Springer 2005
Plant Molecular Biology (2005) 59:909–925 DOI 10.1007/s11103-005-2081-x
Dynamic histone acetylation of late embryonic genes during seed germination Helen H. Tai1,*, George C.C. Tai2 and Tannis Beardmore1 1
Canadian Forest Service, Natural Resources Canada, P.O. Box 4000, E3B 5P7, Fredericton, NB, Canada (*author for correspondence; e-mail
[email protected]); 2Potato Research Centre, Agriculture and Agri-Food Canada, P.O. Box 20280, E3B 4Z7, Fredericton, NB, Canada Received 27 April 2005; accepted in revised form 12 August 2005
Key words: chromatin, gene expression, histone acetylation, histone deacetylase, microarray, seed germination
Abstract Histone acetylation is involved in the regulation of gene expression in plants and eukaryotes. Histone deacetylases (HDACs) are enzymes that catalyze the removal of acetyl groups from histones, which is associated with the repression of gene expression. To study the role of histone acetylation in the regulation of gene expression during seed germination, trichostatin A (TSA), a specific inhibitor of histone deacetylase, was used to treat imbibing Arabidopsis thaliana seeds. GeneChip arrays were used to show that TSA induces up-regulation of 45 genes and down-regulation of 27 genes during seed germination. Eight TSA-upregulated genes were selected for further analysis – RAB18, RD29B, ATEM1, HSP70 and four late embryogenesis abundant protein genes (LEA). A gene expression time course shows that these eight genes are expressed at high levels in the dry seed and repressed upon seed imbibition at an exponential rate. In the presence of TSA, the onset of repression of the eight genes is not affected but the final level of repressed expression is elevated. Chromatin immunoprecipitation and HDAC assays show that there is a transient histone deacetylation event during seed germination at 1 day after imbibition, which serves as a key developmental signal that affects the repression of the eight genes. Abbreviations: ABRE, abscisic acid response element; ANOVA, analysis of variance; ChIP, chromatin immunoprecipitation; DAI, days after imbibition; DNA, deoxyribonucleic acid; HAT, histone acetyltransferase; HDAC(s), histone deacetylase(s); LIMMA, linear models for microarray analysis; MS, Murashige and Skoog; qPCR, quantitative PCR; RNA, ribonucleic acid; RTqPCR, reverse transcription quantitative PCR; TSA, Trichostatin A
Introduction Typically, seed development proceeds through a series of confluent stages and is terminated as the seed undergoes maturation drying, becoming quiescent or dormant. Imbibition of a nondormant seed results in germination and subsequent seedling development. The transition from the developmental to the germinative program is associated
with changes in the pattern of gene expression (Comai and Harada, 1990; Gallardo et al., 2001; Nakabayashi et al., 2005; Nambara et al., 2000; Soeda et al., 2005). Evidence suggests that seed germination marks the end of embryonic development and rapid repression of embryonic genes is observed with seed imbibition. The pkl mutant in Arabidopsis thaliana shows a loss of repression of embryonic traits in seedlings (Ogas et al., 1997;
910 Henderson et al., 2004) and a loss of repression of the LEAFY COTYLEDON embryonic identity genes, LEC1, LEC2, and FUS3 (Rider et al., 2003). The PKL gene encodes a protein that is similar to CHD3, a mammalian chromatin protein (Ogas et al., 1999), indicating that chromatin may have a role in the repression of embryonic genes. In this study we investigate the role of covalent modification of chromatin in the control of embryonic gene repression during seed germination. The basic unit of chromatin is the nucleosome, which consists of 146 bp of DNA wrapped around a tetramer of H3/H4 and two dimers of H2A/H2B (Wolffe, 1992). Histones can be chemically modified through the action of enzymes that add or remove acetyl, methyl, phosphoryl, ubiquitin or sumo from the N-terminal tail of the proteins that are exposed on the surface of the nucleosome (Jenuwein and Allis, 2001). The functions of these modifications in cellular and developmental processes are beginning to be elucidated. This study addresses histone acetylation. Earlier studies show a correlation between histone acetylation and increased gene transcription (Allfrey et al., 1964; Hebbes et al., 1988). In addition, several transcriptional co-activators have intrinsic histone acetyltransferase (HAT) activity and transcriptional co-repressor complexes contain histone deacetylase (HDAC) (Ahringer, 2000; Sterner and Berger, 2000; Struhl, 1998). Furthermore, studies also show that active regions along chromosomes are enriched in acetylated histones whereas inactive regions are not (Turner, 1993). Transcription factor recruitment of HATs to promoter regions is associated with acetylation of histones and activation of gene expression (Kuo et al., 1998, 2000), whereas the targeted recruitment of HDACs to promoters is associated with deacetylation of histones and gene repression (Kadosh and Struhl, 1998a, b; Rundlett et al., 1998). However, histone acetylation and deacetylation also occurs over larger chromosomal domains that extend beyond promoters and is not under the control of sequence specific transcription factors (Kurdistani and Grunstein, 2003). Histone acetylation changes not targeted to promoters are referred to as ‘global acetylation and deacetylation’ may function to control basal transcription or allow for reversal of targeted
acetylation changes after removal of the recruited HATs or HDACs (Krebs et al., 2000; Kuo et al., 2000; Vogelauer et al., 2000; Katan-Khaykovich and Struhl, 2002). Histones are also covalently modified in plants and plant HATs and HDACs have been identified (Stockinger et al., 2001; Pandey et al., 2002; Loidl, 2004). Arabidopsis studies also demonstrate that HDAC functions as a repressor in plants (Wu et al., 2000a, b Zhou et al., 2004). Anti-sense expression knockouts of HDACs, ATHD1 and ATHD2A (Wu et al., 2000a, b; Tian and Chen, 2001), an ATHD1 T-DNA insertional mutant (Tian et al., 2004), ATHD2A transgenic Arabidopsis thaliana (Zhou et al., 2004) and OSHDAC1 transgenic rice (Jang et al., 2003) were used to identify a role for HDACs in plant development. Recently ATHDI (also called HD19) was also shown to be involved in regulation of pathogen response genes (Zhou et al., 2005). Histone acetylation is also involved in the regulation of FLC, a flowering control gene in Arabidopsis thaliana (He et al., 2003) and the pea plastocyanin gene (Chua et al., 2001, 2003). An advantage of using chemical inhibitors of HDAC is that the timing of the loss of HDAC activity can be controlled. Small molecules trapoxin and trichostatin A (TSA) were used in mammalian cells to characterize the function of HDAC1 (Taunton et al., 1996; Richon et al., 2000). Chemical inhibitors of HDACs are also effective in plants (Brosch et al., 1995; Lechner et al., 1996) and specific chemical inhibitors of TSA were used to identify a role for HDACs in plants in nucleolar dominance (Chen and Pikaard, 1997; Lawrence et al., 2004), root meristem proliferation (Murphy et al., 2000) and tobacco protoplast cell cycle progression (Li et al., 2005). Microarray analysis in tobacco and Arabidopsis thaliana seedlings also show that TSA induces changes in gene expression and affects histone acetylation at specific genes (Chua et al., 2004; Chang and Pikaard, 2005). Our study investigates the role of HDAC on the expression, acetylation and deacetylation of Arabidopsis thaliana genes during seed germination through inhibition of HDAC with TSA. Arabidopsis thaliana has HDAC homologs that belong to three HDAC families, RPD3/HDA1, HD2, and SIR2 (Pandey et al., 2002). TSA inhibits RPD3/HDA1-like HDACs and plant-specific
911 HD2 HDACs (Yoshida et al., 1990, 1995; Lechner et al., 1996), but does not affect the SIR2 class of HDACs (Imai et al., 2000). Out of the 17 members of the HDAC family in Arabidopsis thaliana there are 14 RPD3/HDA1-like and HD2 genes (Pandey et al., 2002). An analysis of gene expression using GeneChip arrays and reverse transcription quantitative polymerase chain reaction (RTqPCR) identified eight genes whose repression during imbibition is altered with TSA treatment. These genes are expressed during late maturation in the embryo, involved in dehydration stress responses and contain an upstream abscisic acid response element (ABRE). The genes also show a deacetylation pattern during germination that is correlated with HDAC activity levels providing evidence that they are controlled by HDAC during seed germination.
fragmentation, cRNA was used in a hybridization mix containing added hybridization controls and arrays hybridized for 16 h at 45 C. Standard post hybridization wash with protocol EukGE-WS2 and double-stain protocols were used on an Affymetrix GeneChip Fluidics Station 400. Arrays were scanned on an Affymetrix GeneChip Scanner 2500. Two replicates of cRNA samples from two different batches of 3-day germinated seeds either treated with TSA or untreated were prepared. Two sets of replicate samples were hybridized to the Arabidopsis Genome array with 8300 gene sequences and used for statistical analysis. Scanned arrays were normalized globally and analyzed with Affymetrix MAS 5.0 software to obtain absent/ present calls and to assure that all quality parameters were in the recommended range (Supplemental material Table 1).
Materials and methods Plant material and growth conditions Seeds from Arabidopsis thaliana ecotype Columbia were surface sterilized and sown on nylon membranes on Murashige and Skoog (MS) media (Murashige and Skoog, 1962) containing 0.8% agar with and without 10 lM Trichostatin A (TSA) (Sigma Chemical Co., USA) in 10 cm Petri dishes with 10 ml media/dish. Seeds were germinated under 16 h light conditions. One hundred milligrams of seeds were sown per 10 cm dish for samples used for RNA preparation or ChIP. GeneChip array expression analysis Total RNA was prepared from 500 mg of plant tissue from dry seeds and seeds imbibed for 3 days in the presence and absence of 10 lM TSA using a LiCl extraction method described previously (Tai et al., 2004). RNA quality was assessed by agarose gel electrophoresis and spectrophotometry. The RNA was then processed for use on Affymetrix Arabidopsis GeneChip arrays (Santa Clara, USA), according to the manufacturer’s protocol. Briefly, cDNA was synthesized from total RNA using reverse transcriptase followed by second strand synthesis to generate double-stranded cDNA. An in vitro transcription reaction was used to generate biotinylated cRNA. After purification and
Statistical analysis Gene expression signal data obtained from the replicated 8300 gene Arabidopsis Genome arrays on the Affymetrix Gene Chip Fluidics Station were statistically analyzed in two stages: 1. The affy module (Gautier et al., 2004) of the Bioconductor open-source software (http:// www.bioconductor.org) was used to normalize and compute expression values using the robust multichip average (RMA) method (Irizarry et al., 2003). The linear model for microarray analysis (LIMMA) (Smyth, 2004), implemented using the limma module of the Bioconductor software, was used for statistical analysis of gene expression data. P = 0.025 was used in LIMMA analysis to obtain a list of differentially expressed genes. 2. Genes identified as differentially expressed after stage 1 were candidates for second stage screening. The gene expression data normalized globally with Affymetrix MAS 5.0 software was used. The data was subjected to further discriminant analysis to identify those genes with large effects due to TSA treatment. Three gene expression variables TSA, untreated and TSA/untreated ratio, over two replicates were subjected to canonical variate analysis (Bartlett, 1947). Canonical variate analysis was carried out
The sense (upper) and antisense (lower) primers used to amplify the promoter and coding regions for each gene are listed in this table in the 5¢ to 3¢ orientation. The predicted function of the protein encoded by the gene (gene function), and gene locus (locus) are listed.
5¢GCACCGCCGCTACCACCAG 5¢CCACGGAGACGGAGGACC
5¢GGAGATGCTAAAGAGAAGTTGGCGGAG 5¢CCAGGATCACCGTCACAACAAGAAAC 5¢ACGAACGCAACAAACACTAATCAAAGC 5¢GAACACGAAAGTAAGACAGAAAACCACGAA 5¢TCCTTCCTCGCCTCTCCTCCTTTGTGT
5¢GCACGAAGACAACATCCAACCCACTC 5¢CGCGAGGCCAAGGACAAGG 5¢AGCCCAGTCAGCCCAACAAAAGG 5¢CAACGCGGCCATGAAAGAAGC 5¢GTGGAGAGGCGAGGAAGGAGCAG TTAG 5¢GAGAGGGCACGAACAAAGGACAAC 5¢GATCTTCGCCGGAAAGCAACTT 5¢ACCTCTGTTTACTGTGATGTGTTCTC 5¢CGGCGGAGAAGAAGACACG 5¢AACTTGGAGTTATGTGCGAGTGTTA 5¢TGAGACGTGTCATGAAAGAAGAGG 5¢AAAGGAAACAAAAGGAGAGAAAAA GTG 5¢GGAAGAGAAGGCAGAGAGGTGTTTG 5¢GACGACTCGGTCGGTCACG hsp 70 AT3G12580 5¢CTTGTTTTCAAAACGGGAGTTACTATT UBQ 11 AT4G05050 5¢TCAGTATATGTCTCGCAGCAAACTATC
Gene Locus function
Total RNA was isolated from dry seeds, and seeds one, three, and 6 days after imbibition (DAI) on MS media containing 0.8% agar in the presence and absence of 10 lM TSA. Total RNA was also isolated from seeds undergoing two additional treatments: (1) 3 days on media in absence TSA followed by 3 days on media in the presence 10 lM TSA (3d–3d TSA), (2) 3 days on media in the presence of 10 lM TSA followed by 3 days on media in the absence of TSA (3d TSA–3d). One microgram of RNA from each sample was used for cDNA synthesis using reverse transcriptase (Invitrogen, Burlington, Canada) following pre-treatment with RNase-free DNAse. RTqPCR was done using coding region-specific primers listed in Table 1. Preliminary experiments were run to ensure the
Table 1. Primers used for PCR.
Reverse transcription quantitative polymerase chain reaction (RTqPCR)
LEA LEA LEA LEA AtEm1
Upper primer Upper primer
Lower primer
Coding region
Plant material was ground in liquid nitrogen and lysed in 0.1 M KCl, 20 mM HEPES/NaOH pH 7.9,0.2 m EDTA, 0.5 mM DTT, and 0.5 mM PMSF. The lysate was centrifuged at 15 000 rpm and the supernatant used in the colorimetric HDAC assay (BIOMOL Research Laboratories, Inc., Plymouth Meeting, USA). Briefly, the colorimetric acetylated lysine substrate was incubated with plant lysates. Deacetylation sensitizes substrate to the developer and causes an increase in absorption at 405 nm, which is linearly correlated with HDAC activity. Protein concentrations were measured at A280. The activity of HDAC is expressed at A405/mg protein.
Promoter region
Histone deacetylase assay
5¢TCTGGCTTCTGTCTCTTTACTTCTG 5¢GTGACGCGTGGCAGCAGCAG
Lower primer
The TAIR database (www.arabidopsis.org) was used to classify the predicted function of the genes and to identify upstream regions of the genes. Five hundred base pairs of DNA sequence upstream of the transcription start site was analyzed for conserved motifs using INCLUSive::Motif Sampler (Thijs et al., 2002a, b) and the PlantCare database (Rombauts et al., 1999, Lescot et al., 2002).
AT5G52300 5¢GATTTTTTCTTTTGCCGTTTTGTTAT AT5G66400 5¢GTTAGTACCGCCACAAAGAAAAG GATAG AT3G17520 5¢AATCGCTTGCCTCGTTGTTTG AT3G15670 5¢TCTCATAACATGCGACGACGATAC AT1G52690 5¢GTAAATATCTATGCAGTAATGGCGGT AT5G06760 5¢TGTTTTATCAATTTGTTTTATGCGACTC AT3G51810 5¢TCTTGGGGGAAACAGAAAATGG
Functional classification of genes
rd29B rab18
using the software SYSTAT 10.2 (Systat Software Inc., USA).
5¢CGAGAGCCCTGTAAAAGATGAAACTCC 5¢CTCCGCCATGCCTCCCAACGGAGGGTTG 5¢GCACCACGGCCAAGAGCAAC 5¢ATCGCAGGACGTACATACATAAAAAGCAC
912
913 amplification of a single PCR product for each gene and the absence of any PCR products in the total RNA without reverse transcription (data not shown). A standard curve was generated for each gene that consisted of serial dilutions of the dry seed cDNA (1, 1/2, 1/4, 1/ 8, 0). Template concentrations for each gene are given arbitrary values that are relative to the concentration of the template in the dry seed cDNA. RTqPCR was done with the DyNAmo SYBR green qPCR kit (Finnzymes Oy, Espoo, Finland) with the following cycling conditions: 2 min initial denaturation at 94 C; 50 cycles of 94 C 30 s, 60 C 30 s, 72 C 30 s; final elongation 72 C 10 min, 4 C hold. Data presented is the average relative expression values for three replicates and the error bars represent the standard deviation. Chromatin immunoprecipitation quantitative polymerase chain reaction (ChIP/qPCR) ChIP was carried as described in Johnson et al. (Johnson et al., 2002) with the following modification: DNA was purified using the Qiaquick PCR purification kit (Qiagen, Germany) instead of by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. Immunoprecipitation was done with an anti-acetyl histone H4 antibody specific for tetra-acetylated H4 (Upstate, Charlottesville, USA). For qPCR serial dilution of leaf DNA was used to generate the standard curve. Leaf tissue was formaldehyde cross-linked, extracted and sonicated as for ChIP samples. Cross-links were reversed, residual protein and DNA was purified using the Qiaquick PCR purification kit. Purified DNA from the ChIP samples and the leaf standard curve samples were used for qPCR with the DyNAmo SYBR green qPCR kit (Finnzymes Oy, Espoo, Finland) with the following cycling conditions: 2 min initial denaturation at 94 C; 50 cycles of 94 C 30 s, 60 C 30 s, 72 C 30 s; final elongation 72 C 10 min, 4 C hold. Dilutions of leaf template DNA for the standard curve were 1, 1/2, 1/4, 1/8, and 0 and a standard curve was generated for each promoter and coding region of each gene analyzed. Primers used for qPCR of promoter and coding regions are listed in Table 1. The relative quantity of template DNA was calculated using
the standard curve. Each sample was done in triplicate. Error bars represent the standard deviation.
Results Identification of genes affected by TSA treatment during seed germination Three DAI was selected as the time point for gene chip expression analysis, since visible differences between untreated and TSA-treated seedlings could be observed. One function of HDAC is to repress genes; therefore, the following two characteristics were used to select genes for analysis: 1. gene expression is up-regulated in the presence of TSA and 2. gene is repressed following seed imbibition. Affymetrix Arabidopsis GeneChip arrays were used to examine differences in gene expression between seeds imbibed for 3 days in the presence and absence of TSA (Supplemental material Table 1). LIMMA analysis indicated that 72 genes were affected by TSA treatment (Supplemental material Table 2). Genes with up-regulated expression are presented in Table 2 and genes with down-regulated expression presented in Table 3. It was highly desirable to validate the gene chip expression data using RTqPCR and to carry out chromatin analysis of TSA-affected genes; therefore, further statistical analyses were applied to the data to narrow down the list of 72 genes to those that had the most highly significant increases in expression in the presence of TSA. Three gene expression variables were used for multivariate statistical analysis of the 72 genes: 1. mean signal when untreated (untreated), 2. mean signal when treated with TSA (TSA), 3. mean signal ratio of TSA treated over untreated (TSA/untreated) (Table 4, Supplemental material Table 3). Analyses of variances (ANOVA) were carried out for each of the three sets of gene expression data, TSA, untreated and TSA/untreated to evaluate differences between these three gene expression characteristics. Significant differences between the three gene expression characteristics were found, which indicates that the variabilities in these three sets of data can be used to select genes. Canonical variate analysis (Bartlett, 1947) was applied to examine the three gene expression variables together to identify TSA-responsive genes. The
914 Table 2. Genes up-regulated by TSA. Probe ID
Locus identifier
Annotation
log2-fold change
17407_s_at
AT5G52300
4.18
16038_s_at 18872_at 17310_at 20641_at 19918_at 14097_at 17282_s_at 19186_s_at 20321_s_at 19152_at 13645_at 13198_i_at 16450_s_at 13284_at 14420_at 19660_at 13199_r_at 15280_at 20220_at 16422_at 14077_at 12072_at 18664_at
AT5G66400 AT3G17520 AT3G51810 AT1G52690 AT3G15670 AT2G47770 AT3G51810 AT3G50970 AT1G73190 AT5G06760 AT1G05340 AT4G28520 AT3G50980 AT3G12580 AT2G31980 AT2G40610 AT4G28520 AT2G19900 AT4G02280 AT2G33830 AT4G08950 AT4G25170 AT2G17230
18876_at 12802_at 13488_at 16524_at 19762_at 13514_s_at 20384_at 19843_at 13134_s_at 17388_at 16173_s_at 12521_at 19008_s_at 20210_g_at 16301_at 17464_at 12966_s_at 13099_s_at 17929_s_at 19227_at 14659_s_at
AT2G39980 AT4G36040 AT4G20070 AT1G54100 AT4G21680 AT4G18210 AT4G36010 AT1G61890 AT2G47180
Low-temperature-responsive 65 kD protein (LTI65) /desiccation-responsive protein 29B (RD29B) Dehydrin (RAB18) Late embryogenesis abundant domain-containing protein Em-like protein GEA1 (EM1) Late embryogenesis abundant protein Late embryogenesis abundant protein Benzodiazepine receptor-related Em-like protein GEA1 (EM1) Dehydrin xero2 (XERO2)/low-temperature-induced protein LTI30 (LTI30) Tonoplast intrinsic protein, alpha/alpha-TIP (TIP3.1) Late embryogenesis abundant group 1 domain-containing protein Expressed protein 12S seed storage protein Dehydrin Heat shock protein 70 Cysteine proteinase inhibitor-related Expansin 12S seed storage protein Malate oxidoreductase Sucrose synthase Dormancy/auxin associated family protein Phosphate-responsive protein Expressed protein Phosphate-responsive 1 family protein similar to phi-1 (phosphate-induced gene) [Nicotiana tabacum] Transferase family protein DNAJ heat shock N-terminal domain-containing protein (J11) Peptidase M20/M25/M40 family protein Aldehyde dehydrogenase Proton-dependent oligopeptide transport (POT) family protein Purine permease family protein Pathogenesis-related thaumatin family protein MATE efflux family protein Galactinol synthase
AT4G37430 AT3G51860 AT2G28470 AT4G39400 AT4G22920 AT1G09970 AT4G34590 AT1G22710 AT5G57050 AT4G13830 AT4G39090
Cytochrome P450 81F1 (CYP81F1) (CYP91A2) Cation exchanger Beta-galactosidase Brassinosteroid insensitive 1 (BRI1) Expressed protein Leucine-rich repeat transmembrane protein kinase bZIP transcription factor family protein Sucrose transporter/sucrose-proton symporter (SUC2) Protein phosphatase 2C ABI2/PP2C ABI2/abscisic acid-insensitive 2 (ABI2) DNAJ heat shock N-terminal domain-containing protein (J20) Cysteine proteinase RD19a (RD19A)
3.93 3.72 3.54 3.48 3.32 3.24 3.24 3.12 3.05 2.96 2.88 2.84 2.65 2.62 2.48 2.38 2.31 2.15 2.11 1.81 1.74 1.70 1.64 1.62 1.48 1.46 1.44 1.42 1.41 1.39 1.26 1.23 1.21 1.21 1.20 1.16 1.12 1.09 1.08 1.07 0.97 0.93 0.88 0.86
Affymetrix probe set identification code (Probe ID), gene locus (Locus identifier), functional annotation (Annotation) from TAIR (www.arabidopsis.org) and log2-fold change in expression levels of TSA over untreated (log2-fold change) are listed.
first two canonical variates account for 97% of the variability of the data. Mean scores of the first (CAN1) and second (CAN2) canonical variates of the 72 genes are distributed in a two-dimension
diagram (Figure 1). CAN1 mainly represents the variability due to gene expression levels, whereas CAN2 represents mainly the variability due to TSA/untreated ratios. The majority of genes are
915 Table 3. Genes down-regulated by TSA. Probe ID
Locus identifier
18571_at 14076_at 16150_at
AT1G52070 Jacalin lectin family protein similar to myrosinase-binding protein homolog AT2G20520 Fasciclin-like arabinogalactan-protein (FLA6) AT4G12480 Protease inhibitor/seed storage/lipid transfer protein (LTP) family protein identical to pEARLI 1 (Accession No. L43080) AT1G30870 Cationic peroxidase AT5G64100 Peroxidase AT4G00680 Actin-depolymerizing factor AT2G16060 Nonsymbiotic hemoglobin 1 (HB1) (GLB1) AT5G44110 ABC transporter family protein AT2G17850 Senescence-associated family protein contains similarity to ketoconazole resistant protein AT4G22080; Pectate lyase family protein similar to pectate lyase 2 AT4G22090 AT2G46860 Inorganic pyrophosphatase AT2G19590 1-aminocyclopropane-1-carboxylate oxidase AT4G33560 Expressed protein AT4G01480 Inorganic pyrophosphatase AT4G25790 Allergen V5/Tpx-1-related family protein AT5G19790; AP2 domain-containing protein RAP2.11 (RAP2.11) AT5G19780 AT1G62440 Leucine-rich repeat family protein/extensin family protein similar to extensin-like protein [Lycopersicon esculentum] AT1G75750 Gibberellin-regulated protein 1 (GASA1) AT2G25060 Plastocyanin-like domain-containing protein AT2G41970 Protein kinase, putative similar to Pto kinase interactor 1 AT4G25220 Similar to glycerol-3-phosphate transporter (glycerol 3-phosphate permease) [Homo sapiens] AT1G59960 Aldo/keto reductase AT3G01390 Vacuolar ATP synthase subunit G 1 (VATG1) AT2G34080 Cysteine proteinase AT2G23630 Multi-copper oxidase type I family protein AT1G55020 Lipoxygenase (LOX1) AT2G46490 Expressed protein (APS2) identical to cDNA Aps2
20367_s_at 15985_at 20448_at 17832_at 16636_at 16253_at 17332_s_at 19631_at 14039_at 15357_at 17953_at 18970_at 19495_at 18998_at 16014_at 13529_at 14031_at 15021_at 12472_s_at 17994_r_at 12330_at 12352_at 13680_at 19999_s_at
Annotation
log2-fold change )3.89 )3.51 )3.09 )2.93 )2.61 )2.60 )2.51 )2.32 )2.21 )2.20 )2.18 )2.11 )2.09 )1.95 )1.74 )1.70 )1.57 )1.57 )1.53 )1.41 )1.33 )1.12 )1.10 )1.05 )1.01 )0.93 )0.90
Affymetrix probe set identification code (Probe ID), gene locus (Locus Identifier), functional annotation (Annotation) from TAIR (www.arabidopsis.org) and log2-fold change in expression levels of TSA over untreated are listed (log2-fold change) are listed.
Table 4. Genes selected using canonical variate analysis. Gene function
Probe ID
Locus
Group
Untreated
TSA treated
Ratio TSA/untreated
rd29B rab18 LEA AtEm1 LEA LEA LEA hsp 70
17407_s_at 16038_s_at 18872_at 17282_s_at 20641_at 19918_at 19152_at 13284_at
AT5G52300 AT5G66400 AT3G17520 AT3G51810 AT3G15670 AT1G52690 AT5G06760 AT3G12580
a b b b c c c c
212.45 1050 466.9 156.95 2342.7 3292.95 3188.05 1706.35
11268.8 29409.3 12882.75 3399.8 32009.5 41896.2 34208.15 15981.1
52.86 28.16 26.57 21.39 14.33 11.75 10.03 9.34
The predicted function of the protein encoded by the gene (gene function), Affymetrix probe set identification code (probe ID), gene locus (locus) are listed. The group label from Figure 1 is indicated (group). Averaged gene expression signal values from the Affymetrix Arabidopsis Genome array for seeds three DAI in the presence of TSA (TSA treated) absence of TSA (untreated) and the ratio of the TSA treated signal divided by the untreated signal (ratio TSA/untreated) are presented as the mean of two replicate experiments.
distributed together (group c) and six genes are distributed outside of the main area (groups a, b, and d). Four genes in groups a and b had high
values for CAN2 and two genes in group d had high CAN1 values. The group d genes had very high expression levels in both TSA and untreated
916 expression and it has no effect on gene expression at one DAI. The up-stream regions of the eight genes were analyzed for conserved DNA regulatory motifs and all the genes except HSP70 show the presence of the abscisic acid response element (ABRE), a cis-acting element that confers abscisic acid (ABA) inducible expression (Busk and Pages, 1998; Rock, 2000; Finkelstein et al., 2002) (Figure 3). Dynamic histone acetylation during seed imbibition
Figure 1. Distributions of genes based on scores of the first (CAN1) and second (CAN2) canonical scores. Groups of genes with similar scores are circled and labeled a–d.
treatments, but did not show high TSA/untreated ratios and were not included in further analyses. Validation of the data was done using RTqPCR for the four genes in groups a and b distributed along CAN2. The four genes encode rab18, rd29B, AtEm1, and a LEA protein (Table 4). Four other genes within group c were selected, three of these encode LEA proteins and one encodes hsp 70 (Table 4). All of the selected genes are among the genes showing up-regulation in the presence of TSA (Table 2). Gene expression was monitored in seeds one, three and six DAI in the presence and absence of TSA (Figure 2). Decreased expression of the eight selected genes during seed germination All eight genes show exponential decreases in gene expression upon seed imbibition, which is plotted on a logarithmic axis in Figure 2. The genes show rapid decrease in transcript levels from seed imbibition to three DAI, when expression is near basal levels. By three DAI transcript levels are at less than 10% of dry seed levels. Steady-state basal transcript levels are reached by three DAI for the ATEM1 gene (At3g51810) and for the other genes, transcript levels continue to decrease, but at a slower rate after 1 DAI. Expression of the genes at three and six DAI is higher in the presence of TSA, but TSA does not affect onset of the decrease in
An analysis of the acetylation and deacetylation of the eight genes during seed imbibition and seedling development was done using ChIP with the antiacetylated H4 antibody followed by quantitative PCR to quantify the amount DNA precipitated (ChIP/qPCR). Promoter regions targeted for ChIP analysis included the first ABRE in all the genes except for HSP70, which did not have an ABRE. The coding regions targeted for analysis were selected from a single exon. The results in Figure 4 show that acetylation of both the promoter and coding regions of the eight genes transiently decreases at one DAI and recovers by three DAI. In addition, acetylation levels of coding regions are either the same or higher than promoter regions. The effects of TSA on histone H4 acetylation during seed germination were also examined. Seeds were imbibed in the presence of TSA and used for ChIP/qPCR assays. Figure 4 shows that the deacetylation event at one DAI is blocked by TSA for the eight genes. TSA blocks deacetylation in both promoter and coding regions, similarly. The UBQ 11 gene expression levels are unchanged under a number of developmental and environmental conditions (Sun and Callis, 1997) and it is used as an expression control gene on the Affymetrix gene chip. The gene chip data shows that UBQ 11 gene did not undergo significant changes in gene expression in the presence of TSA (Supplementary material Table 1). We also examined the acetylation of the UBQ 11 gene in both the promoter and coding regions. Acetylation of UBQ 11 follows the same pattern as the other genes in the absence of TSA and is decreased at one DAI. In the presence of TSA, the acetylation of the coding region is blocked as observed for the other genes; however, the promoter region of UBQ 11 is not affected by TSA.
917
Figure 2. TSA affects gene repression during germination. RTqPCR was used to monitor gene expression of the 8 genes identified from the microarray analysis. Samples were taken at zero, one, three, and six DAI in the presence (dashed line) and absence (solid line) of TSA. qPCR was done in triplicate for each time point and relative expression values presented are the averages for each sample. Error bars represent standard deviation for the triplicate readings. The y-axis indicates relative expression values and the x-axis indicates the number of days after imbibition.
918 that TSA inhibits the histone deacetylase activity similarly with in vitro or in vivo TSA treatments indicating that treatment of live plants with TSA is effective. TSA does not affect gene expression when added at three DAI
Figure 3. Genes up-regulated by TSA share upstream ABRE. The figure shows a schematic diagram of the upstream region of each of the genes from )500 to 0. The boxes indicate the locations of the abscisic acid response element (ABRE). The gene locus and predicted gene function are indicated on the right.
Histone deacetylase activity during seed imbibition HDAC activity was examined in the presence and absence of TSA during seed imbibition (Figure 5). Seeds were imbibed on media for 6 h, 1 d, and 3 d. In the in vivo TSA treatment, seeds were imbibed on media containing 10 lM TSA; hence dry seeds at 0 DAI could not be treated with TSA in vivo. Lysates from imbibed seeds were prepared and assayed for HDAC activity. In the absence of TSA, HDAC activity decreases from slightly from dry seed to 6 h following imbibition then sharply increases four fold at one DAI in untreated imbibed seeds. HDAC activity levels fall again at three DAI to levels that are approximately the same as dry seeds. The timing of the rise in HDAC activity at one DAI coincides with the decrease in histone H4 acetylation of the eight genes observed in Figure 4. The in vivo TSA treatment resulted in a partial inhibition of HDAC activity. Decreased HDAC activity was detected at one DAI and three DAI in TSA treated over untreated samples with the largest inhibition (35%) induced one DAI. In vivo TSA treatment was compared with in vitro TSA treatment to check if the application of TSA in vivo was effective. In the in vitro TSA treatment, TSA was added to soluble lysates from seeds imbibed in the absence of TSA. By adding TSA to a soluble lysate, TSA does not have to penetrate plant tissues before binding to HDAC. The data in Figure 6 shows
The transient deacetylation of the eight genes and the rise in HDAC activity at one DAI indicated that this may be a critical time point for HDAC regulation of gene expression. In addition, Figure 5 demonstrates that TSA can block the deacetylation event at one DAI. We asked whether TSA would still be effective in up-regulating gene expression if it was added at three DAI instead 0 DAI. To address this question, dry seeds were initially imbibed on media without TSA for 3 days followed by transfer to TSA-containing media for an additional 3 days (3d–3d TSA, Figure 6A). The expression of the eight genes was examined in this sample and compared to control samples imbibed on media in the presence (6d TSA) or absence (6d untreated) of TSA for 6 days. We also asked whether up-regulation of gene expression in the presence of TSA is reversed after TSA is removed. For this experiment, dry seeds were imbibed on TSA-containing media for 3 days, then transferred to media without TSA for an additional 3 days and gene expression was examined (3d TSA–3d, Figure 6A). Figure 6B shows that gene expression is increased in seeds imbibed on TSA-containing media continuously for 6 days (6d TSA compared with 6d untreated). When TSA is added at three DAI (3d–3d TSA), expression of the eight genes is not increased, as the relative expression levels are the same as untreated imbibed seeds. Furthermore, withdrawal of TSA at three DAI (3d TSA–3d) returns expression levels for the eight genes 3 days later to levels that are the same as untreated imbibed seeds.
Discussion In our study we used TSA, an inhibitor of HDAC, to investigate the role of HDAC in controlling gene repression during seed germination. Gene chip analysis indicated that 45 genes are up-regulated in the presence of TSA and 27
919
Figure 4. ChIP of promoter and coding regions show dynamic histone acetylation during seed germination. DNA associated with acetylated histone H4 is immunoprecipitated with the anti-acetylated H4 antibody and primers specific promoter or coding regions for each gene are used to amplify DNA for quantitative PCR (ChIP/qPCR). The y-axis values are the relative quantities of DNA template. x-axis labels indicate the following: seeds at 6 h of imbibition (6 h), seeds one DAI (1 d) and seeds three DAI (3 d). The black bars are the amount of ChIP DNA from seeds that were imbibed in the absence of TSA and the gray bars are the amount of ChIP DNA from seeds that were imbibed in the presence of TSA. The DNA from seeds three DAI in the presence of TSA was used as for a control precipitation in the absence of antibody (No Ab). The locus and predicted function for each gene is located at the top of each pair of graphs. ChIP/qPCR data for the promoter region of each gene is in the graph on the left (promoter) and data for the coding region is in the graph on the right (coding). The average of amount of DNA for three replicates is presented and the error bars represent standard deviation.
genes are down-regulated (Tables 2 and 3). Among the genes with the highest up-regulation in the presence of TSA are genes highly expressed in dry, mature seeds and repressed during seed germination. These genes include LEA proteins, 12S seed storage proteins, hsp 70, and dehydrin (Galau and Hughes, 1987; Hughes and Galau, 1991; Parcy et al., 1994; Rouse et al., 1996;
Gallardo et al., 2001). The high expression of genes associated with dry, mature seeds in the presence of TSA correlates with the TSA-induced 1-day delay in germination observed (data not shown). However, expansin was also among the top TSA-up-regulated genes, but is associated with germination (Chen and Bradford, 2000) indicating that not all the genes that are up-
920
Figure 5. HDAC activity increases at one DAI and inhibited by TSA. HDAC activity was measured using an assay with an acetylated substrate that absorbs A405 when deacetylated. HDAC activity was measure at 0, 6 h, 1 day and 3 days after imbibition in the presence and absence of either in vivo or in vitro applied TSA. The bars represent HDAC activity measured by the amount of product formed at A405/mg protein. Values are the mean of six replicates and the error bars represent the standard deviation.
regulated by TSA are associated with expression in the dry, mature seed. The TSA down-regulated genes include those encoding ACC oxidase, gibberellin-regulated protein 1, extensin-like protein and peroxidases which are increased in expression during seed germination (Aubert et al., 1998; Dubreucq et al., 2000; Petruzzelli et al., 2000; Bellani et al., 2002; Morohashi, 2002). Other genes encode proteins that are associated with growth such as actin-depolymerizing factor (Chen et al., 2002). The association of TSA-down-regulated genes with germination and growth corresponds to the delay in germination and development with TSA treatment. It was desirable to examine the expression of a selected number of genes up-regulated by TSA in more detail. To select genes, canonical variate analysis was used to identify genes showing highly significant increases in expression in the presence of TSA. Four genes, RD29B, RAB18, ATEM1 and AT3G17520 were selected. RAB18 and RD29B are ABA responsive genes that are induced by desiccation and cold temperature (Lang, 1992, #291; Yamaguchi-Shinozaki, 1993, #290), and ATEM1 and AT3G17520 encode LEA proteins. Previous studies by others have shown that RAB18 and ATEM1 are induced during embryo development and accumulate to high levels in the dry, mature seed (Gaubier et al., 1993; Parcy et al., 1994; Vicient et al., 2000). LEA proteins, in general, are highly expressed during late seed maturation and repressed during germination (Galau and
Hughes, 1987; Hughes and Galau, 1991) and are thought to be involved in maintaining protein structure in the during periods of dehydration (Wise, 2003; Goyal et al., 2005). Our study focuses on genes showing repression during seed germination, hence three other genes encoding LEA proteins (AT3G15670, AT1G52690, and AT5G06760) were selected for analysis. HSP70, which encodes a heat-shock protein that is repressed during seed germination (Sung et al., 2001), was also included in our study. The transcript levels of the eight genes were examined using RTqPCR to confirm TSA effects on gene expression and to expand the analysis of gene expression over a time course. All eight genes were repressed exponentially during seed germination and TSA was found to inhibit repression for all genes examined. RD29B, RAB18, ATEM1, AT3G17520, AT3G15670, AT1G52690, and AT5G06760 contain an ABRE in the upstream region indicating that ABA is involved in the induction of gene expression for these genes (Giraudat et al., 1992; Busk and Pages, 1998). ABA plays an important role in embryo development, seed maturation and dormancy, and responses to environmental stresses such as cold, salt, and desiccation (Busk and Pages, 1998; Finkelstein et al., 2002). Nakabayashi et al. (2005) also identified many ABRE containing genes strongly repressed upon imbibition including the eight genes from this study and shows that the ABRE is the most prominent upstream element in the dry seed transcriptome. The strong repression of late maturation genes during seed germination indicates a diversion of metabolic resources away from desiccation tolerance and towards seedling growth. A subset of genes were found to be located in clusters and coregulated during seed imbibition (Nakabayashi et al., 2005). We did not find any evidence for gene clusters among the 72 genes affected by TSA. In addition, the gene chip data indicates that the genes adjacent to the eight selected genes are not coordinately expressed. Therefore, the evidence indicates that TSA does not target localized regions in the chromosome. The 72 genes differentially expressed in the presence of TSA from this study were not affected by TSA in another study with Arabidopsis thaliana (Chang and Pikaard, 2005). Many late maturation genes were up-regulated by TSA in our study, but
921
Figure 6. Effects of TSA removal and addition after 3 days. (A) TSA treatment of imbibing seeds was as follows: seeds imbibed for 6 days on media without TSA (6d untreated), seeds imbibed for 6 days on 10 lM TSA containing media (6d TSA), seeds imbibed for 3 days on media without TSA then transferred to media containing 10 lM TSA for 3 days (3d–3d TSA), seeds imbibed for 3 days on media containing10 lM TSA then removed to media without TSA for 3 days (3d TSA–3d). (B) RTqPCR was used to measure relative gene expression levels in seeds six DAI. The seeds were imbibed and treated as in ‘A’ and relative expression for each treatment are presented as follows: 6d untreated (dark gray bars), 6d TSA (light gray bars), 3d–3d TSA (white bars), and 3d TSA–3d (black bars). The locus and predicted protein function are indicated on the y-axis. The relative expression values represent the average over three replicates and the errors bars represent the standard deviation.
Chang and Pikaard (Chang and Pikaard, 2005) did not find up-regulation of this group of genes by TSA. A key difference between the two studies is the developmental stage of the plants – 16-day-old seedlings as opposed to germinated seeds at 3 DAI examined in this study. In addition, a lower
concentration of TSA was used in the study by Chang and Pikaard (Chang and Pikaard, 2005) (0.5 lM), which was based on the concentration known to derepress silenced rRNA genes in Arabidopsis thaliana. Ten micromoles of TSA was used in this study since it was the concentra-
922 tion found to induce a delay in germination and development of Arabidopsis thaliana seedlings (data not shown). Genes affected by TSA in a study in tobacco (Chua et al., 2004) were also different from those identified in Arabidopsis thaliana from our study and by Chang and Pikaard (Chang and Pikaard, 2005); however, a custom array with 88 genes was used in the tobacco study that was missing many of the genes that were identified as affected by TSA in Arabidopsis thaliana. Promoter-targeted acetylation and deacetylation involve localized changes in histone acetylation at promoter regions and are associated with increased and decreased gene expression, respectively (Struhl, 1998; Kurdistani and Grunstein, 2003). The promoter regions of the eight genes and the control gene, UBQ 11, are deacetylated at one DAI. TSA blocks the deacetylation of promoter regions for all eight genes but not UBQ 11, whose expression is also not affected by TSA. These results indicate that TSA affects promoter acetylation for genes whose expression is also affected by TSA. However, the timing of TSA effects on promoter acetylation and gene expression is not coordinated. TSA blocks deacetylation at one DAI, but the effect of TSA on gene expression is not observed until three DAI. One explanation is that transcript levels observed in the dry seed and at one DAI are due to high levels of stored mRNA (Nakabayashi et al., 2005). Therefore, TSA effects on de novo transcription will not be apparent until stored transcripts are further degraded at three DAI. Although, HDAC-mediated promoter-targeted deacetylation is a well characterized, HDAC may have other roles during seed germination. Histone acetylation, is not limited to promoter regions and occurs globally throughout the genome (Krebs et al., 2000; Kuo et al., 2000; Vogelauer et al., 2000). The function of global acetylation is not as well understood as promotertargeted acetylation. Studies in yeast show that global acetylation is involved in the regulation of basal transcription of the PHO5 gene (Vogelauer et al., 2000). Global acetylation and deacetylation is also involved in the restoration of acetylation to steady-state levels after the removal of transcriptional activators or repressors (Katan-Khaykovich and Struhl, 2002). The results presented here show that histone acetylation changes in the eight genes studied are not restricted to promoter regions
indicating that HDAC effects are not limited to promoter-targeted events. In addition, studies in tobacco also demonstrate that TSA affects acetylation at both upstream and coding regions (Chua et al., 2004). Therefore, HDAC may function during seed germination to control global histone acetylation levels and histone acetylation may be involved in restoring transcript levels after the removal of transcriptional activators such as ABI3 and ABI5, which are known to decrease after seed imbibition (Parcy et al., 1994; Lopez-Molina et al., 2001). The effect of TSA on histone acetylation is greatest at one DAI where it is observed to block a deacetylation event. TSA is also observed to increase acetylation levels at three DAI for some genes. Histone acetylation changes are also associated with the cell cycle (Waterborg and Matthews, 1983; Georgieva et al., 1991; Belyaev et al., 1997, 1998; Lusser et al., 1997; Jasencakova et al., 2000, 2001; Vogelauer et al., 2002; Wako et al., 2002l; Cimini et al., 2003; Li et al., 2005). During seed imbibition the cell cycle is reactivated after a period of arrest (Bewley and Black, 1985; de Castro et al., 2000) and the observed dynamic histone acetylation during seed germination may be associated with progression of the cell cycle. In addition, TSA inhibits cell cycle progression in tobacco protoplasts and pea meristems (Murphy et al., 2000; Li et al., 2005), which correlates with our observation that TSA delays seed germination by 1 day. Hence, the deacetylation of the eight late maturation genes may be associated with a global deacetylation event during mitosis and the TSA effect on repression of the eight genes is associated with cell cycle inhibition that induces a developmental delay. ChIP and HDAC assays demonstrate the occurrence of a transient deacetylation event during seed germination at one DAI, which can be blocked by TSA resulting in reduced repression of the eight genes studied at three and six DAI. Removal of TSA at three DAI restores expression to the same level as untreated seeds, indicating that TSA effects on are reversible. TSA was also added at three DAI after the deacetylation event, and was not found to affect the expression of the eight genes. Therefore, deacetylation at one DAI is a critical event in the regulation of the eight genes and may be a key process for seed germination.
923 Acknowledgements This work was supported by a grant from the Canadian Biotechnology Strategy, Regulatory Fund. The authors would like to thank Kathleen Forbes for her technical assistance and Dr. Xianzhou Nie for critically reviewing the manuscript.
References Ahringer, J. 2000. NuRD and SIN3 histone deacetylase complexes in development. Trends Genet. 16: 351–356. Allfrey, V.G., Faulkner, R. and Mirsky, A.E. 1964. Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc. Natl. Acad. Sci. USA 51: 786–794. Aubert, D., Chevillard, M., Dorne, A.-M., Arlaud, , G.r. and Herzog, M. 1998. Expression patterns of GASA genes in Arabidopsis thaliana: the GASA4 gene is up-regulated by gibberellins in meristematic regions. Plant Mol. Biol. 36: 871–883. Bartlett, M.S. 1947. The general canonical correlation distribution. Ann. Math. Stat. 18: 1–17. Bellani, L.M., Guarnieri, M. and Scialabba, A. 2002. Differences in the activity and distribution of peroxidases from three different portions of germinating Brassica oleracea seeds. Physiol. Plant. 114: 102–108. Belyaev, N.D., Houben, A., Baranczewski, P. and Schubert, I. 1997. Histone H4 acetylation in plant heterochromatin is altered during the cell cycle. Chromosoma 106: 193–197. Belyaev, N.D., Houben, A., Baranczewski, P. and Schubert, I. 1998. The acetylation patterns of histones H3 and H4 along Vicia faba chromosomes are different. Chromosome Res. 6: 59–63. Bewley, J.D. and Black, M. 1985. Seeds Physiology of Development and Germination. Plenum Press, New York. Brosch, G., Ransom, R., Lechner, T., Walton, J.D. and Loidl, P. 1995. Inhibition of maize histone deacetylases by HC toxin, the host- selective toxin of Cochliobolus carbonum. Plant Cell 7: 1941–1950. Busk, P.K. and Pages, M. 1998. Regulation of abscisic acidinduced transcription. Plant. Mol. Biol. 37: 425–435. Chang, S. and Pikaard, C.S. 2005. Transcript profiling in Arabidopsis reveals complex responses to global inhibition of DNA methylation and histone deacetylation. J. Biol. Chem. 280: 796–804. Chen, C.Y., Wong, E.I., Vidali, L., Estavillo, A., Hepler, P.K., Wu, , H.-m., and Cheung, A.Y. 2002. The Regulation of actin organization by actin-depolymerizing factor in elongating pollen tubes. Plant Cell 14: 2175–2190. Chen, F. and Bradford, K.J. 2000. Expression of an expansin is associated with endosperm weakening during tomato seed germination. Plant Physiol. 124: 1265–1274. Chen, Z.J. and Pikaard, C.S. 1997. Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and histone modification in nucleolar dominance. Genes Dev. 11: 2124–2136. Chua, Y.L., Brown, A.P.C. and Gray, J.C. 2001. Targeted histone acetylation and altered nuclease accessibility over
short regions of the pea plastocyanin gene. Plant Cell 13: 599–612. Chua, Y.L., Mott, E., Brown, A.P.C., MacLean, D. and Gray, J.C. 2004. Microarray analysis of chromatin-immunoprecipitated DNA identifies specific regions of tobacco genes associated with acetylated histones. Plant J 37: 789–800. Chua, Y.L., Watson, L.A. and Gray, J.C. 2003. The transcriptional enhancer of the pea plastocyanin gene associates with the nuclear matrix and regulates gene expression through histone acetylation. Plant Cell 15: 1468–1479. Cimini, D., Mattiuzzo, M., Torosantucci, L. and Degrassi, F. 2003. Histone hyperacetylation in mitosis prevents sister chromatid separation and produces chromosome segregation defects. Mol. Biol. Cell 14: 3821–3833. Comai, L. and Harada, J. 1990. Transcriptional activities in dry seed nuclei indicate the timing of the transition from embryogeny to germination. PNAS 87: 2671–2674. de Castro, R.D., van Lammeren, A.A.M., Groot, S.P.C., Bino, R.J. and Hilhorst, H.W.M. 2000. Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not. Plant Physiol. 122: 327– 336. Dubreucq, B., Berger, N., Vincent, E., Boisson, M., Pelletier, G., Caboche, M. and Lepiniec, L. 2000. The Arabidopsis AtEPR1 extensin-like gene is specifically expressed in endosperm during seed germination. Plant J. 23: 643–652. Finkelstein, R.R., Gampala, S.S.L. and Rock, C.D. 2002. Abscisic Acid signaling in seeds and seedlings. Plant Cell 14: S15–S45. Galau, G.A. and Hughes, D.W. 1987. Coordinate accumulation of homeologous transcripts of seven cotton Lea gene families during embryogenesis and germination. Dev. Biol. 123: 213–221. Gallardo, K., Job, C., Groot, S.P.C., Puype, M., Demol, H., Vandekerckhove, J. and Job, D. 2001. Proteomic analysis of Arabidopsis seed germination and priming. Plant Physiol. 126: 835–848. Gaubier, P., Raynal, M., Hull, G., Huestis, G.M., Grellet, F., Arenas, C., Pages, M. and Delseny, M. 1993. Two different Em-like genes are expressed in Arabidopsis thaliana seeds during maturation. Mol. Gen. Genet. 238: 409–418. Gautier, L., Cope, L., Bolstad, B.M. and Irizarry, R.A. 2004. affy – Analysis of affymetrix GeneChip data at the probe level. Bioinformatics 20: 307–315. Georgieva, E.I., Lopez-Rodas, G., Sendra, R., Grobner, P. and Loidl, P. 1991. Histone acetylation in Zea mays. II. Biological significance of post-translational histone acetylation during embryo germination. J. Biol. Chem. 266: 18751–18760. Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy, F. and Goodman, H.M. 1992. Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4: 1251–1261. Goyal, K., Walton, L.J. and Tunnacliffe, A. 2005. LEA proteins prevent protein aggregation due to water stress. Biochem. J. 388: 151–157. He, Y., Michaels, S.D. and Amasino, R.M. 2003. Regulation of flowering time by histone acetylation in Arabidopsis. Science 302: 1751–1754. Hebbes, T., Thorne, A. and Crane-Robinson, C. 1988. A direct link between core histone acetylation and transcriptionally active chromatin. EMBO J. 7: 1395–1402. Henderson, J.T., Li, H.-C., Rider, S.D., Mordhorst, A.P., Romero-Severson, J., Cheng, J.-C., Robey, J., Sung, Z.R., de Vries, S.C. and Ogas, J. 2004. PICKLE acts throughout the
924 plant to repress expression of embryonic traits and may play a role in gibberellin-dependent responses. Plant Physiol. 134: 995–1005. Hughes, D.W. and Galau, G.A. 1991. Developmental and environmental induction of Lea and LeaA mRNAs and the postabscission program during embryo culture. Plant Cell 3: 605–618. Imai, S., Armstrong, C.M., Kaeberlein, M. and Guarente, L. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403: 795–800. Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B. and Speed, T.P. 2003. Summaries of affymetrix GeneChip probe level data. Nucleic Acids Res. 31: 15. Jang, I.C., Pahk, Y.M., Song, S.I., Kwon, H.J., Nahm, B.H. and Kim, J.K. 2003. Structure and expression of the rice class-I type histone deacetylase genes OsHDAC1-3: OsHDAC1 overexpression in transgenic plants leads to increased growth rate and altered architecture. Plant J. 33: 531–541. Jasencakova, Z., Meister, A. and Schubert, I. 2001. Chromatin organization and its relation to replication and histone acetylation during the cell cycle in barley. Chromosoma 110: 83–92. Jasencakova, Z., Meister, A., Walter, J., Turner, B.M. and Schubert, I. 2000. Histone H4 acetylation of euchromatin and heterochromatin is cell cycle dependent and correlated with replication rather than with transcription. Plant Cell 12: 2087–2100. Jenuwein, T. and Allis, C.D. 2001. Translating the histone code. Science 293: 1074–1080. Johnson, L.M., Cao, X. and Jacobsen, S.E. 2002. Interplay between two epigenetic marks: DNA methylation and histone H3 lysine 9 methylation. Curr. Biol. 12: 1360–1367. Kadosh, D. and Struhl, K. 1998a. Histone deacetylase activity of Rpd3 is important for transcriptional repression in vivo. Genes Dev. 12: 797–805. Kadosh, D. and Struhl, K. 1998b. Targeted recruitment of the Sin3-Rpd3 histone deacetylase complex generates a highly localized domain of repressed chromatin in vivo. Mol. Cell. Biol. 18: 5121–5127. Katan-Khaykovich, Y. and Struhl, K. 2002. Dynamics of global histone acetylation and deacetylation in vivo: rapid restoration of normal histone acetylation status upon removal of activators and repressors. Genes Dev. 16: 743–752. Krebs, J.E., Fry, C.J., Samuels, M.L. and Peterson, C.L. 2000. Global role for chromatin remodeling enzymes in mitotic gene expression. Cell 102: 587–598. Kuo, M.-H., vom Baur, E., Struhl, K. and Allis, C.D. 2000. Gcn4 activator targets Gcn5 histone acetyltransferase to specific promoters independently of transcription. Mol. Cell 6: 1309–1320. Kuo, M.-H., Zhou, J., Jambeck, P., Churchill, M.E.A. and Allis, C.D. 1998. Histone acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo. Genes Dev. 12: 627–639. Kurdistani, S.K. and Grunstein, M. 2003. Histone acetylation and deacetylation in yeast. Nat. Rev. Mol. Cell Biol. 4: 276–284. Lawrence, R.J., Earley, K., Pontes, O., Silva, M., Chen, Z.J., Neves, N., Viegas, W. and Pikaard, C.S. 2004. A concerted DNA methylation/histone methylation switch regulates rRNA gene dosage control and nucleolar dominance. Mol. Cell 13: 599–609.
Lechner, T., Lusser, A., Brosch, G., Eberharter, A., GoralikSchramel, M. and Loidl, P. 1996. A comparative study of histone deacetylases of plant, fungal and vertebrate cells. Biochim. Biophys. Acta 1296: 181–188. Lescot, M., Dehais, P., Thijs, G., Marchal, K., Moreau, Y., Van de Peer, Y., Rouze, P. and Rombauts, S. 2002. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 30: 325–327. Li, Y., Butenko, Y. and Grafi, G. 2005. Histone deacetylation is required for progression through mitosis in tobacco cells. Plant J. 41: 346–352. Loidl, P. 2004. A plant dialect of the histone language. Trends Plant Sci. 9: 84–90. Lopez-Molina, L., Mongrand, S. and Chua, N.-H. 2001. A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. PNAS 98: 4782–4787. Lusser, A., Brosch, G., Lopez-Rodas, G. and Loidl, P. 1997. Histone acetyltransferases during the cell cycle and differentiation of Physarum polycephalum. Eur. J. Cell Biol. 74: 102–110. Morohashi, Y. 2002. Peroxidase activity develops in the micropylar endosperm of tomato seeds prior to radicle protrusion. J. Exp. Bot. 53: 1643–1650. Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473–497. Murphy, J.P., McAleer, J.P., Uglialoro, A., Papile, J., Weniger, J., Bethelmie, F. and Tramontano, W.A. 2000. Histone deacetylase inhibitors and cell proliferation in pea root meristems. Phytochemistry 55: 11–18. Nakabayashi, K., Okamoto, M., Koshiba, T., Kamiya, Y. and Nambara, E. 2005. Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. Plant J. 41: 697–709. Nambara, E., Hayama, R., Tsuchiya, Y., Nishimura, M., Kawaide, H., Kamiya, Y. and Naito, S. 2000. The role of ABI3 and FUS3 loci in Arabidopsis thaliana on phase transition from late embryo development to germination. Dev. Biol. 220: 412–423. Ogas, J., Cheng, J.-C., Sung, Z.R. and Somerville, C. 1997. Cellular differentiation regulated by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277: 91–94. Ogas, J., Kaufmann, S., Henderson, J. and Somerville, C. 1999. PICKLE is a CHD3 chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc. Natl. Acad. Sci. USA 96: 13839–13844. Pandey, R., Muller, A., Napoli, C.A., Selinger, D.A., Pikaard, C.S., Richards, E.J., Bender, J., Mount, D.W. and Jorgensen, R.A. 2002. Analysis of histone acetyltransferase and histone deacetylase families of Arabidopsis thaliana suggests functional diversification of chromatin modification among multicellular eukaryotes. Nucleic Acids Res. 30: 5036–5055. Parcy, F., Valon, C., Raynal, M., Gaubier-Comella, P., Delseny, M. and Giraudat, J. 1994. Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 6: 1567–1582. Petruzzelli, L., Coraggio, I. and Leubner-Metzger, G. 2000. Ethylene promotes ethylene biosynthesis during pea seed germination by positive feedback regulation of 1-aminocyclo-propane-1-carboxylic acid oxidase. Planta 211: 144–149.
925 Richon, V.M., Sandhoff, T.W., Rifkind, R.A. and Marks, P.A. 2000. Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. PNAS 97: 10014–10019. Rider, D.S., , Jr., Henderson, J.T., Jerome, R.E., Edenberg, H.J., Romero-Severson, J. and Ogas, J. 2003. Coordinate repression of regulators of embryonic identity by PICKLE during germination in Arabidopsis. Plant J 35: 33–43. Rock, C.D. 2000. Pathways to abscisic acid-regulated gene expression. New Phytol. 148: 357. Rombauts, S., Dehais, P., Van Montagu, M. and Rouze, P. 1999. PlantCARE, a plant cis-acting regulatory element database. Nucleic Acids Res. 27: 295–296. Rouse, D.T., Marotta, R. and Parish, R.W. 1996. Promoter and expression studies on an Arabidopsis thaliana dehydrin gene. FEBS Lett. 381: 252–256. Rundlett, S.E., Carmen, A.A., Suka, N., Turner, B.M. and Grunstein, M. 1998. Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392: 831–835. Smyth, G.K. 2004. Linear Models and Empirical Bayesmethods for Assessing Differential Expression in Microarray Experiments Statistical Applications in Genetics and Molecular Biology,No. 1, Article 3. Berkeley Electronic Press, Berkeley, CA, pp. 1–25. Soeda, Y., Konings, M.C.J.M., Vorst, O., van Houwelingen, A.M.M.L., Stoopen, G.M., Maliepaard, C.A., Kodde, J., Bino, R.J., Groot, S.P.C. and van der Geest, A.H.M. 2005. Gene expression programs during Brassica oleracea seed maturation, osmopriming, and germination are indicators of progression of the germination process and the stress tolerance level. Plant Physiol. 137: 354–368. Sterner, D.E. and Berger, S.L. 2000. Acetylation of histones and transcription-related factors. Microbiol. Mol. Biol. Rev. 64: 435–459. Stockinger, E.J., Mao, Y., Regier, M.K., Triezenberg, S.J. and Thomashow, M.F. 2001. Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interactions with CBF1, a transcriptional activator involved in cold-regulated gene expression. Nucleic Acids Res. 29: 1524–1533. Struhl, K. 1998. Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12: 599–606. Sun, C.-W. and Callis, J. 1997. Independent modulation of Arabidopsis thaliana polyubiquitin mRNAs in different organs and in response to environmental changes. Plant J 11: 1017–1027. Sung, D.Y., Vierling, E. and Guy, C.L. 2001. Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. Plant Physiol. 126: 789–800. Tai, H.H., Pelletier, C. and Beardmore, T. 2004. Total RNA isolation from Picea marianna dry seed. Plant Mol. Biol. Report. 22: 93. Taunton, J., Hassig, C.A. and Schreiber, S.L. 1996. A mammalian histone deacetylase related to the yeast transcriptional regulator Rpd3p. Science 272: 408–411. Thijs, G., Marchal, K., Lescot, M., Rombauts, S., De Moor, B., Rouze, P. and Moreau, Y. 2002a. A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes. J. Comput. Biol. 9: 447–464.
Thijs, G., Moreau, Y., De Smet, F., Mathys, J., Lescot, M., Rombauts, S., Rouze, P., De Moor, B. and Marchal, K. 2002b. INCLUSive: INtegrated Clustering, Upstream sequence retrieval and motif Sampling. Bioinformatics 18: 331–332. Tian, L. and Chen, Z.J. 2001. Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development. Proc. Natl. Acad. Sci. USA 98: 200– 205. Tian, L., Fong, M.P., Wang, J.J., Wei, N.E., Jiang, H., Doerge, R.W. and Chen, Z.J. 2004. Reversible histone acetylation and deacetylation mediate genome-wide, promoter-dependent, and locus-specific changes in gene expression during plant development. Genetics 169: 337–345. Turner, B.M. 1993. Decoding the nucleosome. Cell 75: 5–8. Vicient, C.M., Hull, G., Guilleminot, J., Devic, M. and Delseny, M. 2000. Differential expression of the Arabidopsis genes coding for Em-like proteins. J. Exp. Bot. 51: 1211– 1220. Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B.J. and Grunstein, M. 2002. Histone acetylation regulates the time of replication origin firing. Mol. Cell 10: 1223–1233. Vogelauer, M., Wu, J., Suka, N. and Grunstein, M. 2000. Global histone acetylation and deacetylation in yeast. Nature 408: 495–498. Wako, T., Fukuda, M., Furushima-Shimogawara, R., Belyaev, N.D. and Fukui, K. 2002. Cell cycle-dependent and lysine residue-specific dynamic changes of histone H4 acetylation in barley. Plant Mol. Biol. 49: 645–653. Waterborg, J.H. and Matthews, H.R. 1983. Patterns of histone acetylation in the cell cycle of Physarum polycephalum. Biochemistry 22: 1489–1496. Wise, M. 2003. LEAping to conclusions: a computational reanalysis of late embryogenesis abundant proteins and their possible roles. BMC Bioinformat. 4: 52. Wolffe, A.P. 1992. Chromatin: Structure and Function. Academic Press, London, England. Wu, K., Malik, K., Tian, L., Brown, D. and Miki, B. 2000a. Functional analysis of a RPD3 histone deacetylase homologue in Arabidopsis thaliana. Plant Mol. Biol. 44: 167–176. Wu, K., Tian, L., Malik, K., Brown, D. and Miki, B. 2000b. Functional analysis of HD2 histone deacetylase homologues in Arabidopsis thaliana. Plant J. 22: 19–27. Yoshida, M., Horinouchi, S. and Beppu, T. 1995. Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays 17: 423–430. Yoshida, M., Kijima, M., Akita, M. and Beppu, T. 1990. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J. Biol. Chem. 265: 17174–17179. Zhou, C., Labbe, H., Sridha, S., Wang, L., Tian, L., LatoszekGreen, M., Yang, Z., Brown, D., Miki, B. and Wu, K. 2004. Expression and function of HD2-type histone deacetylases in Arabidopsis development. Plant J. 38: 715–724. Zhou, C., Zhang, L., Duan, J., Miki, B. and Wu, K. 2005. HISTONE DEACETYLASE19 is involved in jasmonic acid and ethylene signaling of pathogen response in Arabidopsis. Plant Cell 17: 1196–1204.
