Curr. Issues Mol. Biol. 14: 1-8.
Cloning of Alternatively Polyadenylated Transcripts 1 Online journal at http://www.cimb.org
Efficient Cloning of Alternatively Polyadenylated Transcripts via Hybridization Capture PCR Theodoros N. Rampias1, Emmanuel G.Fragoulis and Diamantis C. Sideris* University of Athens, Faculty of Biology, Department of Biochemistry and Molecular Biology, Panepistimioupolis, 15701, Athens, Greece 1 Present address: Biomedical Research Foundation of the Academy of Athens, Center of Basic Research II, 11527 Athens, Greece Abstract Cloning of alternatively polyadenylated transcripts is crucial for studying gene expression and function. Recent transcriptome analysis has mainly focused on large EST clone collections. However, EST sequencing techniques in many cases are incapable of isolating rare transcripts or address transcript variability. In most cases, 3΄ RACE is applied for the experimental identification of alternatively polyadenylated transcripts. However, its application may result in nonspecific amplification and false positive products due to the usage of a single gene specific primer. Additionally, internal poly(A) stretches primed by oligo(dT) primer in mRNAs with AU-rich 3΄UTR may generate truncated cDNAs. To overcome these limitations, we have developed a simple and rapid approach combining SMART technology for the construction of a full length cDNA library and hybrid capture PCR for the selection and amplification of target cDNAs. Our strategy is characterized by enhanced specificity compared to other conventional RT-PCR and 3΄ RACE procedures. Introduction Alternative 3΄ processing and polyadenylation of pre-mRNA can generate multiple transcript isoforms of the same gene and has evident roles in mRNA stability, localization and translational efficiency (Bartel, 2009; de Moor et al., 2005; Wickens et al., 2002). Despite the important role of alternative 3΄ processing and polyadenylation in gene function, genome wide characterization of 3΄ UTRs is still incomplete. Recent studies have shown that as many as 5,000 human genes may have unreported 3΄ end extensions (Le Texier et al., 2006). Even in the well-characterized genome of Caenorhabditis elegans, nearly half of the genes deposited in WormBase lack an annotated 3΄ UTR and only ~5% are reported to have alternative 3΄ UTR isoforms (Mangone et al., 2010). Alternative poly(A) sites may be located in the same 3΄ exon and are referred to as tandem poly(A) sites or in alternative 3΄exons (Yan and Marr, 2005). The presence of transcript isoforms with extended 3΄ UTR is often related to mRNAstability, translational efficiency and cellular localization (Decker and Parker, 1995; Jansen, 2001; Mazumder et al., 2003; Wilusz et al., 2001). Alternative polyadenylation may *Corresponding author: Email:
[email protected] Horizon Scientific Press. http://www.horizonpress.com
significantly alter transcript characteristics by the addition of regulatory elements within the non-coding terminal end of the transcript (Gu et al., 2009; Ji et al., 2009). To date, the elucidation of gene expression and function requires the isolation and cloning of alternatively spliced or polyadenylated transcripts. High-throughput transcriptome research has focused on extended expressed sequence tag (EST) libraries, as well as the characterization of 3΄ UTRs mainly using computational methods (Bengert and Dandekar, 2003; Chen et al., 2006). Although EST collections are a helpful tool for the identification of novel transcripts, their potential is limited by low representation of rare transcripts, poor coverage of many tissue types and developmental stages, as well as deposition of sequences from misspliced RNAs (Wang, 2008). In addition, the coverage of many organisms' transcriptome by ESTs remains incomplete due to issues such as transcript end bias, library coverage limitations and sampling differences (Modrek and Lee, 2002). Cloning and characterization of transcript isoforms either by cDNA library screening or by rapid amplification of cDNA ends (RACE) (Frohman, 1993) is the most common method for the experimental validation of predicted extensive variations at the 3΄ end of transcripts. Screening of cDNA library is an expensive, tedious and time consuming procedure. On the other hand, the conventional 3΄ RACE method often has practical problems, such as low sensitivity for rare transcripts and high background of non-specific amplification products, due to internal priming of the oligo(dT) primer in adenine rich stretches (Nam et al., 2002). Hybridization capture in solution using biotinylated DNA probes is also an alternative approach for transcript isolation from amplified (Levin et al., 2009) or enriched (Haraguchi et al., 2003) cDNA libraries, as well as for nucleic acids detection of pathogens in clinical or environmental samples (Chen et al., 1998; Jacobsen, 1995; Maibach et al., 2002). However, its application to transcriptome analysis of 3΄ UTR extended isoforms remains limited. Direct high throughput sequencing of cDNA (RNA-Seq) is a recently developed approach that uses deep-sequencing technologies, allowing the further characterization and quantification of prokaryotic and eukaryotic transcriptomes (Wang et al., 2009). RNA-Seq has also been applied to C. elegans transcriptome for the identification of 3΄ UTR isoforms by developing a high throughput method called poly(A)-position profiling by sequencing (3P-Seq). This method is based on the isolation of the single stranded polyadenylated ends after ligation with a biotinylated adaptor at the 3΄ end of mRNAs, partial digestion with RNase T1, magnetic capture of biotinylated DNA fragments, reverse transcription - digestion with RNase H and finally, the purified polyadenylated ends are subjected to high-throughput sequencing (Jan et al., 2011). Compared to conventional methods, this approach permitted the identification of 8,580 additional UTRs in C. elegans transcriptome and provided evidence that thousands of deposited shorter UTR isoforms
2 Rampias et al. that were supported by oligo(dT) based methods may not be authentic and seem to derive from internal-priming artifacts. Although RNA-Seq is a very attractive approach to transcriptome profiling, it is still a technology under constant development and faces some technical challenges. For example, 7-nt or longer homopolymers have higher error rates, leading to ambiguous base calls in the sequence output (Huse et al., 2007; Margulies et al., 2005) and therefore the read accuracy in AU rich 3΄ UTRs may be imprecise in some cases. Some technical manipulations such as RNA or cDNA fragmentation may also have a negative impact on the sequencing outcome. More specifically, RNA or cDNA molecules must be fragmented into smaller pieces to be compatible with deep-sequencing technology. RNA fragmentation has little bias over the transcript body but is relatively depleted for both the 5΄ and 3΄ ends. In contrary, cDNA fragmentation is strongly biased towards the identification of sequences from the 3΄ end of transcripts (Wang et al., 2009). In any case, RNA-Seq technologies provide only partial sequencing information and do not allow the direct cloning of target transcripts. Therefore, EST clone collections remain the major sequence sources for many species. Here, we present a simple and efficient approach for the experimental identification and cloning of alternatively polyadenylated transcripts with extended 3΄ UTR. It combines SMART technology (Zhu et al., 2001) and hybrid capture PCR and fills an important niche in transcriptome research. We successfully applied this method for the isolation and cloning of an alternatively polyadenylated transcript of Cc RNase gene from the insect Ceratitis capitata (Rampias et al., 2008). Materials and Methods RNA isolation and of single stranded cDNA library construction Total RNA was prepared from six-day-old larvae of the insect Ceratitis capitata by the acid guanidinium thiocyanatephenol-chloroform method (Bouhin et al., 1992). Poly (A)+ RNA was isolated from 100 µg total RNA using Dynabeads oligo (dT)25 (Dynal AS, Oslo, Norway) in accordance with the manufacturers' protocol. Approximately 1 μg of poly (A)+ RNA was reverse transcribed using the SMART PCR cDNA synthesis kit (Clonotech Laboratories, Palo Alto, CA). Briefly, a 5 µl cDNA synthesis mixture containing the poly(A)+ RNA, 2.4 µM 3΄SMART CDS primer IIA (5΄AAG CAG TGG TAT CAA CGC AGA GTA CT(30) (A/C/G/T) (A/G/C) -3΄), and 2.4 µM SMART IIA oligonucleotide (5΄AAGCAGTGGTATCAACGCAGAGTACGCGGG-3΄) was incubated at 72 ºC for 2 min and placed on ice for another 2 min. The reaction volume was then adjusted to 10 µl adding 2 µl 5× first-strand synthesis buffer (250 mMTris-HCl, pH 8.3, 30 mM MgCl2, 375 mM KCl, 10 mM DTT), 1 µl dNTP mixture (10 mM each), 1 µl deionized water and 1 µl (200 U) of Superscript II reverse transcriptase (Life Technology, Rockville, MD). The reaction was carried out at 42 ºC for 1hour and terminated by the addition of 80 µl of TE buffer, followed by incubation at 72 ºC for 7 min. The single stranded cDNA molecules were precipitated with ethanol–sodium acetate and resuspended in 20 µl TE buffer.
Hybridization capture of target cDNAs Hybrid selection of the Cc RNase target transcripts was performed using a biotin labelled single stranded cDNA probe captured on streptavidin coated magnetic beads. The capture probe was complementary to a portion of the known sequence of the Cc RNase cDNA (nucleotides 69790, accession number AJ441124) and was synthesized by conventional PCR using the 5´ biotinylated forward primer TTGTGGAAAATCATACGAG-3΄ and the reverse primer 5΄CTGCAGACATCGCTTACTT-3΄. The biotinylated strand of the PCR product was attached to streptavidin coated paramagnetic beads (Dynabeads M-280 Streptavidin, Dynal, Oslo, Norway) as recommended by the manufacturer and resuspended in 80 μl of a buffer containing 3.75 x SSC, 0.125% SDS, 1.5625 x Denhardt's. The synthesized single stranded cDNAs (20 µl) were denatured by heating at 99°C for 5 min, followed by immediate cooling on ice for 3 min and then directly added to the biotinylated captured Cc RNase probe. The hybridization reaction (100 μl) was performed at 68 °C for 6 h in 3 x SSC, 0.1% SDS, 1.25 x Denhardt's (hybridization buffer) under continuous agitation (800 rpm) in an Eppendorf thermomixer. Following hybridization, the beads were collected by a magnetic particle separator allowing the hybridization solution to be removed and washed twice with 200 μl of 2 x SSC, 0.1% SDS, at 63°C, four times with 200 μl of 10 mM Tris-HCl (pH 8.0), 1 mM ethylanediaminetetraacetic acid (EDTA) at room temperature, and finally resuspended in 50 μl of distilled H2O. All post-hybridization wash steps were performed in constant agitation of 1400 rpm using an Eppendorf thermomixer. PCR amplification, cloning and characterization of captured cDNAs Following hybridization and washes, the target single stranded cDNAs were amplified by PCR, using the LD primer (5΄- AAG CAG TGG TAA CAA CGC AGA GT-3΄), which is complementary to the SMART adaptor at the 3΄ and 5΄ end of the synthesized cDNAs. Ten microliters of purified hybrids and 5 U of Pfu Turbo DNA polymerase (Stratagene, CA, USA) were used for the PCR reaction, performed at 95°C for 3 min, followed by 25 cycles of 95°C for 1 min, 56°C for 1 min, 68°C for 2 min and a final extension of 10 min at 68°C. The amplified products were then purified using the QIAquick PCR purification kit (Qiagen), cloned into the pCR2.1 vector (Invitrogen, Carlsbad, CA, USA) and characterized by restriction endonuclease mapping and DNA sequencing. 3΄ RACE-PCR One μg poly (A)+ RNA was reverse transcribed using the oligo(dT) adaptor primer (5΄GGCCACGCGTCGACTAGTACT18-3΄) and 1 µl of of the single stranded cDNA library was used as template in a PCR reaction, containing the gene specific primer DS74 (5΄TTGTGGAAAATCATACGAGA-3΄) and the adaptor primer (5΄-GGCCACGCGTCGACTAGTAC-3΄). Ten microliters of the PCR products were analyzed on an ethidium bromidestained 1% agarose gel and subsequently employed for Southern blot analysis.
Cloning of Alternatively Polyadenylated Transcripts 3
3! UTR Internal poly(A)
'()&"
/01"
#$"
3! end poly(A)
&&&&&&&"
&&&&&&&&&&&&"
*+,-*".!"
%$"
*+,-*".!"
Reverse transcription %$" %$"
Full length ss cDNA 5! Truncated ss cDNA
!!!!!!!!!!!!"
!!!!!!!!" !!!!!!!!"
#$"
#$"
%$"
!!!!!!!!" 3! Truncated ss cDNA
#$"
Second strand cDNA synthesis with GSP
%$"
#$"
GSP
Full length ss cDNA
"&&&&&&&" !!!!!!!!"
""&&&&&&&&&&" !!!!!!!!!!!!"
%$" #$"
Suppression of PCR amplification due to internal poly (A) hybridization
3! Truncated ss cDNA
#$"
2,-3"4"
#$"
!!!!!!!!" "&&&&&&&"
""&&&&&&&&&&&"
%$"
!!!!!!!!"
!!!!!!!!!!!!"
#$"
GSP
%$"
Figure 1. Schematic representation of 3΄ RACE PCR suppression in mRNAs containing internal poly(A) stretches. The initiation of cDNA synthesis from internal poly(A) stretches located in 3΄ UTR results in the generation of 5΄ and 3΄ truncated single stranded cDNAs from a single mRNA template. A gene specific primer (GSP) is used for the second strand cDNA synthesis and the double stranded cDNA molecules are then amplified in a PCR reaction using the gene specific primer and the adaptor one. During amplification, the population of 3΄ truncated single stranded cDNA molecules generated in RT reaction prevents the extension of the adaptor primer due to hybridization of internal poly(A) stretches and therefore suppresses the full length cDNA synthesis. Southern blot analysis Southern blot experiments were carried out as described previously (Maniatis et al., 1989), using a 32P-labeled DNA probe corresponding to nucleotides 58-784 of the Cc cDNA sequence (Accession number AJ441124). Results and Discussion The extended UTR region in alternatively polyadenylated transcripts is almost 90% longer than the constitutive UTR region (cUTR) and has a higher AU content (Tian et al., 2005). These AU rich sequences often contain poly (A) stretches which can be primed by oligo(dT) adaptor-primer during the reverse transcription reaction, resulting in the generation of 3΄- and 5΄- truncated single stranded cDNA molecules (Nam et al., 2002) and in the accumulation of
non-specific 3΄ RACE amplification products. Moreover, since the 3΄- truncated single stranded cDNAs contain oligo(dT) sequences, they may be hybridized to internal poly(A) stretches of the cDNA template, suppressing the full length target cDNA synthesis (Figure 1). To overcome this problem, we have developed a simple approach in order to increase the specificity and the efficiency of the target cDNA amplification. The basic principle of the method is outlined in figure 2. It consists of the following steps: (i) Construction of a single stranded cDNA library according to the SMART protocol. (ii) Hybridization of cDNA molecules with a biotinylated single strand DNA probe immobilized on streptavidin paramagnetic beads. (iii) Magnetic pull down and wash of the immobilized hybrids. (iv) PCR amplification of the target
4 Rampias et al.
Figure 2. Schematic representation of the hybrid capture protocol for the selection of alternative transcripts. mRNAs are represented by black line and cDNAs by black boxes.
cDNA molecules, using a primer complementary to the 5΄ SMART adaptor sequence (LD primer). To our knowledge this is the first adapted magnetic capture hybridization PCR protocol to study the expression of alternative transcripts by employing the SMART cDNA synthesis technology. Construction of cDNA library and hybrid selection of target transcripts In order to evaluate the efficiency of our protocol, we prepared a single stranded SMART cDNA library from 6-day-old larvae of the insect Ceratitis capitata. SMART technology offers the advantage of full length cDNA synthesis, due to the usage of the SMART oligo that specifically binds at the 5΄ end of mRNA molecules. The SMART anchor sequence and the poly(A) sequence serve as universal priming sites for end-to-end cDNA amplification. This approach eliminates the amplification of 5΄or 3΄ truncated molecules.
In the next step, the isolation of the Cc RNase target transcripts was performed by hybrid selection using a biotinlabelled single stranded DNA probe captured on streptavidin coated magnetic beads. The DNA probe is designed to be complementary to a part of the coding region of the Cc RNase gene and has a length of 721 nucleotides and a melting temperature (Tm) of 60-70°C. The synthesized single stranded SMART cDNA library was hybridized at 68°C for 6 hours under continuous agitation to ensure that magnetic beads remained in suspension. The enrichment of target transcripts is especially crucial when working with low copy alternative transcripts. High stringency hybridization conditions facilitates the removal of the majority of non target cDNA molecules, increasing the concentration of the specific target transcripts by several orders of magnitude. Previous reports suggest that hybridization temperature should not exceed 70°C, so as to reduce the probability of bead degradation (St John and Quinn, 2008). In our case
Cloning of Alternatively Polyadenylated Transcripts 5 the Dynal beads tolerated a hybridization temperature of 68°C making them suitable for this protocol. Isolation and characterization of alternative isoforms Following hybridization, the beads were collected by a magnetic particle separator allowing the hybridization solution to be removed and washed twice with 2 x SSC, 0.1% SDS, at 63°C and four times with TE buffer at room temperature. The selected ss cDNAs captured on the beads were used as a template in polymerase chain reaction with the LD primer, that specifically binds at both ends of the cDNA molecules. The application of the above strategy in our case, allowed the retrieval of two distinct bands, as visualized in a 1.2% agarose gel (Figure 3A, lane 1). These cDNAs correspond to the two transcripts of the Cc RNase gene (Rampias et al., 2008), as confirmed by Southern blot (Figure 3B, lane 1) and sequencing analysis. These results demonstrated the high specificity of transcript selection and amplification in our method. A series of experiments under different salt concentrations (2 to 3.5 × SSC in hybridization buffer) was performed in order to determine the optimal hybridization conditions. Comparison of the final PCR amplification products revealed that the usage of 3 x SSC hybridization buffer assured the retrieval of the most abundant and specific DNA product (Figure 4A). The capture of hybrids on paramagnetic beads also allows extensive washing prior to the final PCR reaction. Applying different washing conditions of the selected
A
1
2
3
beads, demonstrated that the stringency of wash is a crucial parameter, since even traces of non-target DNA can produce severe background in the subsequent PCR amplification step. When beads were initially washed with 2 × SSC containing 0.1% SDS at hybridization temperature (63°C) and then with TE at room temperature, an optimal elimination of non-specific cDNA molecules at the final amplification step was achieved. In contrary, when higher salt concentration in wash buffer (3-3.5 x SSC) or lower incubation temperatures (55-60°C) were applied, the non specific amplification was significantly increased (Figure 4B). A relatively low number of amplification cycles (25 cycles) were applied in order to avoid PCR bias. However, a higher number of cycles can be used under optimized conditions to further increase the sensitivity of the proposed method. Moreover, the hybridization beads may also be used as a direct template for real time PCR amplification using specific primers for each transcript isoform. This approach could provide a direct and accurate measurement of the expression levels of the transcript variants. The development of this technique was attempted due to the difficulty of isolating the alternative Cc RNase transcript applying the conventional 3΄ RACE procedure (Figure 3A, lane 2). As shown in Figure 3, only specific PCR products were detected following our method, whereas the application of the conventional 3΄ RACE (Frohman, 1993) led to the accumulation of non-specific products and failed to specifically amplify the longer transcript. Sequence
B
1
2
1.3 1.15 0.76 0.61
Figure 3. Comparative demonstration of the PCR products obtained applying the magnetic capture hybrid selection technique (lane 1) and 3΄ RACE (lane 2). (A) The PCR products were analyzed on an ethidium bromide-stained 1.2% agarose gel in parallel with λ phage DNA digested with HindIII (lane 3). (B) Southern blot analysis of PCR amplification products with a 32Plabelled specific probe corresponding to nucleotides 69-790 of the Cc RNase gene.
Fig. 3
6 Rampias et al.
A
1
2
3
4
B
1
1.3 1.15 0.76
2
3
4
5
6
1.3 1.15 0.76 0.61
Figure 4. Comparative demonstration of the PCR products obtained under several hybridization and washing conditions. (A) The final PCR products yielded under different hybridization conditions, 2 x SSC (lane 1), 3 x SSC (lane 2) and 3.5 x SSC (lane 3) and (B) under different washing conditions 2 x SSC at 55 oC (lane 1), 2 x SSC at 60 oC (lane 2), 2 x SSC at 63 oC (lane 3), 3 x SSC at 63 oC (lane 4) and 3.5 x SSC at 63 oC (lane 5) were analyzed on an ethidium bromide-stained 1.2% agarose gel in parallel with λ phage DNA digested with HindIII (lane 4A and lane 6B).
Fig. 4
analysis of the longer Cc RNase transcript revealed a 71% AU content, as well as the presence of several adenine-rich stretches in the extended UTR region (Ac. No AJ 874689). It is possible that the internal priming of the oligo-(dT) containing primer to these adenine-rich stretches during standard 3΄ RACE led to non specific amplification. This hypothesis is in agreement with previous reports demonstrating that the high rate of oligo-(dT) priming in internal poly(A) tracts during reverse transcription can generate a high background of nonspecific products (Nam et al., 2002). In our protocol, the addition of the hybridization capture step
allows the complete removal of the 3΄-truncated ss cDNA molecules prior to the final amplification step, facilitating the complete target cDNA synthesis and allowing the identification of transcript variants with adenine rich regions in their sequence. Given the fact that the high AU content of the extended 3΄ untranslated region is a general feature of the alternatively polyadenylated transcripts, our method is suitable for the efficient amplification of transcript variants generated by alternative choice of the polyadenylation signal.
Figure 5. BLASTN analysis of the Cc RNase transcripts (mRNA 01, mRNA 02) using the Ceratitis capitata NCBI dbEST. Each EST is represented by a horizontal line. Arrows show the direction of EST sequencing read. The accession numbers of corresponding ESTs, the identity and the coverage of the query sequence are also indicated. The accession numbers of the Cc RNase transcripts are AJ441124 (mRNA 01) and AJ874689 (mRNA 02).
Cloning of Alternatively Polyadenylated Transcripts 7 Since our previously reported experimental results demonstrated that the longer Cc RNase transcript is more abundant than the shorter one (Rampias et al., 2008), a question about the representation of Cc RNase transcripts in the current expression databases is raised. Recently, the first major EST dataset from the insect Ceratitis capitata embryo and adult head cDNA libraries was released (Gomulski et al., 2008). A BLASTN analysis using the longer Cc RNase transcript sequence as query against this database retrieved six ESTs corresponding to the full length sequence of the shorter Cc RNase transcript and only two ESTs (FG082396.1 and FG080372.1) corresponding to 3΄- truncated sequences of the longer transcript (Figure 5). In addition, given that all the retrieved ESTs represented 5΄ sequencing reads of the cDNA clones, the BLASTN analysis pointed out the lack of currently available sequence information regarding the 3΄ end of the longer Cc RNase transcript in EST databases. In fact, the method described in this report could avert this incompleteness since it facilitates the isolation of full-length 3΄ UTR extended transcripts that are not represented in EST databases. The protocol presented here is highly flexible and can also have potential applications in the identification of transcripts that contain regulatory elements within their 3΄ UTR, such as AU-rich elements (AREs) (Barreau et al., 2005) or retroelement insertions (Lee et al., 2008), by designing DNA hybridization probes highly specific for these elements. It is well known that some 3΄ UTR regulatory elements are extremely conserved reflecting a very strong selective pressure for these sequences among different transcripts. Alternative polyadenylation produces transcript isoforms with 3΄ untranslated regions of different lengths. Therefore, if a regulatory element is present in an extended UTR, only those element-containing transcript isoforms are regulated (Legendre et al., 2006). Recently, it was shown that proliferating cells such as CD4+ lymphocytes express mRNAs with shortened 3΄ untranslated regions with fewer microRNA target sites (Sandberg et al., 2008). Thereafter, we believe that our protocol can also be adapted to detect alternative transcripts that host regulatory UTR elements and microRNA target sites by using the appropriate cDNA probes. Acknowledgements This work is part of Ph.D. thesis of Mr. Th. Rampias and was supported by the Hellenic State Scholarship's Foundation and by the Research Committee of the National Kapodistrian University of Athens. References Barreau, C., Paillard, L., and Osborne, H.B. (2005). AUrich elements and associated factors: are there unifying principles? Nucleic Acids Res 33, 7138-7150. Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233. Bengert, P., and Dandekar, T. (2003). A software tool-box for analysis of regulatory RNA elements. Nucleic Acids Res 31, 3441-3445. Bouhin, H., Charles, J.P., Quennedey, B., and Delachambre, J. (1992). Developmental profiles of epidermal mRNAs during the pupal-adult molt of Tenebrio molitor and isolation of a cDNA clone encoding
an adult cuticular protein: effects of a juvenile hormone analogue. Dev Biol 149, 112-122. Chen, J., Johnson, R., and Griffiths, M. (1998). Detection of verotoxigenic Escherichia coli by magnetic capturehybridization PCR. Appl Environ Microbiol 64, 147-152. Chen, Z., Wang, W., Ling, X.B., Liu, J.J., and Chen, L. (2006). GO-Diff: mining functional differentiation between EST-based transcriptomes. BMC Bioinformatics 7, 72. de Moor, C.H., Meijer, H., and Lissenden, S. (2005). Mechanisms of translational control by the 3' UTR in development and differentiation. Semin Cell Dev Biol 16, 49-58. Decker, C.J., and Parker, R. (1995). Diversity of cytoplasmic functions for the 3' untranslated region of eukaryotic transcripts. Curr Opin Cell Biol 7, 386-392. Frohman, M.A. (1993). Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Methods Enzymol 218, 340-356. Gomulski, L.M., Dimopoulos, G., Xi, Z., Soares, M.B., Bonaldo, M.F., Malacrida, A.R., and Gasperi, G. (2008). Gene discovery in an invasive tephritid model pest species, the Mediterranean fruit fly, Ceratitis capitata. BMC Genomics 9, 243. Gu, S., Jin, L., Zhang, F., Sarnow, P., and Kay, M.A. (2009). Biological basis for restriction of microRNA targets to the 3' untranslated region in mammalian mRNAs. Nat Struct Mol Biol 16, 144-150. Haraguchi, S., Tsuda, M., Kitajima, S., Sasaoka, Y., Nomura-Kitabayashid, A., Kurokawa, K., and Saga, Y. (2003). nanos1: a mouse nanos gene expressed in the central nervous system is dispensable for normal development. Mech Dev 120, 721-731. Huse, S.M., Huber, J.A., Morrison, H.G., Sogin, M.L., and Welch, D.M. (2007). Accuracy and quality of massively parallel DNA pyrosequencing. Genome Biol 8, R143. Jacobsen, C.S. (1995). Microscale detection of specific bacterial DNA in soil with a magnetic capturehybridization and PCR amplification assay. Appl Environ Microbiol 61, 3347-3352. Jan, C.H., Friedman, R.C., Ruby, J.G., and Bartel, D.P. (2011). Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs. Nature 469, 97-101. Jansen, R.P. (2001). mRNA localization: message on the move. Nat Rev Mol Cell Biol 2, 247-256. Ji, Z., Lee, J.Y., Pan, Z., Jiang, B., and Tian, B. (2009). Progressive lengthening of 3' untranslated regions of mRNAs by alternative polyadenylation during mouse embryonic development. Proc Natl Acad Sci U S A 106, 7028-7033. Le Texier, V., Riethoven, J.J., Kumanduri, V., Gopalakrishnan, C., Lopez, F., Gautheret, D., and Thanaraj, T.A. (2006). AltTrans: transcript pattern variants annotated for both alternative splicing and alternative polyadenylation. BMC Bioinformatics 7, 169. Lee, J.Y., Ji, Z., and Tian, B. (2008). Phylogenetic analysis of mRNA polyadenylation sites reveals a role of transposable elements in evolution of the 3'-end of genes. Nucleic Acids Res 36, 5581-5590. Legendre, M., Ritchie, W., Lopez, F., and Gautheret, D. (2006). Differential repression of alternative transcripts: a screen for miRNA targets. PLoS Comput Biol 2, e43.
8 Rampias et al. Levin, J.Z., Berger, M.F., Adiconis, X., Rogov, P., Melnikov, A., Fennell, T., Nusbaum, C., Garraway, L.A., and Gnirke, A. (2009). Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcripts. Genome Biol 10, R115. Maibach, R.C., Dutly, F., and Altwegg, M. (2002). Detection of Tropheryma whipplei DNA in feces by PCR using a target capture method. J Clin Microbiol 40, 2466-2471. Mangone, M., Manoharan, A.P., Thierry-Mieg, D., ThierryMieg, J., Han, T., Mackowiak, S.D., Mis, E., Zegar, C., Gutwein, M.R., Khivansara, V., et al. (2010). The landscape of C. elegans 3'UTRs. Science 329, 432-435. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1989). Molecular cloning : a laboratory manual, 2nd edn (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory). Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka, J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. (2005). Genome sequencing in open microfabricated high-density picolitre reactors. Nature 437, 376-380. Mazumder, B., Seshadri, V., and Fox, P.L. (2003). Translational control by the 3'-UTR: the ends specify the means. Trends Biochem Sci 28, 91-98. Modrek, B., and Lee, C. (2002). A genomic view of alternative splicing. Nat Genet 30, 13-19. Nam, D.K., Lee, S., Zhou, G., Cao, X., Wang, C., Clark, T., Chen, J., Rowley, J.D., and Wang, S.M. (2002). Oligo(dT) primer generates a high frequency of truncated cDNAs through internal poly(A) priming during reverse transcription. Proc Natl Acad Sci U S A 99, 6152-6156. Rampias, T.N., Fragoulis, E.G., and Sideris, D.C. (2008).
Genomic structure and expression analysis of the RNase kappa family ortholog gene in the insect Ceratitis capitata. Febs J 275, 6217-6227. Sandberg, R., Neilson, J.R., Sarma, A., Sharp, P.A., and Burge, C.B. (2008). Proliferating cells express mRNAs with shortened 3' untranslated regions and fewer microRNA target sites. Science 320, 1643-1647. St John, J., and Quinn, T.W. (2008). Rapid capture of DNA targets. Biotechniques 44, 259-264. Tian, B., Hu, J., Zhang, H., and Lutz, C.S. (2005). A largescale analysis of mRNA polyadenylation of human and mouse genes. Nucleic Acids Res 33, 201-212. Wang, S.M. (2008). Long-short-long games in mRNA identification: the length matters. Curr Pharm Biotechnol 9, 362-367. Wang, Z., Gerstein, M., and Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10, 57-63. Wickens, M., Bernstein, D.S., Kimble, J., and Parker, R. (2002). A PUF family portrait: 3'UTR regulation as a way of life. Trends Genet 18, 150-157. Wilusz, C.J., Wormington, M., and Peltz, S.W. (2001). The cap-to-tail guide to mRNA turnover. Nat Rev Mol Cell Biol 2, 237-246. Yan, J., and Marr, T.G. (2005). Computational analysis of 3'-ends of ESTs shows four classes of alternative polyadenylation in human, mouse, and rat. Genome Res 15, 369-375. Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R., and Siebert, P.D. (2001). Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. Biotechniques 30, 892-897.
Lab-on-a-Chip Technology (Vol. 2): Biomolecular Separation and Analysis Lab-on-a-Chip Technology (Vol. 2): Biomolecular Separation and Analysis Edited by: Keith E. Herold and Avraham Rasooly Title 1 Edited by: Keith Herold978-1-904455-47-9 and Avraham Rasooly Published: 2009E.ISBN: Published: 2009or ISBN: 978-1-904455-47-9 Price: GB £150 US $310 The editors this book have brought together expert authors from many countries to produce a comprehensive volume focusing on the Price: GB of£150 or US $310
applications of this LOCbook technology in the biomedical and life sciences. The first sectiontoincludes on LOC biomolecule separation. editors of have brought together expert authors from many countries producechapters a comprehensive volume focusing on the PCR BooksThe Separation ofofbiomolecules is aninimportant element various clinical is required for many "down stream" analytical applications LOC technology the biomedical andoflife sciences. Thelaboratories first sectionand includes chapters on LOC biomolecule separation. applications.ofVarious electrophoresis and liquid chromatography applications for proteins DNA for are many described asstream" well as analytical methods for cell biomolecules is an important element of various clinical laboratories and isand required "down PCR Books Separation separation, with an emphasis on blood cell separation, which have many important clinical applications. The second part includes chapters on
Our high level PCR books bring together expert international authors under the skilled editorship of leading scientists to produce applications. Various electrophoresis and liquid chromatography applications for proteins and DNA are described as well as methods for cell analysis andwith manipulation technologies. Authors protein, genetic (mainly PCR) andapplications. transcriptome analysis from separation, emphasis on bloodAimed cell separation, which havescientist, many important clinical The secondwith partexamples includes chapters on state-of-the-art compendiums ofancurrent research. atdescribe the research graduate student, medical reseacher and other research and clinical applications, as well as cell manipulation and analysis including cell viability analysis and microorganism capturing. Our high level PCR books bring together expert international skilled editorship of transcriptome leading scientists produce analysis and manipulation technologies. Authorsauthors describe under protein,the genetic (mainly PCR) and analysistowith examples from A professionals, these books are highly recommended for all PCR laboratories. Every PCR, microbiology and bioscience library skillful selection of topics of exceptional importance to current science ensures that this book will be of major value to a wide range of research and applications, well asatcell and analysis including student, cell viability analysisreseacher and microorganism capturing. A state-of-the-art compendiums of clinical current research.asAimed themanipulation research scientist, graduate medical and other molecular biologists, clinical scientists, biochemists andensures anyone that interested in LOC technology developing applications should have a copy of each of the following books. microbiologists, skillful selection of topics of exceptional to current science this book will be of bioscience major or value to a wide range of for LOC professionals, these books are highly recommended forimportance all PCR laboratories. Every PCR, microbiology and library devices. molecular biologists, clinical scientists, microbiologists, biochemists and anyone interested in LOC technology or developing applications for LOC should have a copy of each of the following books. devices.
PCR Troubleshooting and Optimization: The Essential Guide Lab-on-a-Chip Technology (Vol. 1):Nick Fabrication and Microfluidics PCR Troubleshooting and Optimization: The Essential Guide Edited by: Suzanne Kennedy and Oswald Lab-on-a-Chip Technology (Vol. 1): Fabrication and Microfluidics Published: 2011 ISBN:and 978-1-904455-72-1 Edited by: Keith E. Herold Avraham Rasooly Edited by: Suzanne Kennedy and Nick Oswald Price: £159 or US 978-1-904455-46-2 $310 Edited by:GB Keith Herold and Avraham Rasooly Published: 2009 Published: 2011E.ISBN: ISBN: 978-1-904455-72-1 This book discusses the strategies for preparing effective controls and standards for PCR, when they should be employed and how to interpret Published: 2009 ISBN: 978-1-904455-46-2 Price: GB £150 or US $310 Price: GB £159they or US $310It highlights the significance of optimization for efficiency, precision and sensitivity of PCR methodology and the information provide. This invaluable bookordescribes the methods and novel technologies being developed fordescribe thethey fabrication of LOC devices new Price: GBdiscusses £150 USstrategies $310 Thisprovides book the for preparing effective controls and standards for in PCR, should employed andand how to interpret essential guidance on latest how to troubleshoot inefficient reactions. Experts PCRwhen design be and optimization techniques, discuss
approaches forappropriate fluid and manipulation. Expert from around theefficiency, world describe discuss the of newest technologies foreffective the the the information they control provide. It the highlights the ofofoptimization for precision and sensitivity of PCR methodology and This invaluable book describes latest methods andauthors novel technologies being developed forand the fabrication LOC devices andfor new use of controls, explain thesignificance significance standard curves and explore the principles and strategies required prototyping of including replication andExpert directinefficient machining methods of fabrication. Part Iand of the book covers all aspects of fabrication provides essential on how tothe troubleshoot reactions. in PCR describe design and optimization techniques, discuss and approaches fordevices, fluidguidance control and manipulation. authors from aroundExperts the world describe discuss the newest technologies foramplicon the troubleshooting. Authors highlight importance of sample preparation and quality, primer design, controlling inhibitors, avoiding including laser micromachining, silicon and glass micromachining, PMMA and COC microfluidic substrates, and xurography (LOC prototyping the environmental use of appropriate controls, explain the and significance of standard curvesofand explore the andcycling strategies forfabrication effective prototyping of devices, including replication directquality machining methods fabrication. Partprinciples Ithe of thermal the book coversprotocol all required aspects of contamination, optimizing reagent and concentration, and modifying for optimal sensitivity and with a cutting plotter). Part II focuses on fluid control and manipulation for LOC systems. As well as providing examples of the use of pumps in troubleshooting. Authors the importance of the sample preparation and quality, primer design, controlling avoiding amplicon and including laser In micromachining, silicon and glass micromachining, andchoice COC of microfluidic substrates, and inhibitors, xurography (LOC prototyping specificity. addition,highlight specific chapters discuss history of PMMA PCR, the instrumentation, the applications of PCR in metagenomics, microfluidics, topics covered include electrokinetic pumping (electroosmois), electrochemical pumping and electrowetting, of environmental contamination, optimizing reagent quality concentration, and modifying the thermal cycling protocol forofand optimal sensitivity and with a cutting plotter). Part IIanalysis, focuses on MIQE fluid control andand manipulation for LOC systems. well as providing thethe usefabrication ofinpumps in high resolution melting the guidelines, and PCR at the microliter scale.As The strategies, tipsexamples and advice contained this concise a microchip for rapidthe polymerase reaction Thistroubleshoot comprehensive volume presents the current technologies in the field and includes specificity. addition, specific chapters discuss the history of PCR, theachoice of instrumentation, the applications PCR in metagenomics, microfluidics, topics covered include electrokinetic pumping (electroosmois), electrochemical pumping and electrowetting, and the fabrication of realvolume In enable scientist tochain optimize and (PCR). effectively wide range of techniques including PCR, of reverse transcriptase PCR, theoretical and technical information to enable both the understanding of the technology and the reproduction of experiments. The book aims to resolution melting analysis, the MIQE guidelines, PCR at using the microliter scale. The strategies, and adviceincontained in this concise ahigh microchip forand rapid polymerase chain reaction (PCR). Thisanyone comprehensive volume presents the currenttips technologies the field and includes time PCR quantitative PCR. An essential bookand for PCR technology. help the reader to to perform similar to design new LOC systems and to develop new volume enable theunderstand scientist tocurrent optimize andtechnologies, effectively a of wide range of techniques PCR, transcriptase PCR, theoretical and technical information toLOC enable both the troubleshoot understanding theexperiments, technology and the including reproduction of reverse experiments. The book aimsrealto methodologies applications. An book andsimilar clinicians using LOCtotechnology and developing andnew also for timethe PCR and and quantitative PCR. Anessential essential bookfor forbiologists anyone using PCR technology. help reader to understand current LOC technologies, to perform experiments, design new LOC systems applications and to develop engineering, chemical and physical science researchers developing analytical technologies. The book will also be useful as a teaching tool for methodologies and applications. An essential book for biologists and clinicians using LOC technology and developing applications and also for bioengineering, biomedical engineering and researchers biology. engineering, chemical and physical science developing Separation analytical technologies. The book will also be useful as a teaching tool for Lab-on-a-Chip Technology (Vol. 2): Biomolecular and Analysis bioengineering, biomedical engineering and biology.
Lab-on-a-Chip Technology (Vol.Avraham 2): Biomolecular Edited by: Keith E. Herold and Rasooly Separation and Analysis Published: 2009 ISBN:Technology 978-1-904455-47-9 Real-Time PCR: Current and Applications Edited by: Keith E. Herold and Avraham Rasooly Price: GBPCR: £150Current or US $310 Real-Time Technology and Applications Published: 2009 ISBN: 978-1-904455-47-9 Edited by: Julie Logan, Kirstin Edwards andexpert Nickauthors Saunders The editors of this book have brought together from many countries to produce a comprehensive volume focusing on the Price: GB Julie £150 orISBN: US $310 applications of LOC technology inEdwards the biomedical and life sciences. The first section includes chapters on LOC biomolecule separation. Edited by: Logan, Kirstin and Nick Saunders Published: 2009 978-1-904455-39-4 The editors of this book have brought together expert authors from many countries to produce a comprehensive volume focusing on the
Separation of biomolecules is an important element of various clinical laboratories and is required for many "down stream" analytical Published: ISBN: 978-1-904455-39-4 Price: GB £150 ortechnology USelectrophoresis $310 applications of2009 LOC in the biomedical life sciences. The first section includesand chapters on LOC biomolecule applications. Various and liquidand chromatography applications for proteins DNA are described as well separation. as methods for cell This essential manual a comprehensive guide the most up-to-date technologies andapplications. applications as well as providing an overview Price: GB of£150 US $310 Separation biomolecules is an important element of to various clinical laboratories and clinical is required for manyThe "down stream" separation, withor anpresents emphasis on blood cell separation, which have many important second partanalytical includes chapters on
of the theory and of this increasingly technique. Renowned experts in thefor field describe and discuss the as latest platforms, applications. Various electrophoresis and liquid chromatography applications proteins andand DNA are described asPCR well as examples methods for cell This essential manual presentstechnologies. aimportant comprehensive guide to the protein, most up-to-date technologies and applications well as with providing anfluorescent overview analysis manipulation Authors describe genetic (mainly PCR) transcriptome analysis from chemistries, validation software, analysis, and andhave external controls. This timely and authoritative volume also discusses a wide on separation, an emphasis ondata blood separation, which many clinical The second part includes chapters of the theorywith of this increasingly important technique. Renowned experts inimportant the field describe and discuss the latest PCR platforms, fluorescent research and clinical applications, ascell well as cellinternal manipulation and analysis including cellapplications. viability analysis and microorganism capturing. A range of RT-PCR applications including: clinical diagnostics, biodefense, RNA expression studies, validation of array data, mutation detection, analysis manipulation technologies. Authors describe genetic (mainlyThis PCR) andbook transcriptome analysis with from chemistries, validation data analysis, and internal and external controls. and authoritative volume also a wide skillfuland selection of software, topics of exceptional importance to protein, current science ensures thattimely this will be of major value toexamples adiscusses wide range of food authenticity and legislation, NASBA, molecular halotyping, and much more. An essential book for all laboratories using PCR. research and biologists, clinical applications, as wellclinical as celldiagnostics, manipulation and analysis including cell studies, viability analysis and microorganism capturing. A for LOC range of RT-PCR applications biodefense, RNA expression validation of array data, mutation detection, molecular clinicalincluding: scientists, microbiologists, biochemists and anyone interested in LOC technology or developing applications skillful selection and of topics of exceptional to current science ensures this book book will be value tousing a wide range of food authenticity legislation, NASBA, importance molecular halotyping, and much more. that An essential forofallmajor laboratories PCR. devices. molecular biologists, clinical scientists, microbiologists, biochemists and anyone interested in LOC technology or developing applications for LOC devices.
Lab-on-a-Chip Technology (Vol. 1): Fabrication and Microfluidics Real-Time PCR in Microbiology: From Diagnosis to Characterization Lab-on-a-Chip Technology (Vol.Avraham 1): Fabrication Microfluidics Real-Time PCR in E. Microbiology: From Diagnosis to Characterization Edited by: Keith Herold and Rasoolyand Edited by: Ian M. Mackay Published: 2009 ISBN: 978-1-904455-46-2 Editedby: by:Ian Keith Herold and Avraham Rasooly Edited M. E. Mackay Published: 2007 ISBN: 978-1-904455-18-9 Price: GB £150 or US $310 Published: 2009 ISBN: 978-1-904455-46-2 Published: 2007 ISBN: 978-1-904455-18-9 Price: £150 or US $300 This GB invaluable book describes the latest methods and novel technologies being developed for the fabrication of LOC devices and new The editor and authors have produced an excellentExpert book authors that will from be extremely useful fordescribe all microbiologists. recommended book for all Price: GB £150 orUS US $310 Price: GB £150 $300 approaches for or fluid control and manipulation. around the world and discussAthe newest technologies for the
microbiology laboratories. Thisprototyping invaluable describes the latest novel technologies being developed the fabrication LOC all devices andofnew The editor and authors have produced an methods excellent book that will be methods extremely for all for microbiologists. A of recommended book for all ofbook devices, including replication andand direct machining ofuseful fabrication. Part I of the book covers aspects fabrication approaches fluid control and manipulation. Expertmicromachining, authors from around the world describe and discuss the newest technologies the microbiology laboratories. including for laser micromachining, silicon and glass PMMA and COC microfluidic substrates, and xurography (LOCforprototyping prototyping of devices, including replication machining methods for of fabrication. PartAs I ofwell theas book coversexamples all aspects with a cutting plotter). Part II focuses on and fluiddirect control and manipulation LOC systems. providing of of thefabrication use of pumps in including laser micromachining, glass micromachining, PMMA and COC microfluidic substrates, and xurography (LOC prototyping microfluidics, topics covered silicon includeand electrokinetic pumping (electroosmois), electrochemical pumping and electrowetting, and the fabrication of witha amicrochip cutting plotter). Part II focuseschain on fluid control(PCR). and manipulation for LOC volume systems.presents As well the as providing examples ofinthe pumps in for rapid polymerase reaction This comprehensive current technologies theuse fieldofand includes microfluidics, covered information include electrokinetic pumping (electroosmois), pumping and electrowetting, and the The fabrication of to theoreticaltopics and technical to enable both the understanding of electrochemical the technology and the reproduction of experiments. book aims a microchip for rapid polymerase chain reaction (PCR). This comprehensive volume presents the current technologies in the field and includes help the reader to understand current LOC technologies, to perform similar experiments, to design new LOC systems and to develop new theoretical and technical informationAn to enable both thefor understanding the technology and the reproduction of experiments. The book methodologies and applications. essential book biologists andofclinicians using LOC technology and developing applications andaims alsotofor helpengineering, the reader to understand current LOC technologies, to developing perform similar experiments, to design systems and toas develop new tool for chemical and physical science researchers analytical technologies. Thenew bookLOC will also be useful a teaching methodologies and biomedical applications. An essential for biologists and clinicians using LOC technology and developing applications and also for bioengineering, engineering andbook biology. engineering, chemical and physical science researchers developing analytical technologies. The book will also be useful as a teaching tool for bioengineering, biomedical engineering and biology.
Real-Time PCR: Current Technology and Applications Real-Time Technology and Applications Edited by:PCR: JulieCurrent Logan, Kirstin Edwards and Nick Saunders Published: 2009 ISBN: 978-1-904455-39-4 Edited by: Julie Logan, Kirstin Edwards and Nick Saunders Price: GB £150 or US $310 Published: 2009 ISBN: 978-1-904455-39-4 This essential manual presents a comprehensive guide to the most up-to-date technologies and applications as well as providing an overview Price: £150 or US $310 important technique. Renowned experts in the field describe and discuss the latest PCR platforms, fluorescent of theGB theory of this increasingly Thischemistries, essential manual presents a comprehensive to the most up-to-date technologies and and applications as well as providing an overview validation software, data analysis,guide and internal and external controls. This timely authoritative volume also discusses a wide of the theory of this increasingly Renowned biodefense, experts in the fieldexpression describe and discuss the latest PCR data, platforms, fluorescent range of RT-PCR applicationsimportant including:technique. clinical diagnostics, RNA studies, validation of array mutation detection, chemistries, validation software, data analysis, and internal and external controls. This timely and authoritative volume also discusses a wide food authenticity and legislation, NASBA, molecular halotyping, and much more. An essential book for all laboratories using PCR. range of RT-PCR applications including: clinical diagnostics, biodefense, RNA expression studies, validation of array data, mutation detection, food authenticity and legislation, NASBA, molecular halotyping, and much more. An essential book for all laboratories using PCR.
Real-Time PCR in Microbiology: From Diagnosis to Characterization Real-Time in Microbiology: From Diagnosis to Characterization Edited by:PCR Ian M. Mackay Published: 2007 ISBN: 978-1-904455-18-9 Edited by: Ian M. Mackay Price: GB £150 or US $300 Published: 2007 ISBN: 978-1-904455-18-9 The editor and authors have produced an excellent book that will be extremely useful for all microbiologists. A recommended book for all Price: GB £150 or US $300 microbiology laboratories.
