Identification of Amino Acid Residues in Streptococcus mutans

JOURNAL OF BACTERIOLOGY, Aug. 1994, p. 4845-4850

0021-9193/94/$04.00+0 Copyright © 1994, American Society for Microbiology

U4'D5671K9

Vol. 176, No. 16

Identification of Amino Acid Residues in Streptococcus mutans Glucosyltransferases Influencing the Structure of the Glucan Product ATSUNARI SHIMAMURA,1 YOSHIO J. NAKANO,1t HIDEHIKO MUKASA,2

AND

HOWARD K. KURAMITSUl*

Department of Oral Biology, State University of New York, Buffalo, New York 142141 and Department of Chemistry, National Defense Medical College, Saitama 359, Japan2 Received 2 February 1994/Accepted 2 June 1994

The glucosyltransferases (GTFs) of mutans streptococci are important virulence factors in the sucrosedependent colonization of tooth surfaces by these organisms. To investigate the structure-function relationship of the GTFs, an approach was initiated to identify amino acid residues of the GTFs which affect the incorporation of glucose residues into the glucan polymer. Conserved amino acid residues were identified in the GTF-S and GTF-I enzymes of the mutans streptococci and were selected for site-directed mutagenesis in the corresponding enzymes from Streptococcus mutans GS5. Conversion of six amino acid residues of the GTF-I enzyme to those present at the corresponding positions in GTF-S, either singly or in multiple combinations, resulted in enzymes synthesizing increased levels of soluble glucans. The enzyme containing six alterations synthesized 73% water-soluble glucan in the absence of acceptor dextran T1O, while parental enzyme GTF-I synthesized no such glucan product. Conversely, when residue 589 of the GTF-S enzyme was converted from Thr to either Asp or Glu, the resulting enzyme synthesized primarily water-insoluble glucan in the absence of the acceptor. Therefore, this approach has identified several amino acid positions which influence the nature of the glucan product synthesized by GTFs.

Streptococcus mutans strains have been implicated as the primary etiological agents in the development of human dental caries (16). Colonization of teeth by these microorganisms is enhanced in the presence of dietary sucrose. This results from the formation of water-insoluble glucose polymers (glucans) from sucrose by these organisms and is catalyzed by extracellular glucosyltransferases (GTFs). Two types of GTFs from S. mutans and other oral streptococci have been isolated and characterized: GTF-I, synthesizing primarily water-insoluble a-1,3-linked glucan (IG), and GTF-S, forming soluble a-1,6linked glucose polymers (SG). Both biochemical and genetic analyses have indicated that S. mutans strains express three distinct GTFs (2, 8-10, 24, 25): two enzymes involved in insoluble glucan synthesis, GTF-I and GTF-SI, and one enzyme catalyzing the formation of soluble glucans, GTF-S. In addition, the activity of the latter enzyme is dependent upon the presence of exogenous glucan acceptors while the former enzymes are acceptor independent. Recent in vivo experiments have indicated that all three enzymes are required for maximal cariogenesis in animal model systems (26). Comparisons of the amino acid sequences of GTFs isolated from various oral streptococci have revealed a high degree of similarity between the enzymes (1, 4-6, 7, 10, 24, 25). For example, the GTF-I and GTF-S enzymes from S. mutans GS5 (containing 1,475 and 1,431 amino acids, respectively) have 52% sequence identity. In addition, several approaches have revealed that these enzymes are composed of two functional domains: the amino-terminal catalytic domain binding and hydrolyzing the substrate sucrose and a carboxyl-terminal domain involved in acceptor glucan binding (3, 17, 20). Mooser et al. have isolated an active-site peptide from the GTF-I and GTF-S enzymes of S. sobrinus and demonstrated that an Asp

residue within the peptides covalently binds sucrose (17). Site-directed mutagenesis of the corresponding Asp residue in the GTF-I enzyme of S. mutans GS5 completely inactivated the enzyme (12, 13). Moreover, construction of various hybrid

B

DS7lK

K1O04T

:iHLmihM HIE-l _~J _~ SeeR! I

am-1 G_ PA I

Sm!I

ow-s

.ON

HL dM . gII

N471D

5**

aI

_

XD I

c

I

M-

_

Him dil

sea. I

444-,.

TST9D,T589E

FIG. 1. Structures of plasmids used for site-directed mutagenesis (A) and restriction maps of gtfB and gtJD with the replacement positions of the mutated amino acids (B). The arrows under the bars in panel B denote the direct repeating units.

Corresponding author. t Present address: Department of Preventive Dentistry, Kyushu University School of Dentistry, Fukuoka 812, Japan. *

4845

4846

J. BAC-1ERIOL.

SHIMAMURA ET AL.

TABLE 1. Oligonucleotides used for site-directed mutagenesis Mutation

GTF-I I448V

Gene (upper) and oligonucleotide (lower) sequences"

Restriction site

AsnPheAspSerIleArgValAsp AACTTTGATTCCATTCGTGTTGATGC

BsiWI

AACTTTGATTCC0T&CGTGTTGATGC Val

GTF-I D457N

ValAspAsnValAspAlaAspLeuLeu GGTAGATAATGTGGATGCTGACTTGCTC

HpaI

GGTAGATAATGTZ&ACGCTGACTTGCTC Asn

GTF-I D567T

SerGluValGlnAspLeuIleAlaAspIle AGTGAAGTGCAGGATTTGATTGCTGATATC

AseI

AGTGAAGTGCAGAC&TTAAZTGCTGATATC Thr

GTF-I D571K

AspLeuIleAlaAspIleIleLysAla

EcoRV

GATTTGATTGCTGATATCATCAAGGCA

GATTTGATTGCTMAAATCATCAAGGCA Lys

GTF-I D567T:D571K

SerGluValGlnAspLeuIleAlaAspIleIleLeuAla AGTGAAGTGCAGGATTTGATTGCTGATATCATCAAGGCA

EcoRV

AGTGAAGTGCAGACTTTGATTGCTA AATCATCAAGGCA Thr

GTF-I K779Q

Lys

AlaAlaAspIleLysGlyTyrAla CAGCGGCTGATATTAAAGGCTATGCCA

EcoRV

CAGCGGCTGATATCCAAGGCTATGCCA Gln

GTF-I K1014T

SerValLysIleLysGlnThrrpSerALys TTCTGTTAAGATTAAGCAATGGTCTGCCAAG

TTCTGTTAAGATaACGCA0TGGTCTGCCAAG

DraIII

Thr

GTF-S N471D

ValAspAsnValAsnAlaAspLeuLeuGln GTTGATAATGTTAATGCCGACTTGCTGCAG

BsaHI

GTTGATAATGTTOArGCCGACTTGCTGCAG Asp

GTF-S T589D

SerGluValGlnThrValIleAlaLysIleIle AGTGAAGTCCAAACGGTTATTGCTAAAATTATT AGTGAAGTCCAA9>ATTGCTAAAATTATT

BsaHI

Asp

GTF-S T589E

SerGluValGlnThrValIleAlaLys CAGTGAAGTCCAAACGGTTATTGCTAAA

BstNI

CAGTGAAGTCCAgOAGGTTATTGCTAAA Glu

a Substituted nucleotides are underlined. Parental amino acid sequences are indicated above the corresponding nucleotide sequences. Altered amino acid residues shown under the sequences of oligonucleotides. Altered restriction sites are in boldface.

are

fusion GTFs suggested that the glucan-binding domain plays an important, but not exclusive, role in determining the nature of the glucan product synthesized by GTFs (20). However, identification of GTE subdomains involved in regulating the incorporation of glucose residues as either a-1,3- or a-1,6linked residues into the glucan products has not been accomplished. The present communication describes an initial investigation into the structure-function relationship of GTFs. We describe the alteration of specific amino acid residues in the GTF-S and GTF-I enzymes of S. mutans GS5 following site-directed mutagenesis of the corresponding gtfB and gtJD genes which significantly alters the nature of the glucan products produced.

MATERIALS AND METHODS Bacteria and plasmids. Escherichia coli HB101 (21), JM109 (27), BW313, and BMH 71-18 mutS (Mutan-K Kit; Takara Shozu, Kyoto, Japan) were used for site-directed mutagenesis. Plasmids pTSU5, pCK28 (Fig. 1) (4), pYND7, pMCL20, and pMCL18 (6) were utilized in previous investigations in this laboratory. Plasmid pYND72 (Fig. 1) was prepared as follows. An XbaI fragment from pYND7 was subcloned into XbaIcleaved pMCL20. Subsequently, an AvaIl-SacI fragment containing the gtJD gene but lacking its own promoter and Shine-Dalgarno sequence was introduced into the HincII-SacI sites of pMCL18, resulting in expression of the gtfD gene from the promoter and Shine-Dalgarno sequence of the vector.

S. MUTANS GTFs

VOL. 176, 1994 I

a. 462 b. 444 c. 442 d. 456 e. 428

DANFDGIRVDAVDNVDADMLQL DANFDSIRVDAVDNVDADLLQI DANFDSIRVDAVDNVDADLLQI EANFDGVRVDAVDNVNADMLQI DANFDGVRVDAVDNVNADMLQI *

a. 607 b. 559 c. 557 d. 579 e. 542

*

463 477

449

627 580 578

FIRAHDSEVQTVIAKIIKKQI FIRAHDSEVQTRIAKIIREKL *

465

**

FIRAHDSEVQDLIADIIKKEI

*

599 562

containing ampicillin (50 jig/ml) for gtfB mutants or chloramphenicol (25 jig/ml) for gtfD alterations. The cells were harvested by centrifugation, suspended in 1 ml of 0.1 M sodium acetate buffer (pH 6.5), and sonicated (20). The supernatant of the lysate was used as the source of mutant enzymes. Enzyme activity assays. Enzyme activity for IG and SG syntheses was measured as previously described (15), by using [U-14C]sucrose as the substrate. The Km values of the enzymes for sucrose were determined by measuring enzyme activity in the presence of 0.58 to 8.7 mM sucrose following incubation for 3 h. Each extract was assayed at least twice. Linkage analysis. The glucans were synthesized by the GTF-S T589E mutant from 1.5 g of sucrose at 370C for 6 h in a 30-ml reaction mixture containing 0.1 M acetate buffer (pH 6.5) in the absence or presence of 10 mg of dextran T10. IG was collected by centrifugation, and SG was precipitated with 75% ethanol. The glucans were dissolved in 0.5 M NaOH and analyzed by 13C nuclear magnetic resonance (NMR) spectrophotometry (23).

**

GVLTFGANDIKGYETFDMSGFV GYLYFLNDDLKGVANPQVSGFL GELIFTAADIKGYANPQVSGYL GELVFDASDIQGYLNPQVSGYL GNLSFSQSELQSVANAQVSGMI ***

a. 1078 b. 1011 c. 1007 d. 1039 e. 993

**

FIRAHDNNVQDIIAEIIKKEI FARAHDSEVQDLIRDIIKAEI

*

a. 836 b. 772 c. 769 d. 800 e. 755

****

483

4847

*

*

*

****

*

857

793 790 821

776

*

IDDSVKLKQWKAEYFNGTNVL IDPSVKIKQWSAKYFNGSNIL MDPSVKIKQWSAKYFNGTNIL IDPSEKITAWKAKYFNGTNIL IDPSVKITNWSAKYFNGSNIL

1098 1031 1027 1059

1013

FIG. 2. Comparison of amino acid sequences in the regions chosen for site-directed mutagenesis of the S. mutans gtf genes. Lines a to e are

the sequences deduced from S. salivarius ATCC 25985 gtfy, S. downei MFe28 gtfl, S. mutans GS5 gtfB, S. mutans GS5 gtfD, and S. downei MFe28 gtJS, respectively. Mutagenesis was carried out on the doubleunderlined amino acids. The numbers represent positions from the N termini of the enzymes. Asterisks show residues identical among the five sequences. The arrow represents the aspartic acid residue of the sucrose-binding site.

Site-directed mutagenesis. Mutation of the gtfB gene was carried out by the method of Kunkel (14). Briefly, plasmid pCK28 was introduced into E. coli BW313, infected with helper phage M13K07, annealed with synthetic oligonucleotides (Table 1), treated with T4 DNA polymerase and T4 ligase, and introduced into E. coli BMH 71-18 mutS. The resulting plasmids were transformed into E. coli HB101. The gtJD gene from pYND72 was mutated by mutagenesis of double-stranded plasmid DNA (11) and expressed in E. coli JM109. The choice of mutagenic oligonucleotide sequences was based on the generation or elimination of restriction sites (Table 1) which were used to confirm the construction of the selected mutations. Multiple mutations in each gene were produced by sequential mutation by using the appropriate mutagenic primer. In addition, nucleotide sequencing of some of the mutants (GTF-I single mutations and GTF-S T589E) was carried out to further confirm the mutations (22). Preparation of mutant GTFs. E. coli containing the mutated gtf8 or gtfD gene was cultured in 50 ml of Luria-Bertani (LB)

RESULTS AND DISCUSSION Site-directed mutagenesis strategy. Comparison of the amino acid sequences of GTFs from oral streptococci synthesizing primarily SG (S. mutans GS5 GTF-S and S. downei GTF-S [6]) or IG (S. mutans GTF-I, S. salivarius GTF-I [5], and S. downei GTF-I [3]) revealed several positions that appear to be conserved for each group of enzymes (Fig. 2). For example, the enzymes synthesizing IG contain an Asp residue at position 457 (S. mutans gtfB sequence) while those involved in SG formation contain Asn at the corresponding position. Such an analysis revealed six conserved positions in the GTF-I enzyme from S. mutans GS5 and two sites in GTF-S which were selected for site-directed mutagenesis (Fig. 1B). The six amino acids of GTF-I encoded by the gtfB gene were converted to the corresponding amino acids of GTF-S individually, as well as in multiple combinations, and assayed for SG- and IG-synthetic activities. Likewise, two positions in the GTF-S enzyme, 471 and 589, were converted to amino acids observed at the corresponding positions in the GTF-I enzyme and assayed for GTF activity. Mutagenesis of GTF-I. In the absence of acceptor dextran T10, the D457N, D567T, D571K, and K1014T mutants of GTF-I synthesized 37, 24, 18, and 14% SG, respectively (Table 2) while GTF-I and both the 1448V and K779Q mutants synthesized negligible amounts of the water-soluble product. The enzymes containing two or three of these mutations synthesized 28 to 38% SG. Although the mutant containing the D457N:D567T:D571K:K1014T alterations synthesized only 10% SG in the absence of acceptor dextran T10, additional introduction of the K779Q mutation yielded 23% SG and the subsequent 1448V mutation resulted in 73% SG synthetic activity. These results indicated that individual substitutions of three Asp residues at position 457, 567, or 571 with neutral or basic amino acids resulted in enzymes with enhanced SGsynthetic activity in the absence of acceptor glucans. The mutated GTF-I containing all three substitutions synthesized more SG (73% of total glucan [TG]) only when three additional sites were converted to amino acids found at corresponding positions in the GTF-S enzyme (GTF-I mutant

I448V:D457N:D567T:D571K:K779Q:K1l14T). In the presence of dextran T10, the GTF-I enzyme synthesized a small amount (13%) of SG (Table 2). The 1448V, D457N, D571K, and K1014T mutants alone synthesized 25 to 60% SG, which was two to four times higher than the level obtained with GTF-I enzyme. However, the D567T and

4848

J. BACTERIOL.

SHIMAMURA ET AL. TABLE 2. Soluble and insoluble glucan-synthetic activities of original and mutant GTFs of S. mutans GS5 Glucan-synthetic activity' (cpm)

Without dextran T10

Glucosyltransferase

GTF-I pTSU5 GTF-I 1448V GTF-I D457N GTF-I D567T GTF-I D571K GTF-I K779Q GTF-I K1014T GTF-I 1448V:D457N GTF-I D457N:D567T GTF-I D457N:D571K GTF-I D567T:D571K GTF-I D567T:D571K:K1l14T GTF-I D457N:D567T:D571K:K1014T GTF-I 1448V:D457N:D567T:D571K: K1014T GTF-I D457N:D567T:D571K:K779Q: K1014T GTF-I I448V:D457N:D567T:D571K: K779Q:K114T GTF-S pYND72 GTF-S N471D GTF-S T589D GTF-S T589E GTF-S N471D:T589D GTF-S N471D:T589E

Stimulation' by dextran

With dextran T10

SG

IG

TG

SG

IG

TG

(fold)

0(0) 0 (0) 2,490 (37) 2,080 (24) 1,500 (18) 160 (3) 730 (14) 2,560 (33) 1,900 (30) 2,890 (28) 3,250 (41) 2,290 (38) 220 (10) 100 (4)

8,950 (100) 9,170 (100) 4,250 (63) 6,760 (76) 6,990 (82) 5,320 (97) 4,350 (86) 5,280 (67) 4,340 (70) 7,430 (72) 4,700 (59) 3,780 (62) 1,890 (90) 2,410 (96)

8,950 9,170 6,740 8,840 8,490 5,480 5,080 7,840 6,240 10,320 7,950 6,070 2,110 2,510

1,380 (13) 2,690 (25) 2,780 (26) 1,880 (18) 2,590 (25) 1,510 (18) 6,400 (60) 2,930 (24) 3,070 (29) 4,170 (34) 4,810 (48) 3,870 (42) 1,670 (25) 1,180 (21)

9,120 (87) 8,160 (75) 7,870 (74) 8,500 (82) 7,900 (75) 6,930 (82) 4,350 (40) 9,030 (76) 7,450 (71) 8,170 (66) 5,240 (52) 5,450 (58) 4,940 (75) 4,530 (79)

10,500 10,850 10,650 10,380 10,490 8,440 10,750 11,960 10,520 12,340 10,050 9,320 6,610 5,710

1.2 1.2 1.6 1.2 1.2 1.5 2.1 1.5 1.7 1.2 1.3 1.5 3.1 2.3

570 (23)

1,910 (77)

2,480

1,960 (30)

4,510 (70)

6,470

2.6

4,540 (73)

1,650 (27)

6,190

7,720 (51)

7,330 (49)

15,050

2.4

840(86) 3,190 (62) 180 (15) 30 (2) 5,440 (69) 3,330 (53)

140(14) 1,990 (38) 1,000 (85) 1,510 (98) 2,440 (31) 2,970 (47)

980 5,180 1,180 1,540 7,880 6,300

7,480 (99) 11,080 (99) 9,400 (99) 12,080 (99) 12,260 (99) 13,340 (99)

90 (1) 60 (1) 100 (1) 70 (1) 160 (1) 70 (1)

10,500 11,140 9,500 12,150 12,420 13,410

7.7 2.2 8.1 7.9 1.6 2.1

a The activities are shown for SG, IG, and TG synthesized from [U-14C]sucrose. The values in parentheses represent the percentages of SG or IG in the reactions. b Stimulation is expressed as the ratio of TG in the presence and absence of dextran T10.

K779Q mutants did not synthesize significantly more SG than GTF-I. The latter two mutations resulted in higher dextran T10-dependent SG-synthetic activity only in combination with other mutations. For example, the D567T:D571K mutant synthesized 48% SG in the presence of dextran T10. Likewise, the I448V:D457N:D567T:D571K:K779Q:K1O14T mutant synthesized 51% SG although the I448V:D457N:D567T:D571K: K1014T mutant synthesized 21% of the water-soluble product in the presence of the acceptor. Therefore, substitutions at several conserved positions in the GTF-I enzyme (residues 457, 567, 571, and 1014) increased the capacity of the resultant enzyme to synthesized SG. Furthermore, conversion of six amino acids in GTF-I to the corresponding residues present in GTF-S yielded an enzyme synthesizing primarily SG in the absence of acceptor dextran T10 and equal amounts of IG and SG in the presence of the acceptor. This altered GTF-I still synthesized IG but at reduced levels relative to those produced by unaltered GTF-I. Mutagenesis of GTF-S. Since conversion of the Asp residues at positions 457 and 567 of GTF-I to amino acids present at corresponding positions in GTF-S resulted in mutated enzymes synthesizing increased levels of SG relative to GTF-I (Table 2), these residues in GTF-S encoded by gif) were selected for mutation. The change of Asn-471 to Asp resulted in a mutant enzyme synthesizing a higher percentage of IG than GTF-S (37 versus 14%). More dramatically, the conversion of Thr to Asp at position 589 of GTF-S yielded an enzyme synthesizing 85% IG in the absence of acceptor dextran T10. Likewise, conversion of Thr to Glu at this position resulted in a GTF-S mutant synthesizing 98% IG in the absence of acceptor dextran T10. However, introduction of mutations into GTF-S at both positions 471 and 589 yielded a mutant which synthesized lower levels of IG than single mutants T589D and

T589E did. In the presence of dextran T10, however, all of the mutants synthesized primarily SG, as did GTF-S. These observations are similar to previous results indicating that addition of dextran T10 to GTF-I leads to increased soluble-glucan synthesis (2). The activities of the T589D and T589E mutants were stimulated 8-fold by dextran T10, which was almost the same as that of GTF-S, while the stimulation of the double mutants was reduced to 1.6- to 2.1-fold. The T589D and T589E mutants of GTF-S synthesized predominantly IG in the absence of dextran T10, while they failed to synthesized IG in the presence of dextran T10. This suggests that the presence of an acidic amino acid at this position greatly influences the nature of the glucan product but is not sufficient in itself to convert the enzyme completely to one exhibiting GTF-I activity in the presence or absence of dextran T10. Effect of mutagenesis on Km values. To determine if some of the mutations which significantly altered the nature of the glucan products affect the substrate binding of the GTFs, the Km values of the original and mutant GTF-I and GTF-S enzymes for sucrose were determined in the absence and presence of acceptor dextran T10. The Km values of GTF-I and its mutant I448V:D457N:D567T:D571K:K779Q:K1O14T for sucrose were similar (0.7 and 1.6 mM, respectively, for TG synthesis) in the absence or presence of the acceptor. Likewise, the Km values of GTF-S and its mutant T589E were similar in the absence or presence of dextran T10 (1.6 and 5.0 mM, respectively). These results suggested that the binding abilities of GTF-I and GTF-S for substrate sucrose were not drastically altered by the mutations. Linkage analysis. To determine if the IG synthesized by the T589E GTF-S mutant resembles the insoluble product synthesized by GTF-I, the glucose linkages of the glucan products synthesized by the GTE-S T589E mutant were analyzed by 13C

VOL. 176, 1994

S. MUTANS GTFs

TABLE 3. Linkage analyses of a-D-glucans synthesized by the GTF-S T589E mutant in the absence or presence of dextran T10 Concn (mol%) glucose residue Enzyme

GTF-S T589E

Dextrana

+

GTF-Sb GTF-IC

_

Glucan

Soluble Insoluble Soluble Insoluble Soluble Insoluble

with the following a linkage: 1,3

1,6

1,3,6

1

4.3 38.1 8.2 31.0 0 76.0

65.8 33.6 44.1 37.8 70.3 24.0

13.7 10.9 23.1 10.0 15.1

16.2 17.4 24.6 21.2 14.6 ND

NDd

a The enzymes were reacted in the absence (-) or presence (+) of 10 mg of dextran T10. b The data shown from reference 18 for the enzyme from S. mutans Ingbritt. cThe data shown are from reference 19 for the enzyme from S. mutans Ingbritt. d ND, not detected.

NMR spectrophotometry (Table 3). The SG synthesized in the absence and presence of acceptor dextran T10 were primarily (1--6)-a-D-glucans with 4 to 8% 1,3-linked and 13 to 23% 1,3,6-branched glucose. The mutant synthesized IG which contained 38 and 31% 1,3-linked glucose in the absence and presence of dextran T10, respectively, as well as 11 and 10% 1,3,6-branched glucose, respectively. By comparison, the SG synthesized by purified GTF-S from S. mutans Ingbritt was mainly (1--*6)-0c-D-glucan with 15% 1,3,6-branched glucose and no 1,3-linked glucose (18). The IG of GTF-I from the same organism was 76% (1->3)-a-D-glucan with 24% 1,6linked glucose and no 1,3,6-branched glucose (19). Therefore, the GTF-S T589E mutant synthesized a novel IG with lower levels of a-1,3 glucose linkages than those of the insoluble product synthesized by GTF-I. Summary. This study demonstrated the effects of sitedirected mutagenesis of selected amino acid residues on the structure of the glucans synthesized by S. mutans GTFs. The presence of an acidic amino acid residue at position 567 of GTF-I (equivalent to reside 589 of the GTF-S enzyme) resulted in an enzyme synthesizing low levels of SG in the absence of dextran T10. Conversely, the presence of a neutral amino acid at this position in either GTF-I or GTF-S results in an enzyme synthesizing primarily SG. Thus, conversion of Thr to Asp or Glu at this position in GTF-S is sufficient to yield an enzyme synthesizing primarily IG in the absence of the acceptor. Several other amino acid changes in both enzymes also altered the nature of the glucan product but not to the same extent as the changes at the position equivalent to residue 589 of GTF-S. Conversion of multiple amino acid residues of GTF-I to the corresponding amino acids found in GTF-S resulted in enzymes with increased GTF-S-like properties; i.e., the enzyme containing six such changes synthesized primarily SG. However, this enzyme still synthesized significant levels of IG. Thus, additional residues are involved in the differential properties of GTF-S relative to GTF-I. Nevertheless, it is interesting that such changes can be demonstrated by altering only a few amino acid residues in proteins containing approximately 1,450 amino acids. Therefore, this approach has identified several amino acid positions which are important in determining the structure of the glucan product synthesized. However, no three-dimensional structural information is available regarding these large enzymes and it is not possible to specifically identify the role of each change in catalysis. Since the alterations affecting the glucan product occur in the catalytic domain of the enzyme, it

4849

is likely that these changes affect the incorporation of the glucose residues from sucrose into the growing glucan polymer chain. Additional investigations are required to define the nature of such influences. In addition, like the GTF-S T589E enzyme, some of the mutated enzymes may synthesize unique glucan structures with properties distinct from naturally produced glucans. Such characteristics will be investigated for selected mutated GTFs. ACKNOWLEDGMENT This study was supported in part by NIH grant DE-03258 (H.K.K.). REFERENCES 1. Abo, H., T. Matsumura, T. Kodama, H. Ohta, K. Fukui, K. Kato, and H. Kagawa. 1991. Peptide sequences for sucrose splitting and glucan binding within Streptococcus sobrinus glucosyltransferase (water-insoluble glucan synthetase). J. Bacteriol. 173:989-996. 2. Aoki, H., T. Shiroza, M. Hayakawa, S. Sato, and H. K. Kuramitsu. 1986. Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis. Infect. Immun. 53:587-594. 3. Ferretti, J. J., M. L. Gilpin, and R. R. B. Russell. 1987. Nucleotide sequence of a glucosyltransferase gene from Streptococcus sobrinus MFe28. J. Bacteriol. 169:4271-4278. 4. Giffard, P. M., D. M. Allen, C. P. Milward, C. L. Simpson, and N. A. Jacques. 1993. Sequence of the g#K gene of Streptococcus salivarius ATCC 25975 and evolution of the gtf genes of oral streptococci. J. Gen. Microbiol. 139:1511-1522. 5. Gifard, P. M., C. L Simpson, C. P. Milward, and N. A. Jacques. 1991. Molecular characterization of a cluster of at least two glucosyltransferase genes in Streptococcus salivarius ATCC 25975. J. Gen. Microbiol. 137:2577-2593. 6. Gilmore, K. S., R. R. B. Russell, and J. J. Ferretti. 1990. Analysis of the Streptococcus downei gtJS gene, which specifies a glucosyltransferase that synthesizes soluble glucans. Infect. Immun. 58: 2452-2458. 7. Hanada, N., Y. Isobe, Y. Aizawa, T. Katayama, S. Sato, and M. Inoue. 1993. Nucleotide sequence analysis of the gtJT gene from Streptococcus sobrinus OMZ176. Infect. Immun. 61:2096-2103. 8. Hanada, N., and H. K. Kuramitsu. 1988. Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans. Infect. Immun. 56:19992005. 9. Hanada, N., and H. K. Kuramitsu. 1989. Isolation and characterization of the Streptococcus mutans gtfD gene, coding for primerdependent soluble glucan synthesis. Infect. Immun. 57:2079-2085. 10. Honda, O., C. Kato, and H. K. Kuramitsu. 1990. Nucleotide sequence of the Streptococcus mutans gtJD gene encoding the glucosyltransferase S-enzyme. J. Gen. Microbiol. 136:2099-2105. 11. Jung, R., M. P. Scott, L. 0. Oliveira, and N. C. Nielsen. 1992. A simple and efficient method for the oligodeoxyribonucleotidedirected mutagenesis of double-stranded plasmid DNA. Gene 121:17-24. 12. Kato, C., and H. K. Kuramitsu. 1990. Carboxyl-terminal deletion analysis of the Streptococcus mutans glucosyltransferase-I enzyme. FEMS Microbiol. Lett. 72:299-302. 13. Kato, C., Y. Nakano, M. Lis, and H. K. Kuramitsu. 1992. Molecular genetic analysis of the catalytic site of Streptococcus mutans glucosyltransferases. Biochem. Biophys. Res. Commun. 189:1184-1188. 14. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488492. 15. Kuramitsu, H. K. 1975. Characterization of extracellular glucosyltransferase activity of Streptococcus mutans. Infect. Immun. 12: 738-749. 16. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50:353-380. 17. Mooser, G., A. Hefta, R. J. Paxton, J. E. Shively, and T. D. Lee. 1991. Isolation and sequence of an active-site peptide containing a catalytic aspartic acid from two Streptococcus sobnnus a-glucosyltransferases. J. Biol. Chem. 266:8916-8922.

4850

SHIMAMURA ET AL.

18. Mukasa, H., A. Shimamura, and H. Tsumori. 1982. Purification and characterization of basic glucosyltransferase from Streptococcus mutans serotype c. Biochim. Biophys. Acta 719:81-89. 19. Mukasa, H., A. Shimamura, and H. Tsumori. 1989. Purification and characterization of cell-associated glucosyltransferase synthesizing insoluble glucan from Streptococcus mutans serotype c. J. Gen. Microbiol. 135:2055-2063. 20. Nakano, Y. J., and H. K. Kuramitsu. 1992. Mechanism of Streptococcus mutans glucosyltransferases: hybrid-enzyme analysis. J. Bacteriol. 174:5639-5646. 21. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 22. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 23. Shimamura, A. 1989. Use of 13C-N.M.R. spectroscopy for the

J. BACTERIOL. quantitative estimation of 3-0- and 3,6-di-O-substituted D-glucopyranosyl residues in a-D-glucans formed by the D-glucosyltransferases of Streptococcus sobrinus. Carbohydr. Res. 185:239-248. 24. Shiroza, T., S. Ueda, and H. K. Kuramitsu. 1987. Sequence analysis of the gtfB gene from Streptococcus mutans. J. Bacteriol. 169:4263-4270. 25. Ueda, S., T. Shiroza, and H. K. Kuramitsu. 1988. Sequence analysis of the gtfC gene from Streptococcus mutans GS-5. Gene 69:101-109.

26. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu. 1993. Role of the Streptococcus mutans gtf genes in caries induction in the specific-pathogen-free rat model. Infect. Immun. 61:3811-3817. 27. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.