25/12 did not restore growth of the ras2 mutant strain 112-694 on a non-fermentable carbon source. Similarly, the temperature sensitive growth defect of a cdc35-10 mutant (strain

35-971/3c), mutated in the gene encoding adenylyl cyclase, was not suppressed by pCDC25/12. These data indicate that complementation of the cdc25 defect by the mouse cDNA clone is due to actual replacement of the CDC25 function and not to overexpression of a downstream element of the adenylyl cyclase pathway. Table I shows that pCDC25/12 could complement also the cdc25-5 mutation carried by strain OL86 (Camonis et al., 1986), as well as a cdc25 deletion/disruption in the strain JCL300-3A. These findings rule out the possibility that the pCDC25/12 encoded protein might work by interacting with a mutated CDC25 protein. We obtained similar results after subcloning the mouse cDNA insert in a centromeric plasmid (Table I). pCDC25/12 transformants grew as well as strains expressing or overexpressing the budding yeast CDC25 gene (data not shown). TC7(pCDC25/ 12) transformants were checked for phenotypes associated with deregulated adenylyl cyclase and protein kinase activity, namely lack of glycogen accumulation and increased heat shock sensitivity. Only a moderate reduction of glycogen accumulation as detected by iodine staining of stationary phase cell patches and of heat shock resistance was observed in cells transformed with the mouse cDNA (data not shown). These phenotypes are much more pronounced in RAS2val9 (Toda et al., 1985) and bcyl mutants (Matsumoto et al., 1983) or in strains overexpressing the RAS activating domain of the S.cerevisiae SDC25 gene (Damak et al., 1991). Using the cloned cDNA as a probe, we isolated other clones from the same cDNA library by colony hybridization. Most of them were quite similar to pCDC25/12 as demonstrated by restriction analysis and size of cDNA insert: one of these clones called pCDC25/17 was significantly larger, containing a cDNA insert of 1700 nt. Also the pCDC25/17 plasmid was able to complement the cdc25-1 mutation in TC7 strain and a CDC25 disruption in JCL300-3A strain (Table I) and the phenotype of transformed strains was identical to that of pCDC25/12 transformants (not shown). -

Table I. Plasmid pCDC25/12 and a centromeric derivative complement mutations in CDC25 but not in genes acting downstream in the adenylyl cyclase pathway Relevant genotype

Plasmid

TC7 TC7 TC7 TC7 TC7 OL86 OL86 JCL300-3A JCL300-3A

cdc25-1ts cdc25-Its cdc25-SIs cdc25-Its cdc25-Its cdc25-5ts cdc25-5ts cdc25::HIS3 cdc25::HIS3

pGR56 pCDC25/12 YCplac33 YCplac33/12 pCDC25/17 pGR56-L pCDC25/12-L

NA NA NA NA NA NA NA

JCL300-3A

cdc25::HIS3 cdc25::HIS3

35-971/3C 35-971/3C 112-694 112-694

cdc35-1Ots cdc35-lOts ras2::HIS3

YEp-CDC25 YEp-CDC25 +pCDC25/12 pCDC25/12 pCDC25/17 pGR56 pCDC25/12 pGR56 pCDC25/12

Strain

ras2::HIS3

Growth condition +ura/-leu -ura/ -leu

-ura/ +leu

240C

370C

Glucose

Glyc/EtOH

NA NA NA NA NA NA NA +

+ + + + + + +

-

+ +

NA NA NA NA NA NA NA +

NA NA

+ + + NA NA

NA NA NA NA NA NA NA NA NA

NA NA NA NA NA NA NA NA NA

NA NA NA NA

NA NA NA NA

+ + NA

NA NA + + NA NA

NA NA NA NA

NA NA NA NA + +

NA NA NA NA

NA NA NA

+

Growth of transformed strains (four independent transformants) was scored on minimal plates under appropriate selective conditions of temperature, nutrient or carbon source. In the case of the cdc25::HIS3 strain a plasmid swapping experiment was performed as described in Materials and methods. NA (not appropriate) indicates that the given selective condition was not appropriate for the strain/plasmid combination.

21 52

,1

Mouse cDNA complements CDC25 in yeast

Sequence analysis of the mouse brain cdc25 suppressor cDNAs Figure 1 shows the restriction map, nucleotide and deduced amino acid sequence derived from the pCDC25/12 and pCDC25/17 inserts. The pCDC25/17 insert contains 1685 bp. The most 5' ATG is at position 43. The open reading frame (1416 bp) encodes a protein of 472 residues (Mr 54 131). A putative polyadenylation site is found 191 base pairs downstream of the TGA stop codon. The pCDC25/12 insert (1238 bp) is a truncated version of the pCDC25/17 sequence starting at nucleotide 447. Since the first methionine of pCDC25/12 is in position 598 a shorter protein (287 aa) is encoded by this cDNA. A Northern blot analysis on mouse brain polyadenylated RNA shows the presence of two principal mRNAs of 1700 and 5200 nt (Figure 4). On this basis and also considering that the first ATG (at position 43) contains a good translational consensus (Kozak, 1986) it is likely that our pCDC25/17 clone represents a cDNA copy of the smaller mRNA. Comparison of the protein predicted by translating the mouse sequence with the SwissProt data base using the FASTA algorithm revealed a strong homology (34.2% identity in a 234 amino acid overlap) with the carboxy terminal part (residues 1310-1545) of the CDC25 protein (Camonis et al., 1986; Broek et al., 1987). Considering conservative replacements, homology increases up to 76%. Significant homologies were also detected with the S. cerevisiae SDC25 (26.1 % identity over a 357 aa overlap), LTE1 (21.7% identity over a 249 aa overlap) and BUD5 (25.4% identity over a 169 aa overlap) proteins, the S.pombe ste6 protein (30.8% over a 234 aa overlap) and the Sos protein of Drosophila (30% over a 302 aa overlap), all belonging to the same protein family. A multiple alignment of the mouse protein with S. cerevisiae CDC25 and SDC25, S.pombe ste6 and Drosophila Sos proteins is shown in Figure 2. The close similarity of hydropathy profiles (not shown) also points to a close structure conservation between the mouse and S. cerevisiae proteins. In particular, the mouse protein also shows a large hydrophobic region (residues 383 -398) which is conserved among all CDC25-like proteins. Since the pCDC25/17 mouse cDNA can provide the function of S. cerevisiae CDC25 and because of the high sequence homology with the budding yeast gene, we will refer to its encoding gene as CDC25Mm to indicate its Mus musculus origin. -

Glucose induced stimulation of cAMP The above presented results suggest that the mouse cDNA clones are able to replace the CDC25 function. This hypothesis was further confirmed by the finding that the cAMP levels in cdc25::HIS3 (pCDC25/12) and cdc25::HIS3 (pCDC25/17) transformants were very similar to those found in the same strain transformed with the yeast CDC25 gene (5.3, 4.9 and 4 pmol cAMP/mg protein, respectively). Addition of glucose to glucose-starved yeast cells induces a rapid and transient increase of intracellular cAMP levels. This response is mediated by CDC25/RAS signal transduction pathway and is abolished in CDC25 disrupted strains (Mbonyi et al., 1988, 1990; Van Aelst et al., 1990, 1991). As shown in Figure 3 yeast cells bearing a cdc25::HIS3 disruption and transformed with the pCDC25/12 or with pCDC25/17 plasmids are able to respond properly to glucose addition with a fast increase of intracellular cAMP. The same

lOO bp

PvuU

PO

2

HindlIl

SCW

PvoII

IN N N N N N N N N N N N N N N N N N N N N NIN N N N N N N N N N N IN NHl S Pl

wullueeeeeeSeeevll

Ie eeeeeeeeeeeeeeeeeeeeeeeeeeeeeee 1.

---YME

TCTCCCTTCGGCAAAACCACACTGGACACTCCCAAGCTCTGT CCC AAG ACT CCA GAG GAG ATT GAT GTG Ala Ser Sor Lou Pro Lys Thr Pro Glu Glu Ile Asp Val CCT GCC ACG ATT CCA GAG MG CCT CCC GAG CTC TCA CCC TCC Pro Ala Thr II. Pro Glu Lys Pro Gly Glu Leu S*r Ala SOr AGG MG CA? AGC TCT GAT GTC CTG AMA GMA GAG TCC GAG GAT Arg Lys His SOr Sor Asp Val Lau Lys Glu Glu Ser Glu Asp (~aC AAt- ~ AC? GA? GA~ GAC AAC ACA GA GTG TCA CCA Asp Gln Asn His SOr Asp Glu Asp Asn Thr Clu Val Sr Pro CTT MA TCC CCA CCA ACA CCA AMA TCG TTC TTA AAC AMA ACC Val Lys SOr Pro Pro Thr Pro Lys SOr Phe Leu Asn Arg Thr ATT ACA GAG TTT CCA TTC TT AAC TAC AAC AAT GGA ATC CTG Ile Thr Clu Ph. Pro Phs Ph* Asn Tyr Asn Asn Cly Ile Lou ATC ACC AC TCS CCT GAT CTC CSC GAC AAT AAC CCC ACC ACT Het Thr Thr Cys Arg Asp Lou Va1 Asp Asn Asn Arg Sor Thr CTC TCA OCT ACT TCT OCC mTT cCC ATA Cc ACMT CA GtA GCC Leu SOr Ala Thr Ser Ala Ph. Ala Ile Ala Thr Ala Cly Ala AAT GMACCC CCC TCA AAC AM GAG GTG TT? CGA MG ATC TCT Asn Glu Cly Pro SOr Asn Lys Glu Val Phe Arg Arg Het SOr TTCG CC AMC MCA GCC T TCC TCT GAC CAG AMA AT ATC GAC Lou Ala Asn Thr Gly Ph. SOr Ser Asp Gln Arg Asn Ile Asp AMG GAG TT CTC ATC CCC AMA CCT CCC MC MAT CC? GCT CTG Lys Clu Ph. Va1 II Arg Arg Ala Ala Thr Asn Arg Va1 Lau MT CGC CTC CCC CAC TGG GTC ACC MG CAC ACC CAG GAC STT Asn V.1 lau Arg His Trp V.1 Thr Lys His Thr Gln Asp Ph. GAT ACC CAC Gca AG CTC MA TAC AMG CTC ATC TCG STC CTG Asp Thr Asp Asp Thr lau Lys Tyr Arg Va1 II Cys Ph. Lau GAG GAG CTC ATC CAT GAC CCA GAC C?T CTC ACC CAA GAG CGA Glu Glu VAKEWHis Asp Pro Asp Lou lAu Thr Gln Glu Arg AM CCCA CA CCC AAC A?C ATC AMG ACT CTG ACC CTA GAA GAA Lys Ala Ala Ala Asn Ile Ie1 Arg Thr lAu Thr Lou Glu Glu ACA CT GMA CAA CA? AMC ATC CTC GMA GAA CTC ATA CTG ATG Thr Thr Glu Gln His SOr Het Lou Glu Glu Va1 Ie lau met ACC GAG CC? CTC MG ACT GAG CCC TTC GAA MC CAC CCA GCC Thr Glu Cly Va1 Lys Thr Glu Pro Phe Glu Asn His Pro Ala CTC GAG ATA GCA GAG CAG CTG ACC C?C CTG GAT CAC CTT CTC Lou Glu II Ala Glu Gln lau Thr lau Lau Asp His lau Va1 TTC MC ACT A?? CCT TAT GMA GAG STC TT? GGC CAG GGC TGG Ph. Lys SOr Ile Pro Tyr Glu Glu Ph. Ph. Gly Gln Gly Trp ATG AMC CC GAG MG TAT GMA AGG ACA CCT TAC ATT ATG AAA Hot Lys Ala Glu Lys Tyr Glu Arg Thr Pro Tyr Ile Hot Lys ACC ACC MA CAC TTMCM CA? CTC AG? MC STC ATT CCT TCA Thr Thr Lys His Ph. Asn His Va1 Ser Asn Ph. I1 Ala Ser GAA ATT ATC CGA MC GAG GAC ATC AGC CCA AMG GCA AGC GCC Glu Ile I1- Arg Asn Glu Asp I1 Sar Ala Arg Ala SOr Ala ATC GAG M CGG CTG OCT CT? GCC GAC ATA TCT CCC TGC CTC Ile Glu Lys Trp Va1 Ala Va1 Ala Asp I1- Cys Arg Cys Lou CAC AMC TAC MT GCT CTG CTG GAG ATC ACC TCC TCC ATC AAC His Asn Tyr Asn Ala Va1 lau Glu I1 Tbhr Ser Ser Ile Asn CCC AGC CCC ATC STC CCT CTC MA MG ACA TGG CTC AMA CTT Arg Ser Ala I. Phe Arg Lou Lys Lys Thr Trp Lau Lys Va1 TCT MG CAG ACG AAA TCT TTG CTT GAC MG CTC CAA AAG CTT SOr Lys Gln Thr Lys Sar Lou Lau Asp Lys Lou Cln Lys Lou CTG TCA TCA GAT GGC ACA TTT AAC AAC CTC AGA GAG TCT TTG Val Sar Ser Asp Cly Arg Ph. Lys Asn Lau Arg Glu S-r Lou AMA MT TGT GAT CCA CCC TGT CTC CCT TAC CTG GGG ATG TAT Arg Asn Cys Asp Pro Pro Cys Val Pro Tyr Leu Gly Met Tyr CTC ACC GAC STG CTG TTC ATC GAG GAG GGG ACA CCC AAT TAC lau Thr Asp Lau Va1 Ph. II- Glu Glu Gly Thr Pro Asn Tyr ACA GAG GAC CCC CC CTC AAC TTC TCC AAG ATG AGA ATG ATC Thr Glu Asp Gly Lau Va1 Asn Phe Ser Lys Met Arg Met Ile TCC CAT ATT ATC CGA GAG ATT CGC CAG TTT CAG CAG ACT ACC Sar His Ile Ile Arg Glu IIl Arg Gln Phe Gln Gln Thr Thr TAC AAA ATC GAC CCC CAG CCA AAG GTA ATT CAG TAC TTA CTG Tyr Lys I1 Asp Pro GIn Pro Lys Va1 Ile Gln Tyr Leu Leu GAT GAA TCT TTC ATG TTG GAC GAA GAA AGC CTG TAT GAG TCT Asp Glu Sar Phe N.t Leu Asp Glu Glu Ser Leu Tyr Glu Ser TCG CTC CTA ATC GAA CCA AAA CTC CCC ACATGAGGCTGTTCTCCCC S.r Lou Lau Ile Glu Pro Lys Lou Pro Thr

A=G CCC AGC AGC TTA

ACCCACTGGCACCGCAGCGTAACGCCAGCTGCCCCCCAGCTGCTTCTGTGAACAC CTGCTTTACGATTATTGTATATAATCGTCGCGTGCCTCTGTACTTGTTCTCCACC GTGTCGCTTCCCCGAGAATATATTATCTCTTCCTTGTCCCGTAAAACCGAAATACA

MTGTCTGCACTCAAA&TAAGATGTCTGCACTCTCAAMAAAAAAA

42

64 14 126 28

166 42 210 56 252 70 294

.4 336

378 112 420 126 462 140 504 154 546

166 5.. 162 630 196 672 210 714 224 756 238 798 252 840 266

682 280 924 294 966 308 1008 322 1050 336 1092 350 1134

364 1176 378 1218 392 1260 406

1302 420 1344 434 1386 448 1428 462 1474 478 1529 1584 1639 1685

Fig. 1. Restriction map, nucleotide and deduced amino acid sequence of mouse CDC25 homologue cDNAs. The white arrows indicate the open reading frame. The circle represents the first ATG present in the pCDC25/12 plasmid. The nucleotide sequence was numbered in the 5' to 3' direction beginning with the first sequenced nucleotide. The most 5' ATG was assigned as the site of translation initiation and is underlined. The deduced amino acid sequence is numbered at the right end of each line, beginning with the first methionine (shown in bold). The sequence complementary to an 18mer oligonucleotide used as a primer for the preparation of a single strand DNA probe is underlined. The putative polyadenylation signal is shown by a double underline. Clone pCDC25/12 started at nucleotide 447. The encircled methionine identifies the beginning of the ORF encoded by the shorter pCDC25/12 clone. The sequence has been deposited in EMBL data library under the accession number X59868.

2153

E.Martegani et al. ..

z-.akie1'.:A .-%

&F

*r'

#.

i

>....

A

1

1E.r

T.

i ;

-Y>

..

2

RN

!E

9

s

P P.

[i

-. W:

AT

r ,: f,

;2

X F! 3

F

-

*z;8 ~ f M _ z ii B js3 ~ ~a

.w 2

!:

'!

2,

7 SI f2.

VAl."

- 4

*;

,.

:'

{_, .;

~

~

~

~

~ ~

t

E SEBTR)DI .Ys:Bobrlswy

^

: ' 5}-'u:K w .. !>T

H .4

4

W-iF

.:j .:

rs

15;

_

T k\,

4 #

: R ! '.- 1' t. \ .9 ,}VI' 2~

-; s1+

:

k

>.,

'. g

:zi

.-DC 2

w ;; i

h,.

2'

3wtil;g J6j2*{YXE44 A~~ ~ ~ ~~~~~~~, A:DD T - H MiH 1I! lk

P

y

t!

.E .>'

L,411 ^:

1::

;

Fig. 2. Multiple alignment of CDC25-like proteins from mouse, budding and fission yeast. The predicted proteins encoded by CDC25M?11, S.cerevisiae CDC25 and SDC25, Spombe ste6, Drosophila sos genes were aligned using the Pileup program from GCG. Residue numbers are shown on the right of each line. Equivalence was ranked using the scoring table of Schwartz and Dayhoff (1979) as modified by Griskov and Burgess (1986). Residue pairs with a score higher than 1.0 and conserved in three or more proteins are shown in black boxes.

result was obtained with other independently isolated cdc25::HIS3 transformants (not shown). Although the extent of stimulation is lower in comparison with that observed in the same strain transformed with the S.cerevisiae CDC25 gene on a multicopy plasmid, this experiment demonstrates that a mouse protein can substitute the yeast CDC25 protein in most of its specific function, being able to restore normal cAMP levels and to transduce the glucose induced signal. Activation of yeast adenylyl cyclase A more direct proof of the biochemical activity of the product of CDC25Mm would be obtained by testing the ability of the mouse protein to activate adenylyl cyclase in an in vitro system on purified yeast membranes. In collaboration with Drs Eric Jacquet and Andrea Parmeggiani, we started the biochemical characterization of 2154

the product of CDC25Mm. Small amounts of CDC25Mm protein were obtained in the form of a fused protein between glutathione S-transferase (GST) and the 286 amino acids encoded by pCDC25/12 cDNA expressed in Escherichia coli cells. The fusion protein was purified on glutathioneSepharose resin and used for in vitro assays. Reconstitution experiments with membranes prepared from a rasi ras2 yeast F 1D strain were undertaken, in which adenylyl cyclase activity was determined in the absence and in the presence of added RAS2 protein with fused GST-CDC25Mm and GST alone. As shown in Figure 4 the presence of exogenously added RAS2 protein the GST -CDC25Mm fusion protein is able to activate fully adenylyl cyclase (i.e. to the same level obtained in the presence of Mn2 + ions). These results suggest that the CDC25Mm protein is acting through RAS.

~

Mouse cDNA complements CDC25 in yeast

c

.5

0

Is

0)

E

E.

0.

0 _1

~M

t

-

0

2

4

6

8

| B_ QK_-

Wk.."

Time (min) Fig. 3. Glucose-induced cAMP signalling in JCL300-3A transformants. Glucose (100 mM, final concentration) was added at zero time to starved cells. (O) JCL300-3A (YEp-CDC25); (0) JCL300-3A (pCDC25/12); (A) JCL300-3A (pCDC25/17); (A) JCL300-3A

(pRAS2Ie152).

Expression of CDC25Mm in mammalian tissues Expression of CDC25Mm in mouse brain and in other different tissues (heart, spleen and liver) was analysed by Northern blotting. Probing the blot with an antisense radioactive RNA showed two major hybridizing bands of ca. 1700 and 5200 nucleotides, respectively in mouse brain (Figure 5, lane 1). Identical results were obtained by using as a probe either the whole CDC25Mm cDNA labelled by random priming or a single-strand DNA antisense probe corresponding to the first 200 nt labelled with [_y-32P]dCTP (data not shown). The bands were particularly intense in brain, but a good signal was observed also in the heart. While the 1700 nt mRNA was the predominant species present in all the tested tissues, the larger mRNA was present mainly (if not only) in the brain. Whether this large mRNA is the result of an alternative splicing process or encodes a closely related protein will require further study.

*Say

Fig. 4. Ecoli purified GST-CDC25M.. stimulates adenylyl cyclase in purified yeast membranes in a RAS-dependent manner. The adenylyl cyclase activity was determined after 15 min incubation at 30°C. Adenylyl cyclase activity was normalized to activity assayed in the presence of 1 mM Mn2 . Control refers to intrinsic activity measured in the absence of exogenously added proteins.

I

4

--%

I h.-

34

I.'o.,

Discussion We have identified by both functional and structural criteria cDNA that may encode the mouse equivalent of S. cerevisiae CDC25. The CDC25Mm cDNA is highly homologous to its budding yeast counterpart in a region spanning the catalytic domain and can fully replace the CDC25 function: in fact it suppresses cdc25 mutations, is able to restore cAMP levels, to transduce glucose induced signalling to adenylyl cyclase in vivo and to activate in vitro adenylyl cyclase in yeast membranes in a RAS-dependent manner, suggesting that this protein could have an intrinsic Ras -guanine nucleotide releasing activity. S. cerevisiae CDC25 is a 1589 residue protein (Camonis 180 kDa (Garreau et al., 1986; Broek et al., 1987) of et al., 1990; Vanoni et al., 1990; Jones et al., 1991). Deletion and homology analyses with CDC25-like proteins have restricted the minimal catalytic domain to a region beginning between residues 1211 and 1253 and terminating at residues 1550 (Camonis et al., 1986; Martegani et al., 1986a; Schomerus et al., 1990; Damak et al., 1991). The homology between mouse and S. cerevisiae CDC25 proteins encompasses residues 1310- 1541. Interestingly, the homology of the S.pombe ste6 protein with CDC25 spans almost exactly the same residues, the overall identity between

a

Fig. 5. Northern blot of mouse CDC25Mm expression in mouse tissues. Poly(A)+ RNA extracts from brain (1), heart (2), liver (3) and spleen (4) was separated by formaldehyde agarose gel electrophoresis. About 4 tg of RNA were loaded on lanes 1-4. Positions of 28S and 18S RNAs are indicated. The filters were probed with the in vitro transcribed RNAs. The filter was exposed for 6 h.

the budding and fission yeast proteins (34.4% over 270 residues) being very similar to that between the mouse and S. cerevisiae proteins (Hughes et al.,, J 990). Thus our data pinpoint further the essential catalytic domain of CDC25-like proteins to an even smaller region. A membrane bound ras-specific GNRP has been purified recently from bovine brain (Huang et al., 1990). The exchange factor has a molecular weight of 35 000 a value even smaller to that predicted for the CDC25Mm encoded protein (54 kDa). The factor may form a complex with other yet unidentified protein(s) since gel electrophoresis of this factor and of a similar, soluble factor isolated from rat brain, gave a molecular weight between 100 000 and 160 000 (Huang et al., 1990; Wolfman and Macara, 1990). Ancillary factor(s) might play a role homologous to that of the NH2 domain of yeast SDC25, which has a negative regulatory effect blocking its cdc25 complementing activity. Such a 2155

E.Martegani et al.

domain may interact with specific effectors and/or modulate the guanine nucleotide releasing activity. If this was the case the yeast protein would be a fusion in a single polypeptide of catalytic and regulatory proteins. CDC25 has been proposed to work as a detector responding to nutrients and metabolic signals, interacting with RAS and adenylyl cyclase proteins to form a signalling system homologous to the j3-adrenergic receptor/G protein/cyclase system in mammalian cells (Levitzki, 1988). Recent evidence, however, suggests that CDC25 is not the actual receptor, but that it may act as an integrator device for several signals (Thevelein, 1991). The long NH2 domain may be at least partially responsible for regulating CDC25 activity, by analogy with the NH2 moiety of SDC25 (Damak et al., 1991; Frascotti et al., 1991). Nevertheless both of the parts responsible for interaction with the glucose receptor and with RAS appear located within the COOH-terminal third of the molecule (Van Aelst et al., 1990). Our results with CDC25Mm are consistent with this view of the CDC25 molecule: also, the truncated mouse protein encoded by pCDC25/ 12 clone, which is even noticeably smaller than the truncated yeast version, can reconstruct a functional signal transmission pathway, suggesting that it could interact not only with RAS, but probably with the glucose receptor as well. This finding suggests that some structural features of the receptor may have been conserved throughout evolution, though possibly merged in a molecule playing a different physiological function. The presence of a regulatory domain within the COOH moiety may explain why E. coli expressed CDC25 does not catalyse GDP/GTP exchange on RAS, while the corresponding SDC25 portion does (Crechet et al., 1990b). Analysis of conserved regions in CDC25 like proteins will allow to test experimentally their role in GNRP structure and function. Such an analysis will eventually improve our understanding of vertebrate ras proteins in signal transduction and oncogenic transformation.

Materials and methods Yeast strains, media and genetic manipulations The yeast strains used in this study are TC7 (MATai ade lys trpl ura3 cdc25-1) (Martegani et al., 1986a), OL86 (MATa ade2 leu2 Irpi cdc25-5) (Camonis et al., 1986), JCL300-3A (MATa ade leu2 hys3 lysi trpi ura3 cdc25::HIS3 (Damak et al., 1991), 35-971/3C (MATa ura3, leu2, trpl, ade, cdc35-10) (Boutelet et al., 1985; obtained from M.Jacquet) and 112-694 (MATat leu2 ura3 ade2 his3 canl ras2::His3) (Tatchell et al., 1985; obtained from D.Breviario); FID (MATa ade2 can -100 CR14 his3 leu2-3,112 lysl-l ras:: URA3 ras2::LEU2 ura3-53) (De Vendittis et al., 1986). The strain JCL300-3A is made viable by the presence of the YEp-CDC25 plasmid (LEU2 based) (Damak et al., 1991). Liquid and solid media were prepared as described previously (Martegani et al., 1986a,b; Sherman et al., 1986). Yeast transformation was carried out using the spheroplast method (Martegani et al., 1986a) for library screening and lithium chloride method for purified plasmids (Ito et al., 1983). Plasmid replacement experiments were carried out as follows: strain JCL300-3A made viable by the presence of the plasmid YEp-CDC25 which carries the S.cerevisiae CDC25 gene, was transformed with plasmids pCDC25/12 or pCDC25/17 and grown for several generations in leucine containing minimal medium to induce loss of the LEU2 based YEp-CDC25 plasmid. Plasmid loss was verified by restriction analysis of plasmid extracted from leucine requiring clones.

Cloning, sequencing and analysis of CDC25Mm cDNA Standard methods were used for plasmid construction and purifications (Sambrook et al., 1989). A mouse brain cDNA bank was constructed in the BstXI site of the yeast expression vector pGR56 (2 sm ori, URA3) using the LibrarianTM cDNA cloning system (both obtained from Invitrogen).

2156

Poly(A)+ RNA was isolated from mouse brain (nude mice of Swiss strain) using the Fast TrackTM kit (Invitrogen) according to manufacturers' instructions. Over 2 x 105 independent bacterial clones with an average insert size of 1.5-2 kb were obtained. Colony hybridization was performed according to standard methods (Sambrook et al., 1989). Plasmid YCplac33/12 was constructed by subcloning the pCDC25/12 cDNA insert into the centromeric vector YCplac33 (Gietz and Sugino, 1988; kindly provided by R.Gietz). Plasmids pGR56-L and pCDC25/12-L are LEU2 derivatives of pGR56 and pCDC25/12, respectively, obtained by subcloning a YEp13 derived BglII LEU2 fragment into the unique NcoI site of the plasmid after filling cohesive ends of both plasmid and insert with the Klenow fragment of DNA polymerase. The complete nucleotide sequence of CDC25M"1 cDNA was determined on both strands using the dideoxy chain termination method with T7 DNA polymerase (Tabor and Richardson, 1987). Subclones for sequencing were generated by progressive deletion with ExonucleaseIII/S nuclease (Henikoff, 1984) in pUC19 plasmid. The sequence was deposited i} the EMBL Data Library with the accession number X59868. The CDC25m deduced amino acid sequence was compared with SwissProt database using FASTA algorithm (Lipman and Pearson, 1985) and the EMBL facilities. Multiple sequence alignment was done with the Pileup program from the GCG package (Genetics Computer Group, Inc.) Expression and purification of a GST - CDC25Mm fusion protein Plasmid pCFI was constructed by subcloning a 1000 bp NsiI-AvaI fragments, blunted with T4 DNA polymerase from plasmid pCDC25/12 in the SmaI site of pGEX2T (Smith and Johnson, 1988). The resulting plasmid carrying an in-frame fusion between GST and CDC25M` ORF was used to transform E.coli JM101. Fusion protein expression was induced with 0.1 mM IPTG for 1.5 h. The GST-CDC25Mn' protein was purified using glutathione-Sepharose beads as described (Smith and Johnson, 1988). The fusion protein was concentrated by ultrafiltration and stored in 50 mM Tris pH 7.6, 5 mM MgCl2, 100 mM KCI and 50% glycerol at -20°C. cAMP assay Cellular extracts were obtained as described previously (Martegani et al., 1986b). Time-course measurements of cAMP level were performed as described previously (Frascotti et al., 1991) after addition of 100 mM glucose (final concentration) to glucose starved cells. The cAMP content was determined using the Amersham [3H]cAMP radioassay kit, following the recommended procedure. Protein concentration was determined using the BCA Protein Assay Reagent (Pierce) with bovine serum albumin as a standard. Adenylyl cyclase activity Adenylyl cyclase activity was determined by measuring the cAMP production at 30°C (Crechet et al., 1990a). Total membrane extracts (20 Ag) from yeast strain F1D were prepared as described (De Vendittis et al., 1986; Crechet et al., 1990a). Yeast RAS2 protein was provided from E.Jacquet and A.Parmeggiani (Laboratoire de Biochimie, Ecole Polytechnique, Palaiseau, France) RAS2 was added at a final concentration of 0.3 ;&M, GST and GST-CDC25M"' at 100 Ag/m1. Northern blot analysis Polyadenylated RNA was extracted from mouse tissues using the Fast TrackTM kit (Invitrogen). RNA was denatured and separated on agarose-formaldehyde gels. After electrophoresis RNA was blotted on Hybond-N filters (Amersham). Single-stranded RNA probes were obtained by cloning the mouse pCDC25/12 cDNA in pGEM-7Zf(+) vector. The resulting plasmid was linearized by cutting with PstI. Labelled anti-mRNA was transcribed with SP6 RNA polymerase in the presence of [c-32P]UTP (Melton et al., 1984). A single stranded DNA probe was prepared by primer extension (Sambrook et al., 1989) using an antisense oligonucleotide corresponding to the region 170-187 of the pCDC25/17 cDNA (underlined in Figure 2). The filters were prehybridized in 5 x Denhardt's solution, 10% dextran salmon sperm DNA, 200 Lg/ml tRNA at sulfate, 5 x SSPE, 100 42°C for 6 h, then hybridized overnight in the same solution with 106 c.p.m./mI of the probe. The final washing of the filters was with 0.1 x SSPE, 0.1% SDS for 15 min at 45'C.

Asg/mI

Acknowledgements The authors wish to thank Michel Jacquet, Diego Breviario and R.Geitz for strains and plasmids. We are gratefully indebted to Andrea Parmeggiani and Eric Jacquet for

Mouse cDNA complements CDC25 in yeast providing yeast membrane preparations and helping us in adenylyl cyclase assay. This work was supported by grant n.91.02445.CT14 from Italian C.N.R., Project Molecular Mechanism of Signal Transduction, and by a grant from Italian Association for Cancer Research (AIRC). C.F. is supported by an AIRC fellowship.

References Ballester,R., Michaeli,T., Ferguson,K., Xu,H.-P., McCormick,F. and Wigler,M. (1989) Cell, 59, 681-686. Barbacid,M. (1987) Annu. Rev. Biochem., 56, 779-827. Bourne,H.R., Sanders,D.A. and McCormick,F. (1991) Nature, 349, 117-127. Boutelet,F., Petitjean,A. and Hilger,F. (1985) EMBO J., 4, 2635-2642. Broach,J. and Deschenes,R.J. (1990) Adv. Cancer Res., 54, 79-139. Broek,D., Toda,T., Michaeli,T., Levin,L., Birchmeier,C., Zoller,M., Powers,S. and Wigler,M. (1987) Cell, 48, 789-799. Camonis,J.H., Kalekine,M., Bernard,G., Garreau,H., Boy-Marcotte,E. and Jacquet,M. (1986) EMBO J., 5, 375-380. Chant,J., Corrado,K., Pringle,J.R. and Herskowitz,I. (1991) Cell, 65, 1213-1224. Crechet,J.B., Poullet,P., Camonis,J., Jacquet,M. and Parmeggiani,A. (1990a) J. Biol. Chem., 265, 1563-1569. Crechet,J.B., Poullet,P., Mistou,M.Y., Parmeggiani,A., Camonis,J., Boy-Marcotte,E., Damak,F. and Jacquet,M. (1990b) Science, 248, 866-868. Damak,F., Boy-Marcotte,E., Le-Roscouet,D., Guibaud,R. and Jacquet,M. (1991) Mol Cell. Biol., 11, 202-212. DeFeo Jones,D., Tatchell,K., Robinson,L.C., Sigal,I.S., Vass,W.C., Lowy,D.R. and Scolnick,E.M. (1985) Science, 228, 179-183. De Vendittis,E., Vitelli,A., Zahn,R. and Fasano,O. (1986) EMBO J., 5, 3657-3663. Feig,L.A. and Cooper,G.M. (1988) Mol. Cell. Biol., 8, 2472-2478. Frascotti,G., Coccetti,P., Vanoni,M.A., Alberghina,L. and Martegani,E. (1991) Biochem. Biophys. Acta, 1089, 206-212. Garreau,H., Camonis,J., Guitton,C. and Jacquet,M. (1990) FEBS Lett., 269, 53-59. Gibbs,J.B., Schaber,M.D., Marshall,M.S., Scolnick,E.M. and Sigal,I. (1987) J. Biol. Chem., 262, 10426-10429. Gietz,R.D. and Sugino,A. (1988) Gene, 74, 527-534. Gribskov,M. and Burgess,R.R. (1986) Nucleic Acids Res., 14, 6745 -6763. Henikoff,S. (1984) Gene, 28, 351-359. Huang,Y.K., Kung,H. and Kamata,T. (1990) Proc. NatI. Acad. Sci. USA, 87, 8008-8012. Hughes,D.A., Fukui,Y. and Yamamoto,M. (1990) Nature, 334, 355-357. Ito,H., Fukuda,Y., Murata,K. and Kimura,A. (1983) J. Bacteriol., 153, 163-168. Jones,S., Vignais,M.-L. and Broach,J.R. (1991) Mol. Cell. Biol., 11, 2641-2646. Kataoka,T., Powers,S., Cameron,S., Fasano,O., Goldfarb,M., Broach,J. and Wigler,M. (1985) Cell, 40, 19-26. Kozak,M. (1986) Cell, 44, 283-292. Levitzki,A. (1988) Trends Biochem. Sci., 13, 298-301. Lipman,W.J. and Pearson,W.R. (1985) Science, 227, 1435-1441. Martegani,E., Baroni,M.D., Frascotti,G. and Alberghina,L. (1986a) EMBO J., 5, 2363-2369. Martegani,E., Baroni,M. and Vanoni,M. (1986b) Exp. Cell. Res., 162, 544-548. Matsumoto,K., Uno,I. and Ishikawa,T. (1983) Exp. Cell. Res., 146, 151- 161. Mbonyi,K., Beullens,M., Detremerie,K., Geerts,L. and Thevelein,J.M. (1988) Mol. Cell. Biol., 8, 3051-3057. Mbonyi,K., Van Aelst,L., Arguelles,J.C., Jans,A.W.H. and Thevelein,J.M. (1990) Mol. Cell. Biol., 10, 4518-4523. Melton,D.A., Krieg,P.A., Rebagliati,M.R., Maniatis,T., Zinn,K. and Green,M.R. (1984) Nucleic Acids Res., 18, 7035-7056. Powers,S., O'Neil,K. and Wigler,M. (1989) Mol. Cell. Biol., 9, 390-395. Powers,S., Gonzales,E., Christensen,T., Cubert,J. and Broek,D. (1991) Cell, 65, 1225-1231. Robinson,L.C., Gibbs,J.B., Marshall,M.S., Sigal,I.S. and Tatchell,K. (1987) Science, 235, 1218-1221. Russel,P. and Nurse,P. (1986) Cell, 45, 781-782. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schomerus,C., Munder,T. and Kuntzel,H. (1990) Mol. Gen. Genet., 223, 426-432.

Schwartz,R.M. and Dayhoff,M.O. (1979) In Dayhoff,M.O. (ed.), Atlas of Protein Sequence and Structure. National Biomedical Resource Foundation, Washington, D.C., pp. 353-358. Sherman,F., Fink,G.R. and Hicks,J.B. (1986) Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sigal,I.S., Gibbs,J.B., D'Alonzo,J.S., Temeles,G.T., Wolanski,B.S., Socher,S.H. and Scolnick,E.M. (1986) Proc. Natl. Acad. Sci. USA, 83, 952-956. Simon,M.A., Bowtell,D.D.L., Dodson,G.S., Laverty,T.R. and Rubin,G.M. (1991) Cell, 67, 701-716. Smith,D.B. and Johnson,K.S. (1988) Gene, 67, 131-133. Tabor,S. and Richardson,C.C. (1987) Proc. Natl. Acad. Sci. USA, 84, 5463 -5467. Tanaka,K., Nakafuku,M., Satoh,T., Marshall,M.S., Gibbs,J.B., Matsumoto,K., Kaziro,Y. and Toh-e,A. (1990) Cell, 60, 803-807. Tatchell,K.L., Robinson,L.C. and Breitenbach,M. (1985) Proc. Natl. Acad. Sci. USA, 82, 3785-3789. Thevelein,J.M. (1991) Mol. Microbiol., 5, 1301-1307. Toda,T., Uno,I., Ishikawa,T., Powers,S., Kataoka,T., Broek,D., Cameron,S., Broach,J., Matsumoto,K. and Wigler,M. (1985) Cell, 40, 27-36. Van Aelst,L., Boy-Marcotte,E., Camonis,J., Thevelein,J.M. and Jacquet,M. (1990) Eur. J. Biochem., 193, 675-680. Van Aelst,L., Jans,A.W.H. and Thevelein,J.M. (1991) J. Gen. Microbiol., 137, 341-349. Vanoni,M., Vavassori,M., Frascotti,G., Martegani,E. and Alberghina,L. (1990) Biochem. Biophys. Res. Commun., 172, 61-69. Walter,M., Clark,S.G. and Levinson,A.D. (1986) Science, 233, 649-652. Wickner,R.B., Koh,T.J., Crowley,J.C., O'Neil,J. and Kaback,D.B. (1987) Yeast, 3, 51-57. Wolfman,A. and Macara,I.G. (1990) Science, 248, 67-69. Received on Januarv 8, 1992; revised on February 18, 1992

2157