Biofouling The Journal of Bioadhesion and Biofilm Research
ISSN: 0892-7014 (Print) 1029-2454 (Online) Journal homepage: http://www.tandfonline.com/loi/gbif20
Effect of reserpine on Pseudomonas aeruginosa quorum sensing mediated virulence factors and biofilm formation Debaprasad Parai, Malabika Banerjee, Pia Dey, Arindam Chakraborty, Ekramul Islam & Samir Kumar Mukherjee To cite this article: Debaprasad Parai, Malabika Banerjee, Pia Dey, Arindam Chakraborty, Ekramul Islam & Samir Kumar Mukherjee (2018): Effect of reserpine on Pseudomonas aeruginosa quorum sensing mediated virulence factors and biofilm formation, Biofouling To link to this article: https://doi.org/10.1080/08927014.2018.1437910
View supplementary material
Published online: 27 Feb 2018.
Submit your article to this journal
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=gbif20
Biofouling, 2018 https://doi.org/10.1080/08927014.2018.1437910
Effect of reserpine on Pseudomonas aeruginosa quorum sensing mediated virulence factors and biofilm formation Debaprasad Parai , Malabika Banerjee, Pia Dey, Arindam Chakraborty, Ekramul Islam and Samir Kumar Mukherjee Department of Microbiology, University of Kalyani, Kalyani, India
ARTICLE HISTORY
ABSTRACT
This study aimed to evaluate the effect of reserpine, a plant-derived indole-alkaloid, against Pseudomonas aeruginosa PAO1 biofilms. The anti-biofilm activity of reserpine was evaluated by crystal violet staining, MTT assay, confocal laser scanning microscopy and scanning electron microscopy. Reserpine effects were also assessed by qRT-PCR of quorum sensing (QS)-regulated genes and biochemical quantification of the QS-mediated virulence factors pyocyanin, rhamnolipids, proteases and elastases. Reserpine reduced biofilm formation, cell motility, virulence factor production, and QS-controlled gene expression. Additionally, molecular docking analysis for AHL synthase LasI and QS transcriptional regulators LasR/MvfR revealed a plausible molecular mechanisms of reserpine QS inhibition. These findings provide insights into the underlying mode of action of reserpine, which may be useful in the development of new drugs against biofilm-related infections.
Introduction Pseudomonas aeruginosa is considered a major clinical concern due to its opportunistic nature to cause acute and chronic human infections including cystic fibrosis, bronchiectasis, pneumonia and bacteraemia, particularly in immune-compromised patients (Rashid and Kornberg 2000; Kerr and Snelling 2009). The ability of this pathogen to form biofilms makes it difficult to eradicate, leading to chronic nosocomial infections (Donlan and Costerton 2002; Høiby et al. 2010). Biofilm cells are usually resistant to antibiotics due to the biofilm-associated physical barrier which hinders drug penetration. A biofilm also creates an altered microenvironment that helps the pathogen to escape the host’s immune defence (Høiby et al. 2010; Bjarnsholt et al. 2013). Moreover, it makes P. aeruginosa a more resilient pathogen by the production of several virulence factors such as extracellular polymeric substances (EPS), lipopolysaccharides, pyocyanin, rhamnolipids, proteases, lipases, elastases, extracellular DNA, and type IV pili (Wagner et al. 2007; Balasubramanian et al. 2013). These factors are highly dependent on a sensory system known as quorum sensing (QS) (Borges et al. 2017). Such sensing depends on the production, release and grouplevel detection of self-generated signalling chemicals in response to the bacterial population density that eventually
KEYWORDS
Reserpine; Pseudomonas aeruginosa; anti-biofilm; antivirulence; qRT-PCR; molecular docking
orchestrates relevant gene expression (Williams et al. 2007; Ng and Bassler 2009). P. aeruginosa relies on two N-acyl-homoserine lactone (AHL) dependent QS systems having two pairs of LuxR/I homologs known as LasR/I and RhlR/I, both acting as transcriptional activators in a hierarchical manner (Wagner et al. 2007; Balasubramanian et al. 2013). Another type of QS signal molecule, 2-alkyl4-quinolone (AQ or Pseudomonas quinolone signal: PQS) is produced by P. aeruginosa and plays a significant role in biofilm development. The pqsABCDE operon regulates the synthesis and action of PQS genes through a transcriptional regulator PqsR (mvfR) that is further positively controlled by LasR (Dubern and Diggle 2008). The reckless use of conventional antibiotics triggers drug resistance among bacterial pathogens and these antibiotics can even stimulate biofilm formation (Hoffman et al. 2005; Nucleo et al. 2009). Thus, the present therapeutic strategies are not only constrained in combating drug resistance, but also in eradicating bacterial biofilms (Simões et al. 2009). Currently, an interest in alternative therapeutic approaches has arisen where natural products, mainly phytochemicals or their derivatives, have been targeted to address their antimicrobial properties (Abreu et al. 2012; Cragg and Newman 2013). These phytochemicals are less toxic, have a high chemical group diversity and biochemical specificity and hence possess an advantage
CONTACT Samir Kumar Mukherjee
[email protected] Supplemental data for this article can be accessed here at https://doi.org//10.1080/08927014.2018.1437910 © 2018 Informa UK Limited, trading as Taylor & Francis Group
Received 22 September 2017 Accepted 1 February 2018
2
D. PARAI ET AL.
over conventional antibiotics (Koehn and Carter 2005). Plant-derived alkaloids are structurally diverse groups and serve as lead sources of many antibacterial drugs (Gibbons 2004; Özçelik et al. 2011). Among several known natural alkaloids, a few have been documented to have antibacterial potential against certain pathogens (Gibbons 2004; Simões et al. 2009; Cushnie et al. 2014). Reserpine is an indole-alkaloid found mainly in the flowering plant Rauwolfia serpentina (Chen and Huang 2005) and has been reported as an antidepressant, antihypertensive, antitumor and antimalarial agent (Davies and Shepherd 1955; Kumari et al. 2013). A few reports have documented reserpine as an efflux pump inhibitor and antibacterial agent (Gibbons 2004; Begum et al. 2012; Negi et al. 2014; Li et al. 2016). The goal of this work was to assess the anti-biofilm activity of reserpine on P. aeruginosa. Molecular docking and biochemical experiments were performed to evaluate the QS-impairing abilities and antivirulence activities of reserpine together with a transcriptional-level expression study of selected QS-controlled genes. The effect of reserpine on biofilm development, EPS production, pellicle formation and motility were also examined for a more comprehensive evaluation.
Materials and methods Reagents Reserpine, dimethyl sulfoxide (DMSO), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), sodium dodecyl sulphate (SDS), paraformaldehyde, orcinol, elastin Congo red (ECR) and skim milk powder were purchased from Sigma-Aldrich (Bengaluru, India). Congo red dye, agar powder, ethanol, methanol, chloroform, hydrochloric acid, sulfuric acid, diethyl ether and glacial acetic acid were procured from Merck (Mumbai, India). All molecular reagents were obtained from Thermo Fisher Scientific (Mumbai, India). Crystal violet, Luria Bertani (LB) broth, Mueller Hinton (MH) broth and tryptone medium were obtained from HiMedia (Mumbai, India). Bacterium and culture conditions Pseudomonas aeruginosa PAO1 (ATCC 15692) was obtained from the American Type Culture Collection (ATCC) and used as a model organism in this study. Bacterial cultures were grown in LB medium at 37°C under aerobic conditions at 150 rpm in a mechanical shaker (MaxQ 6000, Thermo Scientific, Marietta, OH, USA) for 16 h. Stock culture was maintained at −80°C in 25% glycerol.
Minimum inhibitory concentration (MIC) The antimicrobial susceptibility test was performed by a microdilution method in a 96-well microtitre plate (Tarsons, Mumbai, India) following Clinical and Laboratory Standards Institute guidelines (CLSI 2012). Briefly, standard inoculums of 5 × 105 colony forming units (CFU ml−1) from a 16 h old bacterial cell suspension (OD600 = 1.5, diluted by 1:30 with fresh medium) were inoculated in the wells containing MH broth. While the positive control sets were prepared with the same proportion of inoculum and DMSO (v v−1, maximum concentration 4%), the negative control only had DMSO. Different concentrations of the test compound were prepared and inoculated into the wells marked as treated sets. The wells were incubated for 24 h at 37°C, the optical density (OD) was recorded at 600 nm in a microtitre plate reader (Multiskan EX®, Thermo Scientific, Vantaa, Finland) and the MIC was determined. MIC was defined as the lowest concentration of the test compound that inhibited the bacterial population growth (OD600 < 0.05). The inhibitory concentrations IC25 (25% growth inhibition), IC50 (50% growth inhibition) and IC80 (80% growth inhibition) were calculated from the graph with the help of statistical fit models. IC50 was calculated both from linear and nonlinear fit models of the dose-dependent growth curve; IC25 and IC80 were calculated from the linear fit model equation. The minimum bactericidal concentration (MBC) was determined by the drop method. Here, the MIC plated cultures were further inoculated from each well onto MH agar plates and observed after 24 h. The MBC was defined as the lowest concentration that killed all the bacterial cells within that population (Parai et al. 2017). Bacterial time-kill curve Time-kill curves were obtained after treating P. aeruginosa PAO1 cells in log phase (OD600 = 0.4) with three selected sub-MIC concentrations viz. 200 μg ml−1, 400 μg ml−1 and 600 μg ml−1 (Kwieciński et al. 2009). Untreated bacterial cultures with only DMSO (v v−1, same proportions) were considered as vehicle controls. Every 60 min, 10 μl of culture were removed from each tube and plated onto LB agar plate after dilution. Viable cell numbers were determined following dilution plate method and presented as CFU ml−1. Crystal violet assay Biofilm eradication was quantified by the method described in Stepanović et al. (2007). Freshly prepared bacterial cells from the mid-log phase were inoculated in a sterile 96-well microtitre plate after adjusting the OD600 to
BIOFOULING
0.1 and incubated in LB supplemented with 0.5% glucose for 24 h to allow biofilm formation. After incubation, the medium was discarded without disturbing the adhered cells and fresh medium containing different concentrations (100–800 μg ml−1) of reserpine were poured, maintaining the appropriate vehicle control sets. Following incubation at 37°C for another 24 h, the contents of each well were drawn and washed with 200 μl of 0.01 mol l−1 phosphate buffered saline (PBS, pH = 7.4). The remaining attached bacteria were fixed with 200 μl methanol for 15 min and the wells were then stained with 200 μl of 2% Hucker crystal violet for 5 min. Biofilm matrix on the well-surface was gently washed with sterilised water and dried at room temperature. Crystal violet bound to the matrix was re-solubilised with 200 μl of 33% (v v−1) glacial acetic acid and the absorbance was determined at 570 nm. For studying the inhibitory effect of reserpine on biofilm formation, a diluted suspension of overnight-grown culture was inoculated into the wells containing fresh LB medium with different concentrations of reserpine (100– 800 μg ml−1) and incubated at 37°C for 24 h (Saising et al. 2012). The biofilm cells attached to the wells were stained using 2% Hucker crystal violet and absorbance was measured as described above. MTT reduction assay The metabolic activities of viable biofilm cells were assessed by the MTT assay method (Saising et al. 2012). Bacterial biofilms were developed and treated with reserpine as described in the crystal violet assay. Medium was aspirated from each well after incubation and the adhered biofilms were washed with PBS (0.01 mol l−1). A volume of 200 μl of fresh medium containing MTT reagent (0.5 mg ml−1) was added to the wells and incubated in dark for 2 h at 37°C. Then, the solution was discarded and 200 μl of DMSO were added to each well to solubilise the developed formazan crystals, and mixed properly. Absorbance was measured at 570 nm in a microtitre plate reader.
3
modifications. The LB agar plates having 0.3% agar (w v−1) were prepared and bacterial suspensions (grown in LB for 16 h) supplemented with or without reserpine were point inoculated with sterilised needles. The inoculated plates were incubated at 37°C for 16 h. The diameter of radial colony growth was measured from the inoculation point as an attribute of swimming behaviour. For the swarming motility assay, treated or untreated bacterial cell suspensions were point inoculated as described earlier to swarm on LB plates having 0.5% glucose (w v−1) and 0.5% agar (w v−1). Plates were incubated at 37°C for 16 h to assess swarming motility. Pellicle formation assay Pellicle formation was assessed as described earlier (Friedman and Kolter 2004). Briefly, 5 ml of LB containing 0.5% glucose were inoculated with P. aeruginosa PAO1 in glass tubes (18 mm × 150 mm, Borosil®, Borosil Glass Works Ltd., Kolkata, India). The IC25, IC50 and IC80 of reserpine were added to the treatment sets and the same proportions of DMSO were added to the control sets. The tubes were incubated vertically at 37°C without any mechanical shaking. Pellicle formation at the air–liquid interface was visually observed after 72 h. Congo red binding assay Production of EPS was estimated by the Congo red binding method of Goswami et al. (2014) with minor modification. Biofilms were grown as mentioned earlier; subsequently, reserpine was added at test concentrations (IC50 and IC80) to the developed biofilms and incubated for 24 h at 37°C. Planktonic cells were discarded and the adhered cells were washed with PBS. Congo red (1%, w v−1) was added to each well and following incubation in the dark for 30 min the extra dye was discarded. DMSO (200 μl) was added to each well to solubilise the bound dye and the absorbance was measured at 490 nm in a plate reader. Biofilm detachment assay
Colony morphology and motility assays Bacterial cultures were inoculated in tryptone broth medium (supplemented with 0.5% glucose) with or without reserpine for 16 h and the cell suspensions were then spotted with sterilised needles onto tryptone agar plates having 40 μg ml−1 of Congo red, 20 μg ml−1 of Coomassie brilliant blue, 0.5% glucose and 1% agar. The plates were incubated at 37°C for 72 h and colony morphologies were observed (Kim and Park 2013). The swimming and swarming motility were assayed as described earlier (Rashid and Kornberg 2000), with minor
Biofilm detachment assay was done according to Davies (1998). Briefly, biofilms were grown as mentioned previously and subsequently exposed to reserpine at IC50 and IC80. Treatment with the same proportion of DMSO was considered as a control. SDS (4 μl of 10% solution) was then added to each well, and the mixture was incubated for 30 min. After incubation, the OD600 was measured for the suspended bacterial cells. The loosely adhered cells were then discarded and the wells were washed with PBS. The remaining attached biofilms were quantified by the crystal violet assay method as mentioned above.
4
D. PARAI ET AL.
Microscopic analysis For scanning electron microscopy (SEM), sample preparation was done following Parai et al. (2017). P. aeruginosa PAO1 was allowed to form biofilms on the glass coverslips (12 mm, Blue Star, Mumbai, India) and subsequently treated with reserpine (IC50 and IC80) for 24 h. Biofilms were fixed with freshly prepared 2% depolymerised paraformaldehyde for 30 min and washed with distilled water. The coverslips were then dehydrated with an increasing concentration series of ethanol (50–100%) for 10 min in each concentration. Images were captured by SEM (EVO® LS 10, Zeiss, Jena, Germany) and analysed by smartSEM graphical user interface software. The imaging conditions were 5–10 kV acceleration potential, 10–15 mm working distance, 50–100 pA probe current and 6,000×/13,000× magnification. For confocal laser scanning microscopy (CLSM), biofilms were grown on glass coverslips following the methods as in the SEM study (Parai et al. 2017). Control and treated biofilms were incubated in the dark for 30 min after staining with 1% Congo red to visualise the biofilm matrix. Coverslips were then rinsed thoroughly with PBS (0.01 mol l−1), air dried and mounted on glass slides which were then observed under CLSM (Leica TCS SP8, Leica Microsystems, Wetzlar, Germany) using a 63× oil immersion objective. Images were captured at an excitation wavelength of 488 nm and an emission wavelength of 600–630 nm for the detection of Congo red dye. Each set of biofilms was scanned at three different fields barring the edges; z-stacking images were captured by vertical sectioning through the biofilms. The images were analysed by Leica application suite X (LAS X) software to generate a 3-D view. Bio-volume and average thickness were analysed using COMSTAT2 (ImageJ, 1.48v, https:// imagej.nih.gov/ij/). Assay for virulence factors Bacterial cells (OD600 = 0.4) were inoculated into LB broth containing reserpine (100, 200, 400 and 600 μg ml−1) and incubated for 16 h at 37°C and 150 rpm. Vehicle control sets were prepared using the same proportion of DMSO. After incubation, cells were harvested by centrifugation at 10,000 g for 8 min at 4°C. Supernatants were collected and filtered through a 0.22 μm syringe filter (EMD Millipore, Burlington, MA, USA). Biofilm-associated virulence factors (pyocyanin, rhamnolipids, proteases and elastases) were assessed subsequently using this filtrate. Pyocyanin assay This test was performed to measure the production of pyocyanin pigment as described by Essar et al. (1990), with some modifications. The cell-free filtrate was added
to 3 ml of chloroform, mixed with 1 ml of 0.2 M hydrochloric acid and centrifuged at 10,000 g for 2 min at 4°C. The top layer was transferred to a fresh tube and absorbance was measured at 520 nm (SpectraMax M5, Molecular Devices, San Jose, CA, USA). Production of pyocyanin was calculated as the ratio between the Absorbancetreated and the Absorbancecontrol. Rhamnolipid assay Rhamnolipids production was determined by the orcinol method as described earlier (Gutierrez et al. 2013). Briefly, 500 μl of culture filtrate were extracted twice with 1.5 ml of diethyl ether by vortexing and centrifuging at 10,000 g for 8 min at 4°C consecutively. The supernatant was discarded and the remainder was dissolved in 100 μl of distilled water, after drying. The resulting solution was mixed with 100 μl of 1.7% orcinol and 800 μl of 60% (v v−1) sulphuric acid. The mixture was heated at 80°C in a water bath for 30 min and then cooled down to room temperature. The absorbance was measured at 420 nm. Production of rhamnolipid was assessed as the ratio between the Absorbancetreated and the Absorbancecontrol. Protease assay The total proteolytic activity of the filtrate was evaluated according to El-Mowafy et al. (2014). Briefly, 500 μl of filtrate were added to 1 ml of 1.25% skimmed milk and kept at 37°C for 30 min. Turbidity was measured at 600 nm. Production of protease was calculated as the ratio between the Turbiditytreated and Turbiditycontrol. Elastase assay The elastase activity of the filtrate was estimated using ECR by the method previously described (Ohman et al. 1980). In brief, 500 μl of filtrate were added to 500 μl of ECR buffer (100 mM Tris-HCl, pH 7.5) containing 10 mg of ECR. The mixture was then kept for 6 h with mechanical shaking at 37°C. Insoluble ECR was pelleted by centrifugation at 1,200 g for 10 min. The supernatant was collected and absorbance was measured at 495 nm. Production of elastase was assessed as the ratio between the Absorbancetreated and the Absorbancecontrol. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) P. aeruginosa PAO1 cells were incubated either with DMSO or reserpine (400 and 600 μg ml−1 as IC50 and IC80 respectively) for 24 h without mechanical shaking and total RNA was isolated from the treated biofilm cells using TRIzol® reagent (Invitrogen™, Carlsbad, CA, USA). The isolated RNA was reverse transcribed to cDNA using Verso cDNA synthesis kit (Thermo Fisher Scientific, Carlsbad, CA, USA) following the manufacturer’s protocol. The pooled
BIOFOULING
cDNAs were then amplified with housekeeping 16S rRNA gene to assess its qualities and a negative control set (with purified total RNA as a template only) was kept to check for any genomic DNA contamination. Real-time PCR was performed with PowerUp™ SYBR® master mix (Applied Biosystems, Austin, TX, USA) using respective primers (Table 1) in StepOnePlus™ Real-Time PCR system (Applied Biosystems). Conditions for qRT-PCR were as follows: 50°C for 2 min, initial denaturation at 94°C for 10 min, and 40 cycles at 94°C of 15 s and at 60°C for 1 min. The copy numbers of each gene were calculated from the critical threshold cycle (CT) values using a relative standard curve method as described earlier (Lee et al. 2008). The expression of each gene of interest was then normalised to the same of 16S rRNA which was referred to as endogenous reference gene. The obtained data were then compared to the treatments as well as with vehicle control to determine the relative changes in gene expression. Molecular docking study of reserpine with LasR, LasI and MvfR Molecular docking was performed with three P. aeruginosa QS-controlled proteins as receptors and reserpine as a small ligand. The crystallographic structures of LasR (PDB ID: 3IX3 chain A, resolution = 1.4 Å), LasI (PDB ID: 1RO5, resolution = 2.3 Å) and MvfR (PDB ID: 4JVC, resolution = 2.5 Å) were downloaded from RCSB Protein Data Bank (PDB) [https://www.rcsb.org/pdb] with their native ligand. Three-dimensional conformer of reserpine (NCBI Table 1. List of target genes and their respective primers used for qRT-PCR analysis. Target gene 16S rRNA
Primer type Forward Reverse
lasR
Forward Reverse
lasI
Forward Reverse
rhlR
Forward Reverse
rhlI
Forward Reverse
mvfR
Forward Reverse
Sequence (5′→3′) CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGGCA ACGCTCAAGTGGAAAATTGG GTAGATGGACGGTTCCCAGA CTACAGCCTGCAGAACGACA ATCTGGGTCTTGGCATTGAG AGGAATGACGGAGGCTTTTT CCCGTAGTTCTGCATCTGGT CTCTCTGAATCGCTGGAAGG GACGTCCTTGAGCAGGTAGG AACCTGGAAATCGACCTGTG TGAAATCGTCGAGCAGTACG
Amplicon size (bp) 193
241
168
231
240
238
5
PubChem CID: 5770) was obtained from PubChem [https://pubchem.ncbi.nlm.nih.gov] and was used as the ligand after energy minimisation. Before conducting the docking procedure, the native crystal ligands and water molecules were removed from the protein–ligand complexes, hydrogen atoms were added and side chain bumps of amino acid residues were fixed in Molegro molecular viewer 2.5 (CLC bio, Aarhus, Denmark). Docking was performed with the shape complementarity based algorithm Patchdock, and the top 10 structures were refined using a scoring function that considered both geometric fit and atomic desolvation energy (Schneidman-Duhovny et al. 2005). Default clustering root mean square deviation value was used to avoid the redundancy in resulting docked solutions. The molecular interactions analysis, production of structural graphics and figures were performed using Discovery Studio Visualizer v17.2.0 (Dassault Systèmes Biovia Corp., San Diego, CA, USA, 2017) and PyMOL (The PyMOL Molecular Graphics System, Version 1.3, Schrödinger, LLC, Portland, OR, USA). The active sites of the enzymes were defined using a radius of 5 Å around natural ligand which was extracted from the PDB. Statistical analysis Descriptive statistical analyses were performed using GraphPad Prism 7.03 for Windows (GraphPad Software, La Jolla, CA, USA), considering each set as one treatment regime with three replications. Statistical differences were calculated by comparing treatments with their respective controls using analysis of variance (ANOVA) followed by Tukey’s multiple comparison tests. p values
