Carcinogenesis vol.19 no.11 pp.2043–2047, 1998
Estrogen treatment enhances hereditary renal tumor development in Eker rats
D.C.Wolf1,4, T.L.Goldsworthy2, E.M.Donner2, R.Harden2, B.Fitzpatrick3 and J.I.Everitt Chemical Industry Institute of Toxicology, Research Triangle Park, NC 27709, USA 1Present
address: USEPA, MD-68, Research Triangle Park, NC 27711, USA
2Present
address: Integrated Laboratory Systems Inc., PO Box 13501, Research Triangle Park, NC 27709, USA
3Present
address: Department of Mathematics, North Carolina State University, Raleigh, NC 27695, USA
4To
whom correspondence should be addressed Email:
[email protected]
Hormonal influences are known to affect the development of renal cell carcinoma in man and laboratory animal models. We tested the hypothesis that estrogen treatment or ovariectomy of rats modulates renal tumor development using tuberous sclerosis 2 (Tsc2) heterozygous mutant (Eker) rats in which a germline mutation predisposes the animals to renal cell tumor development. Two-month-old female wild-type and Eker rats were ovariectomized or sham-operated and treated with placebo or 5 mg 17βestradiol in s.c. pellets for 6 or 10 months. Rats were examined at 8 or 12 months of age, at which time the numbers of renal tumors and preneoplastic foci were quantitated and the severity of nephropathy was assessed. In contrast to what may have been expected, prolonged estrogen treatment enhanced the development of hereditary renal cell tumors, with a 2-fold greater number of preneoplastic and neoplastic renal lesions compared with untreated Eker rats. Ovariectomized Eker rats had 33% fewer renal lesions than the unmanipulated control group. No tumors or preneoplastic lesions were present in wildtype rats at either time point. Estrogen treatment increased the severity of nephropathy in both wild-type and Eker rats, whereas ovariectomy was protective against nephropathic changes. Although estrogen is not a rat renal carcinogen, it enhanced the development of hereditary renal cell tumors when administered to Eker rats. Eker rats heterozygous for a mutation in the Tsc2 locus provide a good model in which to study how genetic and hormonal factors contribute to the development of renal cell tumors and to understand the influence genetic susceptibility has on the development of renal cell carcinoma.
induced renal epithelial tumors than female rats (1) and men spontaneously develop renal carcinoma twice as often as women (2–6). The findings of steroid hormone receptors in normal kidney and RCC tissue (5) in conjunction with the development of RCC in women following chronic estrogen therapy suggests that endocrine involvement is important in tumor development. Estrogen is known to be important in the development of several experimental tumors. For example, estrogen administration inhibits hepatocarcinogenesis in mice whereas ovariectomized mice have an increased neoplastic response (7). In some tissues, estrogen may act to inhibit tumor progression, whereas in other tissues it appears to act as a tumor promoter. Estrogen acts as a tumor promoter in experimental rat liver carcinogenesis (7,8) and in spontaneous human endometrial (9,10) and mammary carcinomas (9,11). The role of estrogen in renal cell carcinogenesis is not well understood. Some renal cancers in human patients have been found to have endocrine dependency and are positive for estrogen receptors (12). Although chronic estrogen treatment induces kidney tumors in male hamsters, estrogen does not induce renal proliferative lesions in rats (8,13). A rat model of hereditary RCC first described by Eker (14) was shown to be due to a germline mutation in the tuberous sclerosis 2 gene (Tsc2) (15,16). Tsc2 is a tumor suppressor gene and is thought to be specifically involved in the pathogenesis of renal cell carcinoma in humans and rats (17). In addition to renal cell tumors, characteristic preneoplastic dysplastic lesions have been described (18,19). The mutation of Tsc2 in the Eker rat is an insertion of 5 kbp of DNA of unknown origin into the 39-portion of the Tsc2 gene that leads to a new 39-terminus and elimination of the distal portion of the Tsc2 gene (20,21). The present study was conducted to determine the role of estrogen in spontaneous rat renal tumorigenesis by examining the ability of 17β-estradiol and ovariectomy to modify the onset of hereditary renal cell tumors and their development in Eker rats. Since renal tumors are more common and numerous in males, it was hypothesized that estrogen treatment would inhibit and ovariectomy enhance hereditary renal tumor development. Female heterozygous Tsc2 mutant (Eker) rats were utilized since they are a well-characterized and sensitive model in which to examine factors that may influence renal cancer development. Materials and methods
Introduction Differences in incidence of renal cell carcinoma (RCC) that exist between males and females in both humans and laboratory animal models are probably due to hormonal influences. Male rats more frequently develop spontaneous and chemically Abbreviations: DEN, diethylnitrosamine; DMN, dimethylnitrosamine; RCC, renal cell carcinoma; RCT, renal cell tumor; TGFα, transforming growth factor α. © Oxford University Press
Female Tsc2 (Eker) mutant and wild-type rats on a Long-Evans genetic background were sham-operated or ovariectomized and treated with placebo or 17β-estradiol s.c. pellets. Unbalanced treatment groups were present in the experiment because the mutant status of individual rats was unknown at the outset of the experiment and a population-based design was used (22). At the completion of the in-life phase of the study, a published description of the molecular changes responsible for the Eker mutation allowed a PCR-based analysis to identify the Tsc2 status of individual animals (15,16; Table I). A total of 180 female Long-Evans rats from a mutant Tsc2 carrier colony were randomly assigned to treatment groups by weight, 60 per treatment group. The rats were group housed two per plastic shoe box cage with direct
2043
D.C.Wolf et al.
Table I. Distribution of Tsc2 mutant and wild-type animals in each group Treatment
All animals
Control Ovariectomy Estrogen
Carrier animals
Non-carrier animals
Unscheduled deaths
8 months
12 months
8 months
12 months
8 months
12 months
Carrier
Non-carrier
Not determined
30 30 30
30 30 30
18 13 20
12 13 10
12 16 9
14 14 8
1 2 9
1 2
3 1 2
Table II. Mean body weight and average gain of female Eker rats Treatment
Mean body weight 8 months (g)
Average gain 8 months (g)
Mean body weight 12 months (g)
Average gain 12 months (g)
Control Ovariectomy 17β-Estradiol
286 6 22 297 6 42 242 6 31
128 6 21 143 6 42 87 6 27
319 6 40 350 6 46 214 6 28a
163 6 39 196 6 45 59 6 28
aSignificant
decrease in body weight, P , 0.01.
contact cellulose bedding and uniquely identified by transponders and cage cards. The rats were kept on 12 h light–dark cycles with a room temperature of 20 6 2°C and humidity of 50 6 10%. Water and feed (NIH-07 chow; Zeigler, Gardener, PA) were available ad libitum. At 55–60 days of age, 60 rats were ovariectomized under isoflurane anesthesia with the remaining 120 rats sham-operated on for gonadectomy. While under anesthesia, the rats had a 5 mg 17β-estradiol or placebo 90-day slow release pellet (Innovative Research of America, Toledo, OH) implanted s.c. between the dorsal scapulae. Literature supplied by the manufacturer of the pellets indicated that 17βestradiol would be maintained at supraphysiological to pharmacological levels in treated rats. Because of the ample literature supplied by Innovative Research of America on the use of the regimen of dosing employed in the present study, we elected not to perform serum estrogen analysis. At 90 day intervals throughout the study, all animals were re-implanted with the pellet appropriate to the treatment group. Animals were observed daily and clinical observations and body weights were recorded monthly. At 8 and 12 months of age, 30 rats from each treatment group were killed by pentobarbital anesthesia and exanguination and then necropsied. Organ weights of the kidneys, liver and spleen were collected. The kidneys were examined macro- and microscopically and the number of renal tumors and preneoplastic renal foci were quantitated. Renal tumors and preneoplastic foci were identified based on standard criteria (18). The morphological characteristics of the neoplastic and preneoplatic lesions are detailed and illustrated elsewhere (18) and were classified as atypical tubules, atypical hyperplasias, adenoma or carcinoma. The atypical tubule is characterized by renal tubules lined by a single layer of enlarged dysplastic epithelium with rounded cytoplasmic borders, basophilic or markedly eosinphilic cytoplasm and enlarged nuclei with clumped chromatin. The atypical hyperplasias have similar cell types but more variability in cell size and multiple layers of cells in a markedly expanded tubule border up to the size of a glomerulus. Adenomas of the solid or cystic type were combined when quantitating them for the purposes of the present study. Carcinomas were masses .1 cm in size, typically had areas of necrosis with cell characteristics that included clear, basophilic and eosinophilic cell types. Nonrenal gross lesions and masses were also identified. Microscopically, the severity of nephropathy was assessed using the following scoring method: 0, no lesion; 1, 1–10% of renal cortex affected; 2, 25% of renal cortex affected; 3, 50% of renal cortex affected; 4, .75% of renal cortex affected; 5, virtually no normal tubules evident and cortex mostly fibrotic and mineralized. Following necropsy, all animals were identified as Tsc2 mutant or wildtype based on the PCR approach described below. DNA was purified from ~25 mg frozen liver tissue using the QIAamp tissue kit and following the manufacturer’s instructions (Qiagen, Chatsworth, CA). The purity and yields of DNA were determined by measuring the concentration of DNA by absorbance at 260/280 nm. The Eker mutation is defined by a 6.3 kbp insertion into the Tsc2 gene and this permits genotyping by PCR using specific primers for identification of the Eker (1/–) mutant. Two primers designed to amplify the mutated Tsc2 DNA (23), MTA2 (TCCTCCTGAAGCTGAAGAGT) and RTSC18 (GTCTAATGCCCTTATGGCTG), were used in each of the PCR reactions. An aliquot of 1 µl isolated template DNA was added to 49 µl master mixture containing 20 pmol each primer, 0.2 mM each deoxyribonucleoside triphosphate (dNTP) and 1.0 U Taq DNA polymerase in PCR buffer supplied
2044
by the manufacturer (Perkin Elmer, Branchburg, NJ). The PCR conditions used were 93°C for 30 s, 56°C for 30 s and 72°C for 1 min for 35 cycles. Aliquots of the PCR products were size separated on 1% agarose gels. Since the Eker homozygous mutant dies in utero, the possible allotypes of the viable progeny are either 1/– or 1/1. Thus the individual animals need to be screened only for the presence or absence of the mutant 892 bp allele. Statistical analysis included ANOVA and the F-test for equal means, as well as the non-parametric Mann–Whitney U-test. By significantly different we mean that the hypothesis of equal means is rejected at a significance level of ø0.01, in favor of the hypothesis that the treatment is different from the control.
Results Treatment-related clinical observations were limited to weight loss and lethargy associated with developing pituitary masses in estrogen-treated rats. Of 60 rats treated with estrogen, 12 were removed early from the study due to morbidity from effects related to pituitary masses. Estrogen treatment did not affect the incidence of development of uterine smooth muscle tumors or splenic vascular tumors, which are also associated with the Tsc2 mutation in rats. Marked uterine atrophy was present in ovariectomized rats but no reproductive tract masses were noted. Ovariectomy resulted in a trend toward increased body weight and average weight gain during the study, however, estrogen treatment resulted in a significantly lower body weight (Table II). Kidney and splenic organ weights were not different from controls. Liver:body weight ratios were increased only in estrogen-treated rats (data not shown). Estrogen treatment increased the total number of preneoplastic and neoplastic renal lesions in Eker rats after 6 and 10 months treatment. Ovariectomy inhibited the development of renal preneoplastic foci and tumors of all phenotypes at both 8 and 12 months compared with either control or estrogentreated rats. Although there were treatment-related changes in the numbers of preneoplastic foci and total lesions, treatment did not affect the incidence of carcinomas (Tables III and IV). Although estrogen treatment increased renal tumor development in Eker rats, it did not induce the development of renal tumors or preneoplastic lesions in wild-type rats (data not shown). The morphology of these renal lesions was typical of those previously described in the Eker rat (18). The differences between groups was in the number of lesions and not in the morphological characteristics of these lesions.
Estrogen treatment and renal tumors
Table III. Total number of neoplastic and preneoplastic lesions in one section of each kidney from female Eker rats at 8 months of age (mean 6 SD) Treatment
Number of carriers
Atypical tubules
Atypical hyperplasia
Adenoma
Carcinoma
Control Ovariectomy 17β-Estradiol
18 13 20
467 (26 6 8) 110a (9 6 3) 564 (28 6 13)
82 (4.6 6 2.4) 9a (0.7 6 1.0) 147 (7.4 6 6.5)
21 (1.1 6 1.5) 14 (1.1 6 1.0) 78 (3.9 6 3.9)
1 2 4
aSignificant
decrease in lesion compared with control, P , 0.01.
Table IV. Total number of neoplastic and preneoplastic lesions in one section of each kidney from female Eker rats at 12 months of age (mean 6 SD) Treatment
Number of carriers
Atypical tubules
Atypical hyperplasia
Adenoma
Carcinoma
Control Ovariectomy 17β-Estradiol
12 13 10
362 (30 6 8) 252a (19 6 7) 336 (35 6 16)
20 (2.1 6 1.7) 14 (1.5 6 1.1) 119b (14.6 6 5.8)
11 (1.8 6 1.8) 9 (1.2 6 1.1) 55b (11.9 6 7.9)
2 4 5
aSignificant bSignificant
decrease in lesion compared with control, P , 0.01. increase in lesion compared with control, P , 0.01.
Estrogen treatment markedly increased the severity of nephropathy 2- to 3-fold in both wild-type and Eker rats (Table V) compared with untreated controls. Ovariectomy was uniformly protective for nephropathic changes and decreased the severity of spontaneous nephropathy by ~50% compared with controls in both Eker and wild-type rats. The other sites of tumor development typically associated with the Tsc2 mutation in Eker rats, the uterus and spleen, were unaffected by estrogen treatment. Ovariectomy severely inhibited overall development of the reproductive tract and no uterine tumors were present in ovariectomized Tsc2 mutant rats. Estrogen treatment increased the incidence of mammary gland and pituitary tumors to a similar extent in both Eker and wild-type rats. Discussion The present study showed that estrogen promoted and ovariectomy inhibited renal cell tumor (RCT) development in rats with a mutation predisposing them to RCT development. In addition to the effects on tumor development, estrogen increased and ovariectomy decreased the severity of nephropathy, suggesting a link between nephrotoxicity and tumorigenesis in this animal model. Estrogen inhibits or stimulates tumor development in an organ- and cell-specific manner. Estrogen-enhanced tumor induction is proposed to be through non-genotoxic mechanisms of altered growth (24–28). Estrogen has been shown to inhibit the development of transplanted mouse mammary carcinomas (29) and diethylnitrosamine (DEN)-initiated mouse hepatocarcinogenesis (30) and may be the reason that female mice tend to have fewer spontaneous liver tumors than males (31). Chronic estrogen treatment is associated with greatly increased male rat mammary tumor incidence (13). Estrogen-induced carcinogenicity has been linked to metabolism of estrogen to reactive catechols or quinones; however, these metabolites have limited affinity for the estrogen receptor (32). Catechol estrogen–glutathione conjugates cause oxidative damage and induce mild nephrotoxicity in the hamster model of estrogen-induced nephrocarcinogenicity. Catechol estrogens readily undergo oxidation to form orthoquinones which undergo redox cycling resulting in oxidative stress and can react directly with cellular nucleophiles such as protein, non-
Table V. Mean nephropathy scores for female Tsc2 mutant (Eker) rats at 8 and 12 months of age and wild-type rats at 12 months of age Treatment
Carrier rats 8 months of age (n)
Carrier rats 12 months of age (n)
Wild-type rats 12 months of age (n)
Control Ovariectomy 17β-Estradiol
0.7 (18) 0.2 (13) 2.3 (20)
1.3 (12) 0.8 (13) 3.1 (10)
0.8 (14) 0.4 (14) 2.8 (8)
protein sulfhydryls and DNA (27,33). Kidney cells have been shown to have enzyme systems that metabolize estrogen to form catechol estrogens. The nephrotoxicity of polyphenolic– glutathione conjugates in rats is a consequence of the relatively high activity of γ-glutamyltranspeptidase within the brush border membrane of renal proximal tubular epithelial cells (32). With chronic administration there is greater availability of estrogen metabolites with resultant formation of potentially damaging reactive species and enhanced oxidative stress in the kidney (34). Lipid hydroperoxide and protein carbonyl levels were substantially elevated in hamster kidneys after a single injection of 17β-estradiol that also produced mild toxicity in the proximal tubule epithelium (33,35). Chronic treatment with 17β-estradiol enhanced the development of nephrotoxicity in the present and previous studies in direct association with an increase in tumor multiplicity or incidence (24,25). The decreased nephrotoxicity in the present study was also associated with a marked decrease in tumor multiplicity. Polyphenolic–glutathione conjugates are formed as metabolites of a variety of non-genotoxic carcinogens in rats, including the male rat nephrocarcinogen hydroquinone (36). Recently a potent nephrotoxic metabolite of hydroquinone, 2,3,5-(trisglutathion-S-yl)hydroquinone, was shown to promote tumorigenesis in Eker rats (37). The induction of tumorigenesis in Tsc2 mutant rats in the present study is most probably associated with estrogen metabolism and nephrotoxicity. Estrogen-induced renal carcinoma has been extensively studied in Syrian golden hamsters and much information is available concerning the metabolism of estrogen in this species (24,25,38). Less information is available concerning estrogen metabolic pathways, nephrotoxicity and nephrocarcinogenicity 2045
D.C.Wolf et al.
in rats, a species less sensitive to estrogen-modulated renal tumorigenesis. Estrogen did not enhance dimethylnitrosamine (DMN)-induced kidney tubular adenomas and carcinomas nor did estrogen alone cause rat renal tumors (13). In the present study, although renal tumor development was enhanced in Tsc2 mutant rats, estrogen did not induce renal tumors in wildtype rats. Estrogen-treated rats in the present study had a decreased body weight that was maintained throughout the study, but ovariectomized rats had increased body weight compared with sham-operated placebo-treated controls. In previous studies, chronic estrogen treatment in rats caused growth retardation, which was seen as poor weight gain (39,40). This is thought to be due to decreased feed conversion in spite of greater food consumption (39). In the present study, chronic estrogen treatment caused severe nephrotoxicity and subsequent regeneration of renal tubules. In contrast, ovariectomy prevented nephropathy. These data are in contrast to reports where nephrosis was less severe in rats treated with a combination oral contraceptive compared with controls (40). The marked severity of nephropathy in the present study was unexpected, since female rats typically have less severe nephropathy than males. High estrogen doses may be metabolized differently than physiological levels, resulting in nephrotoxic metabolites (24,25). Although the results of the present study indicate a strong association between estrogen-induced nephrotoxicity after chronic high doses and renal tumorigenesis, hormonal influences cannot be completely ruled out. Hormonal modulation has been reported to affect RCC development. An increased risk of RCC was reported in multiparous women who have had five or more children and women who had a hysterectomy and an oophorectomy. In addition, women who have used oral contraceptives have a decreased risk of developing RCC (5). Some renal cancers in human patients have been shown to have estrogen receptors and previous work with estrogeninduced renal cancer in hamsters indicate that antiestrogenic compounds might have therapeutic benefit. However, the use of the antiestrogenic cancer chemotherapeutic tamoxifen in renal cancer patients failed to enhance recovery (12,41,42). The rat kidney possesses a receptor that responds to 17βestradiol (43). Therefore, the tumor promoting effect of estrogen in the present study might have been partially mediated through the estrogen receptor. Estrogens may also up-regulate autocrine or paracrine polypeptide growth factor signaling pathways whose effects may be mediated by the estrogen receptor (44–47). Polypeptide growth factors, such as transforming growth factor α (TGFα), may modulate the effects of steroid hormone receptors (44). Overexpression of TGFα has been consistently reported in association with the development of renal neoplasms due to estrogen administration to hamsters (48). Eker rat renal tumors overexpress the polypeptide growth factor TGFα (49). Constitutive overexpression of TGFα in Eker rat renal tumors may have acted in concert with estrogen to promote the development of renal tumors (49). In the absence of physiological estrogen due to ovariectomy, tumor development was inhibited. When estrogen was removed by ovariectomy, it may no longer be available to interact with TGFα, resulting in inhibition of tumor growth. Testosterone causes renal hypertrophy of the tubules, with estrogen producing the opposite effect. In the present study, neither estrogen treatment nor ovariectomy significantly affected kidney weight and estrogen appeared to stimulate a 2046
proliferative response in the tubules. The proliferative response may have been secondary to the nephrotoxicity and it also stimulated tumor development (43,50). The specific mechanisms by which estrogen enhanced and ovariectomy inhibited hereditary renal tumor development were not determined. Persistent cytotoxicity with cell regeneration associated with nephrotoxicity may have stimulated estrogeninduced tumorigenesis (38,51). In addition, estrogens can induce cell replication by stimulating the synthesis of mitogenic growth factors and their receptors (51,52). The present study suggests that female Tsc2 mutant rats are a useful animal model for mechanistic studies of estrogen-induced nephrotoxicity and nephrocarcinogenicity. Acknowledgements The authors would like to extend their appreciation for excellent assistance in the carrying out of this work. We thank Paul Ross, Carol Bobbitt, Kathy Bragg, Tim Shepard, G.-Lee Bridges, Melanie Talley, Richard Masney and, especially, Steve Butler for excellent animal care, Otis Lyght, Mary Morris and Delorise Williams for their necropsy and histotechnology work and Drs Julian Preston, Paul Foster and Barbara Kuyper for helpful reviews.
References 1. Montgomery,C.A.Jr and Seely,J.C. (1990) Kidney. In Boorman,G.A, Eustis,S.L., Elwell,M.R., Montgomery,C.A. and MacKenzie,W.F. (eds) Pathology of the Fischer Rat, Reference and Atlas. Academic Press, New York, NY, Chapter 10, p. 127. 2. Guignard,E., Haillot,O., Chautard,D., Vannier,J., Janin,P. and Lanson,Y. (1990) Descriptive epidemiology of tumors of the renal parenchyma in adults, in Indre-et-Loire from 1980 to 1987. J. Urol. (Paris), 96, 65–72. 3. Haillot,O. and Lanson,Y. (1992) Epidemiology and detection of renal cancer in adults. Rev. Prat., 42, 1211–1215. 4. Hernandez-Galve,A.,Talamante-Serrulla,S., Saiz-Sanchez,C., SabaterPons,A. and Corella-Piquer,D. (1991) Trends in kidney cancer mortality in Spain (1951–1985) and review of hospital case histories. Arch. Esp. Urol., 44, 935–941. 5. Lindblad,P., Mellemgaard,A., Schlehofer,B., Adami,H.-O., McCredie,M., McLaughlin,J.K. and Mandel,J.S. (1995) International renal-cell cancer study. V. Reproductive factors, gynecologic operations and exogenous hormones. Int. J. Cancer, 61, 192–198. 6. Schraub,S., Mercier,M. and Gallat,J.P. (1992) Epidemiology of kidney cancers. Ann. Urol. (Paris), 26, 275–280. 7. Ghia,M. and Mereto,E. (1989) Induction and promotion of gamma-glutamyl transpeptidase-positive foci in the liver of female rats treated with ethinyl estradiol, clomiphene, tamoxifen and their associations. Cancer Lett., 46, 195–202. 8. Shirai,T., Tsuda,H., Ogiso,T., Hirose,M. and Ito,N. (1987) Organ specific modifying potential of ethinyl estradiol on carcinogenesis initiated with different carcinogens. Carcinogenesis, 8, 115–119. 9. Cotran,R.S., Kumar,V. and Robbins,S.L. (1989) Robbins Pathologic Basis of Disease, 4th edn. W.B.Saunders, Philadelphia, PA. 10. Kanoh,H., Hosono,T., Matsui,Y. and Okudaira,Y. (1989) Growth of endometrial cancer and hormone. Gan To Kagaku Ryoho, 16, 3696–3703. 11. Nenci,I., Marchetti,E. and Querzoli,P. (1988) Commentary on human mammary preneoplasia. The estrogen receptor–promotion hypothesis. J. Steroid Biochem., 30, 105–106. 12. Al-Sarraf,M., Eyre,H., Bonnet,J., Saiki,J., Gagliano,R., Pugh,R., Lehane,D., Dixon,D. and Bottomley,R. (1981) Study of tamoxifen in metastatic renal cell carcinoma and the influence of certain prognostic factors: a southwest oncology group study. Cancer Treat. Rep., 65, 447–451. 13. Noronha,R.F.X. and Goodall,C.M. (1984) The effects of estrogen on single dose dimethylnitrosamine carcinogenesis in male inbred Crl/CDF rats. Carcinogenesis, 5, 1003–1007. 14. Eker,R. (1954) Familial renal adenomas in Wistar rats. Acta Pathol. Microbiol. Scand., 34, 554–562. 15. Hino,O., Kobayashi,T., Tsuchiya,H., Kikuchi,Y., Kobayashi,E., Mitani,H. and Hirayama,Y. (1994) The predisposing gene of the Eker rat inherited cancer syndrome is tightly linked to the tuberous sclerosis (Tsc2) gene. Biochem. Biophys. Res. Commun., 203, 1302–1308.
Estrogen treatment and renal tumors 16. Yeung,R.S., Xiao,G.H., Jin,F., Lee,W.C., Testa,J.R. and Knudson,A.G. (1994) Predisposition to renal carcinoma in the Eker rat is determined by germ-line mutation of the tuberous sclerosis 2 (Tsc2) gene. Proc. Natl Acad. Sci. USA, 91, 11413–11416. 17. Bjornsson,J., Short,M.P., Kwiatkowski,D.J. and Henske,E.P. (1996) Tuberous sclerosis-associated renal cell carcinoma. Am. J. Pathol., 149, 1201–1208. 18. Everitt,J.I., Goldsworthy,T.L., Wolf,D.C. and Walker,C.W. (1992) Hereditary renal cell carcinoma in the Eker model: a rodent cancer syndrome with similarities to human von Hippel–Lindau disease. J. Urol., 148, 1932–1936. 19. Wolf,D.C., Whiteley,H. and Everitt,J.I. (1995) Lectin staining patterns in preneoplastic and neoplastic lesions of rat hereditary renal carcinoma. Vet. Pathol., 32, 379–386. 20. Kobayashi,T., Hirayama,Y., Kobayashi,E., Kubo,Y. and Hino,O. (1995) A germline insertion in the tuberous sclerosis (Tsc2) gene gives rise to the Eker rat model of dominantly inherited cancer. Nature Genet., 9, 70–74 (erratum Nature Genet., 9, 218). 21. Kobayashi,T., Nishizawa,M., Hirayama,Y., Kobayashi,E. and Hino,O. (1995) cDNA structure, alternative splicing and exon–intron organization of the predisposing tuberous sclerosis (Tsc2) gene of the Eker rat model. Nucleic Acids Res., 23, 2608–2613. 22. Walker,C., Goldsworthy,T.L., Wolf,D. and Everitt,J. (1992) Predisposition to carcinogen-induced renal cell carcinoma due to alteration of a cancer susceptibility gene. Science, 255, 1693–1695. 23. Yeung,R.S., Xiao,G.H., Everitt,J.I., Jin,F. and Walker,C.L. (1995) Allelic loss at the tuberous sclerosis 2 locus in spontaneous tumors in the Eker rat. Mol. Carcinogen., 14, 28–36. 24. Li,J.J., Gonzalez,A., Banerjee,S., Banerjee,S.K. and Li,S.A. (1993) Estrogen carcinogenesis in the hamster kidney: role of cytotoxicity and cell proliferation. Environ. Health Perspect., 101, 259–264. 25. Li,J.J. and Li,S.A. (1990) Estrogen carcinogenesis in hamster tissues: a critical review. Endocr. Rev., 11, 524–531. 26. Liehr,J.G. (1990) Genotoxic effects of estrogens. Mutat. Res., 238, 269–276. 27. Liehr,J.G. and Roy,D. (1990) Free radical generation by redox cycling of estrogens. Free Radic. Biol. Med., 8, 415–423. 28. Roy,D., Pathak,D.N. and Palangat,M. (1995) In vivo binding of diethylstilbestrol to nuclear proteins of kidneys of Syrian hamsters. Cancer Lett., 90, 215–224. 29. Kordon,E., Lanari,C., Molinolo, A.A., Elizalde,P.V., Charreau,E.H. and Dosne-Pasqualini,C. (1991) Estrogen inhibition of MPA-induced mouse mammary tumor transplants. Int. J. Cancer, 49, 900–905. 30. Lee,A.K., DeLellis,R.A., Blount,M., Nunnemacher,G. and Wolfe,H.J. (1982) Pituitary proliferative lesions in aging male Long-Evans rats. Lab. Invest., 47, 595–602. 31. Standeven,A.M., Wolf,D.C. and Goldsworthy,T.L. (1994) Role of antiestrogenicity in liver tumor promotion by unleaded gasoline in B6C3F1 mice. Cancer Res., 54, 1198–1204. 32. Monks,T.J. and Lau,S.S. (1997) Biological reactivity of polyphenolic– glutathione conjugates. Chem. Res. Toxicol., 10, 1296–1313. 33. Butterworth,M., Lau,S.S. and Monks,T.J. (1998) 2-Hydroxy-4-glutathionS-yl-17β-estradiol and 2-hydroxy-1-glutathion-S-yl-17β-estradiol produce oxidative stress and renal toxicity in an animal model of 17β-estradiolmediated nephrocarcinogenicity. Carcinogenesis, 19, 133–139. 34. Beleh,M.A., Lin,Y.C. and Brueggemeier,R.W. (1995) Estrogen metabolism in microsomal, cell, and tissue preparations of kidney and liver from Syrian hamsters. J. Steroid Biochem. Mol. Biol., 52, 479–489. 35. Roy,D. and Liehr,J.G. (1992) Target organ-specific inactivation of drug metabolizing enzymes in kidney of hamsters treated with estradiol. Mol. Cell. Biochem., 110, 31–39. 36. Peters,M.N.C.G., Jones,T.W., Monks,T.J. and Lau,S.S. (1997) Cytotoxicity and cell-proliferation induced by the nephrocarcinogen hydroquinone and its mephrotoxic metabolite 2,3,5-(tris-glutathion-S-yl)hydroquinone. Carcinogenesis, 18, 2393–2401. 37. Lau,S.S., Monks,T.J., Everitt,J.I. and Walker,C.L. (1998) A nephrotoxic metabolite of hydroquinone induces renal cell tumorigenesis in Eker rats. Toxicol. Sci., 42 (suppl. 1), 317. 38. Li,J.J., Li,S.A., Oberley,T.D. and Parsons,J.A. (1995) Carcinogenic activities of various steroidal and nonsteroidal estrogens in the hamster kidney: relation to hormonal activity and cell proliferation. Cancer Res., 55, 4347–4351. 39. Gibson,J.P., Newberne,J.W., Kuhn,W.L. and Elsea,J.R. (1967) Comparative chronic toxicity of three oral estrogens in rats. Toxicol. Appl. Pharmacol., 11, 489–510. 40. Schardein,J.L., Kaump,D.H., Woosley,E.T. and Jellema,M.M. (1970) Longterm toxicologic and tumorigenesis studies on an oral contraceptive agent in albino rats. Toxicol. Appl. Pharmacol., 16, 10–23.
41. Schomburg,A., Kirchner,H., Fenner,M., Menzel,T., Poliwoda,H. and Atzpodien,J. (1993) Lack of therapeutic efficacy of tamoxifen in advanced renal cell carcinoma. Eur. J. Cancer, 29A, 737–740. 42. Stahl,M., Wilke,H., Schmoll,H.-J., Scho¨ber,C., Diedrich,H., Casper,J., Freund,M. and Poliwoda,H. (1992) A phase II study of high dose tamoxifen in progressive, metastatic renal cell carcinoma. Ann. Oncol., 3, 167–168. 43. Christy,N.P. and Shaver,J.C. (1974) Estrogens and the kidney. Kidney Int., 6, 366–376. 44. Ignar-Trowbridge,D.M., Nelson,K.G., Bidwell,M.C., Curtis,S.W., Washburn,T.F., McLachlan,J.A. and Korach,K.S. (1992) Coupling of dual signaling pathways: epidermal growth factor action involves the estrogen receptor. Proc. Natl Acad. Sci. USA, 89, 4658–4662. 45. Ignar-Trowbridge,D.M., Pimentel,M., Teng,C.T., Korach,K.S. and McLachlan,J.A. (1995) Cross talk between peptide growth factor and estrogen receptor signaling systems. Environ. Health Perspect., 103, 35–38. 46. Ignar-Trowbridge,D.M., Pimentel,M., Parker,M.G., McLachlan,J.A. and Korach,K.S. (1996) Peptide growth factor cross-talk with the estrogen receptor requires the A/B domain and occurs independently of protein kinase C or estradiol. Endocrinology, 137, 1735–1744. 47. Panico,L., D’Antonio,A., Salvatore,G. et al. (1996) Differential immunohistochemical detection of transforming growth factor alpha, amphiregulin and CRIPTO in human normal and malignant breast tissues. Int. J. Cancer, 65, 51–56. 48. Wattiez,R., Nonclercq,D., Journe,F., Toubeau,G., Zanen,J., Falmagne,P. and Heuson-Stiennon,J.A. (1996) Involvement of transforming growth factor-α and its receptor in a model of DES-induced renal carcinogenesis in the Syrian hamster. Carcinogenesis, 17, 1615–1622. 49. Walker,C., Everritt,J., Freed,J.J., Knudson,A.G. and Whiteley,L.O. (1991) Altered expression of transforming growth factor-α in hereditary rat renal cell carcinoma. Cancer Res., 51, 2973–2978. 50. Goldfarb,S. and Pugh,T.D. (1990) Morphology and anatomic localization of renal microneoplasms and proximal tubule dysplasias induced by four different estrogens in the hamster. Cancer Res., 50, 113–119. 51. Zhu,B.T., Evaristus,E.N., Antoniak,S.K., Sarabia,S.F., Ricci,M.J. and Liehr,J.G. (1996) Metabolic glucuronidation and demethylation of estrogen conjugates as a source of parent estrogens and catecholestrogen metabolites in Syrian hamster kidney, a target organ of estrogen-induced tumorigenesis. Toxicol. Appl. Pharmacol., 136, 186–193. 52. Jordan,V.C. and Murphy C.S. (1990) Endocrine pharmacology of antiestrogens as antitumor agents. Endocr. Rev., 11, 578–610. Received on April 7, 1998; revised on July 16, 1998; accepted on August 10, 1998
2047
