EVALUATION OF THE ASSOCIATION OF

Sharma et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online)

EVALUATION OF THE ASSOCIATION OF rs8052394 OF METALOTHIONEIN-1A GENE WITH TYPE 2 DIABETES MELLITUS IN NEPALESE POPULATION Surya Prasad Sharma1,2* ,Bishal Khatiwada1,2, Binita Dhakal1,2, Uddhav Timilsina1 1. Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal 2. Department of Biotechnology, Sikkim Manip al University, Gangtok, Sikkim *Corresponding author: [email protected] ABSTRACT Polymorphisms in metallothionein-1A gene associated with the risk of type 2 diabetes mellitus and its complications. Metallothioneine (MT) as a potent antioxidant can affect energy metabolism. The present study was undertaken to investigate the association between MT gene polymorphism and type 2 diabetes mellitus. Polymorphism in rs8052394 of Metallothioneine 1A gene at lys51Arg is the most prevalent mutation in T2DM. Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) has been found to be a reliable and effective tool to identify the specific gene alteration that is responsible for the development of T2DM and its complication. The aim of study was to identify the mutation in specific part of rs8052394 of MT1A gene (lys51Arg substitution) in diabetic population by PCR-RFLP technique. All together 62 diabetic samples were collected and DNA extraction was performed according to protocol of D.K. Lahari et al. Amplification of fragment with MT1A gene at 51th position of amino acid performed in a XP Thermocycler using primers Forward: 5’-ACTAAGTGTCCTCTGGGGCTG 3’ and Reverse: 5’-AATGGGTCACGGTTGTATGG 3’ of MT1A gene cleaved by pstI enzyme. The restriction fragments obtained were electrophoreses in a 2% agarose gel and were visualized using transilluminator. Mutation of MT1A gene was present in 40.32% of 62 patients, out of which 19.35%was of ≤50 yrs of age group. On comparing the mean age of two category of genotype (AA and AG/GG, correlation is statistically significant with p=0.044 (CI=95%).This is the first time that the mutation positions in MT1A gene Lys51Arg substitution have been studied in Nepalese population with Type II diabetic. Since Nepal is geographically located between two countries (India and China) with around 30% of world’s total diabetic cases, researches in this subject seems to be of a rationale work. Keywords: Diabetes Mellitus type II, SNP, rs8052394, Metallothioneine 1A, PCR-RFLP 2009). In general the MT is known to modulate three INTRODUCTION fundamental processes: Diabetes mellitus is a metabolic disorder in which person is characterized by the high blood sugar either 1) The release of gaseous mediators such as hydroxyl because the body does not produce enough insulin, or radical or nitric oxide; because cells do not use the insulin that is produced 2) Apoptosis, and (World Health Organisatio, 1999). The classical 3) The binding and exchange of heavy metals such as symptoms of diabetes are polyuria (frequent urination), zinc, cadmium or copper. polydipsia (increased thirst) and polyphagia (increased hunger) (Cooke, 2008). Almost one in 10 of the world Metallothionein and Its Relationship with Diabetes: population already has this condition, or can be expected Metallothioneins (MTs) are a group of intracellular metalto develop it during their lifetime, with prevalence rates binding and cysteine-enriched proteins and are highly forecast to double within the next 15 years (Florence, inducible in many tissues in response to various types of 2003). According to WHO (2000A.D.), at least 171 stress. Although it mainly acts as a regulator of metal million people worldwide suffer from diabetes, or 2.8% of homeostasis such as zinc and copper in tissues, MT also the population (Wild, 2004). acts as a potent antioxidant and adaptive (or stress) protein Metallothionein 1A (MT1A), mRNA: Metallothionein (MT) is a sulfhydryl- and cysteine-rich protein found in microorganisms, plants and all invertebrate and vertebrate animals. Metallothioneins are a group of ubiquitous lowmolecular-weight proteins that have functional roles in cell growth, repair and differentiation. These are those family of proteins with low molecular mass and high affinity to certain metal ions (Cai, 2007). They are implicated primarily in metal ion detoxification, in that they are essential for the protection of cells against the toxicity of cadmium, mercury and copper (Higashimoto, IJRPB 1(5)

www.ijrpb.com

to protect cells and tissues from oxidative stress. Diabetes affects many Americans and other populations, and its development and toxic effect on various organs have been attributed to increased oxidative stress. Studies showed that zinc-induced or genetically enhanced pancreatic MT synthesis prevented diabetes induced by chemicals such as streptozotocin and alloxan, and zinc pretreatment also prevented spontaneously developed diabetes. Since diabetic complications are the consequences of organ damage caused by diabetic hyperglycemia and hyperlipidemia through oxidative stress, whether MT in nonpancreatic organs also provides a preventive effect on September – October 2013

Page 570

Sharma et.al


diabetic toxicity has been recently investigated. It has been demonstrated that overexpression of cardiac MT significantly prevented diabetes-induced cardiomyopathy. Likewise, over expression of renal MT also prevented diabetes-induced renal toxicity. In addition, it was found that MT as an adaptive protein is over expressed in several organs in response to diabetes. Therefore, the biological importance of diabetes-induced MT in diabetic complications and subsequent other pathogenesis was further explored. This polymorphism is the result of a nucleotide change A to G at position 55231329 of chromosome 16. Similarly 225 number position of mRNA sequence, and it results in the substitution of Lysine (k) by Arginine (r) at 51 position of the MET1A protein. In the wild type, codon AAA codes for Lysine but in mutated type, codon AAA changes to AGA hence it codes for different amino acid Arginine. After analysis by MUpro we found that protein structure stability was decrease due to this polymorphism. Among the seven identified SNPs: rs8052394, rs11076161, rs8052334, rs964372, rs7191779, rs708274 and rs10636. Significant associations of MT1A rs8052394 (G alteration) with T2DM and decreased serum SOD activity were established. The other six SNPs were not significantly associated with T2DM. However, SNPs rs964372 and rs10636 were found to be significantly associated with increased serum triglyceride and neuropathy among T2DM individuals. It is a restriction enzyme isolated from an E. coli strain that carries the PstI gene from Providencia stuartii 164 (ATCC 49762). According to Nepal Diabetic Association, the number of people suffering from diabetes above 40 years in urban areas has climbed up to 19% of special note is that there will be a 67% increase in prevalence of diabetes in developing countries from 2010-2030 (Shaw, 2010). According to UN, 246 million people in the world are suffering from diabetes and approximately half of that fall in Nepal, India, China and other Asian countries. Increase in the incidence of diabetes mellitus is the 4th leading cause of death in world. Each year 3.8 million people die from diabetes and its related complication like cardiomyopathy, stroke, nephropathy, neuropathy, eye disease etc and the gene metallothionein 1A may be responsible for such complications. It has also been found that polymorphism in metallothionein 1A gene may be responsible for even inducing diabetes not only its complications. Polymorphism in single nucleotide in metallothionein 1A leads for to decrease in level of SOD which may be due to the death of pancreatic β cells (Grarup, 2007). Metallothionein (MT) isoforms I and II are polypeptides with potent antioxidative and antiinflammatory properties (Lina, 2008) and once occur polymorphism; it causes in the alteration in the normal function of the protein and causes different complications IJRPB 1(5)

www.ijrpb.com


like aging, neuropathy, retinopathy, stroke etc. Since diabetes and its complications are the 4th leading cause of death, it needs to be diagnosed soon. The most rapid results could be achieved by using molecular methods including real-time PCR, single-strand-conformation polymorphism analysis (SSCP) (Lina, 2008) multiplexallele-specific PCR (MASPCR), mass spectrophotometry, Allele-Specific Hybridization etc. But the PCR-RFLP approach has several advantages of being cheap, robust and simple to both perform and interpret, basically requiring PCR and electrophoresis set up. Genes significantly associated with developing type 2 diabetes, include TCF7L2, PPARG, FTO, KCNJ11, NOTCH2, WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and HHEX (Lina, 2008; Shoelson, 2006). Within all these family, Metallothionine and its different isoforms have a relationship with T2DM and other disease like neuropathy, hyperlipidemia etc. Among different MT, the isoform MT 1A with SNP rs8052394 is found to have a significant relationship with T2DM (Lina, 2008). The magnitude and trends in diabetes and the polymorphism in MT1A gene at rs8052394 are epidemiologically important to monitor, the estimation of the burden of disease is programmatically relevant in shaping policies for screening and treatment. METHODS Study Population: 63 diabetic subjects (Male: 30 Female: 32) were randomly selected within Kathmandu Valley Population. Samples collected were reported as T2DM from Kathmandu Model Hospital, Bhrikutimandap Samjhana Laboratory, Mangalbazzar. Study Design: A cross sectional study was designed to explore the polymorphism in rs8052394 of MT 1A gene in T2DM patients. Study Site: Department of Biotechnology, College for Professional Studies, Kathmandu, Nepal. Selection of Sample: Samples reported as T2DM according to WHO criteria 2006 Criteria to Confirm T2DM 1) Age above 40 years 2) Fasting Blood Glucose: >110mg% 3) Post-prandial Glucose: >140mg% Data Processing and Analysis: Data will be analyzed manually as well as using SPSS and interpreted according to frequency distribution and percentage. The statistical tool chi-square and t test will be applied to analyze the data. Data will be presented in tables and figures. Clinically and epidemiologically relevant information from each patient including, age, sex, dietry habits was obtained. DNA extraction from T2DM samples: D.K Lahiri et.al method: 1% Agarose Gel Electrophoresis of Extracted DNA: 1% agarose gel was September – October 2013

Page 571

Sharma et.al


prepared with 0.5 µg/ml if Ethidium Bromide (EtBr) in it. 6 µl if each extracted DNA sample and the loading dye mixed in the ratio 5:1 was loaded on the wells and run for an hour at 80-90 Volt on Tris Acetate EDTA (TAE) buffer. The DNA bands were observed under UV transilluminator. PCR Amplification of rs8052394 Specific Exon Fragment of MT1A Gene: The primary task for performing the PCR is to standardize the reaction mixture and to optimize the PCR conditions for the reaction to occur accurately so that the DNA is amplified efficiently. The reaction and the PCR programme were standardize to precisely amplify the rs8052394 specific Exon fragment of MT1A gene in the DNA sample by PCR using the primers to get a 283 bp amplified product. Forward: 5’ACTAAGTGTCCTCTGGGGCTG 3’ Reverse: 5’AATGGGTCACGGTTGTATG3’ 2% Agarose gel electrophoresis of PCR amplified products: To check if the specific DNA segments have been amplified or not, the PCR products were electrophoresed on 2% agarose gel(0.8gm of agarose+40ml of 1X TAE buffer+0.5µg/ml of EtBr) in 1X TAE buffer along with 100bp DNA ladder(Fermentas) for 1 hour at 90 volt. Since the specific PCR primers amplified a 283bp PCR product, single DNA band was observed lying in between 200 and 300bp as indicated by DNA marker when viewed on UV transilluminator. The PCR amplified products were stored at 4°C. Restriction Digestion of PCR amplified


Products Steps:  Incubation at 37°C for 3 hours  Heat Inactivation at 65°C for 20 minutes  Holding at 4°C forever. RESULTS Genomic DNA was extracted from blood cells. The extracted DNA was run through 1% agarose gel electrophoresis. PCR product was run through 2% agarose gel electrophoresis. Finally digested product was run through 3% agarose gel electrophoresis. Further the incubation of the reaction mixture was carried out in the thermocycler and the following program was used; Then the digested product was analyzed by agarose gel electrophoresis. 3%Agarose gel Electrophoresis of digested products: After digestion of the 283bp fragment obtained by PCR, to check for three possible genotypes, 15µl of digested products were mixed with 3µl of loading dye and loaded on the wells of 3%agarose gel in 1XTAE buffer along with 100bp DNA ladder for 1 hour at 90 volts. The result was viewed under UV transilluminator for number of DNA fragments obtained. The amplified product was subjected to digestion by PstI restriction enzyme. After digestion of the 283 bp fragment by PCR, 165bp, 283bp the restriction enzyme digested fragment was run on 3% agarose gel electrophoresis. The gel picture below depicts the band pattern for genotypes. Genotypic distribution was in accordance with Hardy-Weinberg Equilibrium when analysed by PopGene.S2 software with χ2=1.7494, df=1 and P>0.05.

Table.1. PCR reaction mixture with component and volume Reagent Stock Final Concentration Volume/ Reaction 10XPCR buffer 2.5µl 25mM Mgcl2 1.5mM 2.0µl 10 µM (Each) dNTPs 200 µM 0.5µl 100 µM Reserve primer 0.4 µM 1.0µl 5 units/ µl.Taq polymerase 0.4 µM 0.2µl Nuclease free D/W 1 Units/ µl 12.8µl Total Master Mix 20 µl DNA extract 5 µl Total 25 µl

IJRPB 1(5)

www.ijrpb.com

September – October 2013

Page 572

Sharma et.al



Table.2.The following program was standardized for the amplification reaction Step Temperaure (oC) Time Initial Denaturation 95 5 Minutes Denaturation 95 1 minutes Primer Annealing 55.7 45 seconds Extension 72 45 seconds Cycle repeat from step 2 (35 cycles) Final extension 72 7 minutes Holding 4 Forever End Table.3.The reaction mixture for restriction digestion Master Mix for Restriction Digestion Pst I 0.5 µl 10X Buffer ‘O’ 1.5 µl Nuclease free distilled water 3.0 µl PCR product 10 µl Table.4.Genotype Distribution in Nepalese Population Allotypes Band Patterns

Frequency Total sample (a)

GG 118 165 1 62

GA 118 165 283 24

AA 283 37

Table.5. Distribution of genotypic frequency of SNP rs8052394 SNP Group CASE no Genotype X2 P 62 Rs8052394 Case GG GA AA 1.7494 0.79035 1 24 37 Table6: Agewise distribution in accordance to mutation Age < 50 51-60  61 33.87 22.58 43.55 Percentage 21 14 27 Total Number

Figure.1.WHO distributions of diabetic people

IJRPB 1(5)

www.ijrpb.com

Figure.2.Outline of mechanisms by which MT coordinate with Zn prevents diabetes development and diabetic complications rs8052394 of MET1A gene


Page 573

Sharma et.al



Figure.3.Gender wise distribution of patients

Figure.6. 3% Agarose Gel Electrophoresis of digested product by PSTL restriction enzymes DISCUSSION The present study revealed an association of MT genes with T2DM. SNP rs8052394 detected in this study was highly polymorphic. The χ2 goodness-of-fit test showed that the genotypic distribution of rs8052394 SNP was not deviated from the Hardy- Weinberg equilibrium (P >0.05), suggesting the suitability of this sample pool for genetic analysis. The allelic frequency distribution analysed by PopGene software showed that ‘G’ allele (p=0.79035) is high in Nepalese Population whereas ‘A’ allele (q=0.20965) is less in frequency. The gender wise distribution of rs8052394 of MT1A gene mutated and wild type or differently mutated strains. Among male subjects 30 (48.39%) weresuffering from diabetes and 32(51.61%) were from female subjects. This shows no any significant relationship between the prevalence of diabetes mellitus and gender. Agewise distribution of the T2DM patient: Agewise distribution of the patient shows that 33.87% people were less than 50 years, 22.58 were between 51-60 and 43.55 %were >61. In a given diabetic population, the chance of alteration on different genes are possible which are responsible for the induction of T2DM (Shoelson, 2006; Lyssenko, 2008). But the role of MT1A is most widely studied due to the importance of this gene. The mutation IJRPB 1(5)

www.ijrpb.com

in MT1A gene is a major mechanism for the development of diabetes and its complications. The most common mutation is the Lys51Arg substitution in MT1A gene, which is present in approximately 36.13% of the diabetic population and is associated with relatively high level induction of the diabetes and its complication (Lina, 2008). But however it should be remembered that at normal condition MTIA gene acts as antioxidant therefore prevents diabetes (Papouli, 2000). The most frequent mutation patterns of diabetic patient of MT1A gene occurs at rs8052394 fragment at aminoacid51 (36.13%) of MT1Agene. But mutation in MT1A gene occurs in a higher frequency than any other gene and is regarded as to be most important in diagnosing diabetes (Lina Yang, 2008). CONCLUSION The study of genotype frequency distribution for the MT1A polymorphism in rs8052394 in Nepalese population from Nepal for the first time will definitely serve as a major achievement in understanding the molecular level of mechanism and effects of the gene mutation which varies in different geographical region of world. We found that rs8052394 of MT1A gene mutation at amino acid 51 accounted 40.3% among which the mutation is more commonly found on the age group less September – October 2013

Page 574

Sharma et.al


than 50years. To the best of our knowledge frequency of the MT1Agene lys51arg mutation has not been previously determined in Nepalese diabetic population. The higher percentage (40.3%) of common mutation in MT1A definitely highlights the importance of the 51st amino acid for development of diabetes and its complication. BIBLIOGRAPHY American diabetes association, Report: Type 2 diabetes in children and adolescents. Diabetes care 2000, 23:381-9 Cai L, Diabetic cardiomyopathy and its prevention by metallothionein: experimental evidence, possible mechanisms and clinical implications, Curr Med Chem, 14, 2007, 2193–2203. Cooke DW, Plotnick L, Type 1 diabetes mellitus in pediatrics, Pediatr Rev Nov, 29 (11), 2008, 374–384. Florence Demenais, Timo Kanninen, Cecilia M. Lindgren, A meta-analysis of four European genome screens (GIFT Consortium) shows evidence for a novel region on chromosome 17p11.2–q22 linked to type 2 diabetes, Human Molecular Genetics, 12(15), 2003, 1865–1873.


Mikkel Faurschou1, Milena Penkowa, Claus Bøgelund Andersen, Henrik Starklint4 and Søren Jacobsen: The renal metallothionein expression profile is altered in human lupus nephritis. Arthritis Research & Therapy, 10, 2008, 761. Papouli E, Defais M, Larminat F, Over expression of metallothionein-II sensitizes rodent cells to apoptosis induced by DNA cross-linking agent through inhibition of NF-kappaβ activation, J Biol Chem, 277, 2000, 47644769. Shoelson SE, Lee J, Goldfine AB, Inflammation and insulin resistance, J Clin Invest, 116 (7), 2006, 1793–801 Wild S, Roglic G, Green A, Sicree R, King H, Global prevalence of diabetes: estimates for 2000 and projections for 2030, Diabetes Care, 2004, 27(5), 1047–1053. World Health Organisation & Department of Non communicable Disease Surveillance (1999). Definition, Diagnosis and Classification of Diabetes Mellitus and its Complications.

Grarup N, Andersen G, Gene-environment interactions in the pathogenesis of type 2 diabetes and metabolism. Current Opinion in Clinical Nutrition & Metabolic Care, 10, 2007, 420–426. Higashimoto Minoru, Isoyama Naohiro, Ishibashi Satoshi, Inoue Masahisa, Takiguchi Masufumi, Suzuki Shinya, Ohnishi Yoshinari, Sato Masao:Tissue dependent preventive effect of metallothionein against DNA damage in dyslipidemic mice under repeated stresses of fasting or restraint, Life Sciences, 84, 2009, 569-575 J. E. Shaw, R. A. Sicree, and P. Z. Zimmet, Global estimates of the prevalence of diabetes for 2010 and 2030. Diabetes Research and Clinical Practice, 87(1), 2010, 4– 14. Lahari D. K., Steve Bye, Nurenberger Jr J. J., Mario E., Hondes D. and Crisp M, A non organic and non enzymatic extraction methods gives high yields of genomic DNA from whole blood samples than do nine other methods tested, J. Biochem. Biophys Methods, 25, 1992, 193–205 Li X, Cai L, Feng W, Diabetes and Metallothionein, Mini Rev Med Chem, 7, 2007, 761–768. Lina yang, Polymorphisms in metallothionein-1 and -2 genes associated with the risk of type 2 diabetes mellitus and its complications, Am J Physiol Endocrinol Metab, 294, 2008, 987-992. Lyssenko V, Jonsson A, Almgren P, Clinical risk factors, DNA variants, and the development of type 2 diabetes, The New England Journal of Medicine, 359 (21), 2008, 2220–2232. IJRPB 1(5)

www.ijrpb.com


Page 575