Evaluation of the Genetic Structure of Xylella fastidiosa Populations ...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2002, p. 3731–3736 0099-2240/02/$04.00⫹0 DOI: 10.1128/AEM.68.8.3731–3736.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Vol. 68, No. 8

Evaluation of the Genetic Structure of Xylella fastidiosa Populations from Different Citrus sinensis Varieties Helvećio Della Coletta-Filho* and Marcos Antonio Machado Centro de Citricultura Sylvio Moreira, Instituto Agrono ˆmico, Cordeiro ´polis SP, Brazil Received 14 January 2002/Accepted 6 May 2002

Xylella fastidiosa was isolated from sweet orange plants (Citrus sinensis) grown in two orchards in the northwest region of the Brazilian state of Sa õ Paulo. One orchard was part of a germ plasm field plot used for studies of citrus variegated chlorosis resistance, while the other was an orchard of C. sinensis cv. Peˆra clones. These two collections of strains were genotypically characterized by using random amplified polymorphic DNA (RAPD) and variable number of tandem repeat (VNTR) markers. The genetic diversity (HT) values of X. fastidiosa were similar for both sets of strains; however, HTRAPD values were substantially lower than HTVNTR values. The analysis of six strains per plant allowed us to identify up to three RAPD and five VNTR multilocus haplotypes colonizing one plant. Molecular analysis of variance was used to determine the extent to which population structure explained the genetic variation observed. The genetic variation observed in the X. fastidiosa strains was not related to or dependent on the different sweet orange varieties from which they had been obtained. A significant amount of the observed genetic variation could be explained by the variation between strains from different plants within the orchards and by the variation between strains within each plant. It appears, therefore, that the existence of different sweet orange varieties does not play a role in the population structure of X. fastidiosa. The consequences of these results for the management of sweet orange breeding strategies for citrus variegate chlorosis resistance are also discussed. The gram-negative, fastidious bacterium Xylella fastidiosa (41) is the causal agent of diseases in grapevine, plum, peach, citrus, and coffee, all of which are economically important crops grown mainly on the American continents (29). In sweet orange plants (Citrus sinensis [L.] Osb), X. fastidiosa is responsible for citrus variegated chlorosis (CVC) disease. CVC was first described in Brazil in 1987 during an outbreak of the disease in the northwest region of the state of Saõ Paulo (3, 35). The pathogen is naturally transmitted by sharpshooter (Cicadellinae) leafhoppers (33) and by natural root grafts and top grafting with infected budsticks (12). The rapid spread of CVC through Brazilian orchards and the high level of damage caused by this disease have resulted in heavy economic losses for citrus growers and the orange juice industry. A great effort has been made by researchers to select sweet orange plants with resistance to CVC. Results from screening 280 varieties of sweet orange under high X. fastidiosa inoculum pressure indicated that although all materials tested were susceptible to the pathogen, the varieties exhibited variation in the intensity of CVC symptoms (16). The use of resistant varieties is perhaps the most realistic control method for this disease. A comprehensive breeding program involving the genetic mapping of resistance to CVC and studies on the functional genome of sweet orange and its interactions with X. fastidiosa have already been started in our laboratory. Progeny of the cross between sweet orange and tangerine, which are susceptible and resistant to CVC, respectively, have been obtained for these studies (24, 25).

Since most resistance genes studied so far provide stable protection against only a subpopulation of a given pathogen (18), a change in the population structure of the pathogen may lead to overcoming of the resistance (31). Changes in the pathogen’s population structure may result from several factors, such as genetic change (mutation or recombination in response to environmental constraints), migration from other geographic areas, and host selection pressure (17, 22). Therefore, understanding of the genetic diversity and population structure of the pathogen and how they could be influenced by host diversity is vital for the success of any breeding program. Genetic characterization studies of X. fastidiosa have been limited to the relationships between strains obtained from different hosts (including sweet orange) and geographic areas, with strong associations found between strain and host and between strain and geographic origin of the host (4, 20, 27). All previous information, based on random amplified polymorphic DNA (RAPD) analysis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, repetitive extragenic palindromic-PCR, and enterobacterial repetitive intergenic consensus-PCR, showed a close genetic relationship among X. fastidiosa strains from citrus plants (20, 30, 34). We recently showed that markers obtained by using the variable number of tandem repeats (VNTR) technique provided a high-resolution tool for discrimination between citrus-specific X. fastidiosa strains from host plants grown in different geographic regions (7). The necessity for studies on the roles of different citrus varieties in the genetic variability of X. fastidiosa colonizing this host has been suggested by Rosato et al. (34). In addition, host genotypes are known to apply selection pressure to pathogen population structure (21, 32). In the research presented in this paper, we used RAPD and VNTR molecular markers to examine the genetic variation

* Corresponding author. Mailing address: Laborato ´rio de Biotecnologia, Centro de Citricultura Sylvio Moreira, Instituto Agrono ˆmico, CEP 13490-70, CP04, Cordeiro ´polis SP, Brazil. Phone and fax: (055) 19 546-1399. E-mail: [email protected]. 3731

3732

APPL. ENVIRON. MICROBIOL.

COLETTA-FILHO AND MACHADO

between X. fastidiosa strains recovered from different sweet orange varieties displaying symptoms of CVC and investigated the role of host heterogeneity in determining the genetic structure of the sampled X. fastidiosa population. We also determined if different X. fastidiosa genotypes colonize the same sweet orange plant. The resulting information could provide vital assistance to the implementation of disease management strategies as sweet orange breeding programs focus on developing CVC-resistant varieties. MATERIALS AND METHODS Sampling procedure. X. fastidiosa strains were collected from sweet orange plants growing in two bordering orchards located in the northwest region of the Brazilian state of Saõ Paulo. One collection of X. fastidiosa strains was obtained from 12 different sweet orange varieties belonging to a germ plasm field plot used for studies of CVC resistance (the UB orchard), while the other collection of X. fastidiosa strains was recovered from 12 randomly selected sweet orange (C. sinensis cv. Peˆra) plants growing in a clonal orchard (the NP orchard). A total of 144 strains of X. fastidiosa were analyzed, 72 strains from trees in the UB orchard (the UB population) and 72 strains from trees in the NP orchard (the NP population), with six strains per plant being examined in the final study. All of the strains from the same orchard were regarded as one population, whereas strains from the same plant within each orchard were regarded as one subpopulation. Thus, the 144 strains were divided into two populations consisting of a total of 24 subpopulations. All of the plants were grafted onto Rangpur lime rootstock. As a source of X. fastidiosa we used branch fragments (3 to 5 mm in diameter) with leaves showing typical CVC symptoms which were randomly collected from the canopy of each tree. Isolation of X. fastidiosa. Branch fragments were surface disinfected with 2% bleach for 3 min and 70% ethanol for 2 min, followed by a rapid immersion in 95% ethanol and flaming. The branches were cut in the middle, and the sap was squeezed out with a pair of pliers and plated onto buffered charcoal-yeast extract (BCYE) agar (42). Plates were incubated at 28°C for 15 to 20 days, after which two colonies per plate were randomly selected using a stereo microscope and streaked onto fresh BCYE agar. Strains were identified as X. fastidiosa based on in vitro fastidious growth and PCR assays with the primers CVC-1 (5⬘-AGATG AAAACAATCATGCAAA-3⬘) and 272-2int (5⬘-GCCGCTTCGGAGAGCATT CCT-3⬘), which are specific to CVC-causing X. fastidiosa (28). The cultures were stored at ⫺80°C in PW broth (8) containing 30% glycerol. DNA preparation. After culture in BCYE, X. fastidiosa genomic DNA was extracted using the cetyltrimethylammonium bromide technique (43) with minor modifications (7). The DNA concentration was estimated by electrophoresis in a 0.8% (wt/vol) agarose gel, and the DNA solution was diluted to 5 ng/␮l and stored at ⫺20°C. RAPD amplification. Reactions were carried out as previously described (7). Ten RAPD primers (Table 1), selected in a preliminary screening of 71 primers, were used to generate repeatable polymorphism. Primers that were monomorphic, yielded ambiguous interpretation, or did not yield amplification products were discarded. The reproducibility of the selected RAPD markers that were used in the analysis was tested by performing amplifications with different concentrations (5 to 45 ng/␮g) of DNA. The RAPD reaction products were separated by electrophoresis in 1.3% (wt/vol) agarose gels and stained with ethidium bromide. RAPD band sizes were estimated by comparison with a 1-kb DNA ladder marker (Gibco BRL). VNTR amplification. The three highly polymorphic primers shown in Table 1 were used for the VNTR amplifications, which were carried out as previously described (7). VNTR products were separated by gel electrophoresis in 3% (wt/vol) agarose gels and stained with ethidium bromide. Fragment sizes were estimated based on migration relative to a 100-bp size marker (Gibco BRL). Data analysis. Because the samples were haploid, all RAPD and VNTR fragments were scored as one putative locus with two alleles, one allele indicating the presence of a fragment and the other indicating the absence of it. The data sets were compiled as a matrix of strains and RAPD and VNTR fragments. Standard population genetic statistics were calculated using the POPGENE software, version 1.32 (http://www.ualberta.ca/⬃fyeh/index.htm). For each locus, heterogeneity of the marker frequency across populations was calculated by the likelihood ratio (G2), based on a null hypothesis of no differences in allele frequencies between populations. The proportion of the total genetic diversity attributable to population differentiation was measured using Nei’s coefficient of the gene differentiation (GST) (23). The variance associated with the GST value

TABLE 1. Sequences of RAPD and VNTR primers used in this study Primer

Sequence for 5⬘33⬘ amplification

RAPD OPA02 ..........................................TGCCGAGCTG OPA03 ..........................................AGTCAGCCAC OPD20..........................................ACCCGGTCAC OPG19..........................................GTCAGGGCAA OPH07..........................................CTGCATCGTG OPH12..........................................ACGCGCATGT OPH18..........................................GAATCGGCCA OPI02............................................GGAGGAGAGG OPN04 ..........................................GACCGACCCA OPU10..........................................ACCTCGGCAC VNTR SSR20 ...........................................ATGAAGAAGCCAGGATACAT GCTACACGTGCAACAAC SSR30 ...........................................TACGCTGCACCTGTCTG CTGTGAACTTCCATCAATCC SSR40 ...........................................ACCTTGACGACGGATG AGGAACTGCTGCTACTGAT

was calculated by 1,000 bootstrap samplings of loci (J. Beaulieu, Canadian Forest Service, Sainte-Foy, Quebec, Canada). The genotypic diversity (G) was calculated as G ⫽ 1/⌺gj2, where gj is the frequency of the jth genotype and n is the total number of strains (39). The WINAMOVA 1.55 software (http://lgb.unige.ch/software/win/amova/) was used for the molecular analysis of variance (AMOVA) (9). This method is based on the principles of classic analysis of variance and was carried out using a matrix of Euclidian distances between all pairs of haplotypes to estimate how much of the RAPD and VNTR variation between or among strains was due to a population effect. Variance components were estimated based on the proportion of the total variance attributable to the population level effect (␾STAT). The variance components and ␾STAT values were tested statistically by nonparametric randomization tests with 1,000 repetitions, using the null hypothesis of sample variation due to random sampling error in the construction of the populations.

RESULTS RAPD and VNTR variation. Selected RAPD markers were always reproducible independently of the variation in the concentration of the DNA template. This was confirmed by the fact that identical bands were always obtained for individually selected RAPD markers. The number of polymorphic markers for each RAPD primer ranged from 1 to 3, while the OPI02870 and OPN041370 alleles were unique to the NP strains (Table 2) but occurred only rarely in the NP strains. The fragment OPI02870 is pXF1.3 (GenBank accession no. NC 002489), plasmid borne, and was present in X. fastidiosa from several host species but rarely present in X. fastidiosa from citrus (data no shown). The VNTR primers showed more polymorphism, with the number of polymorphic markers ranging from five to seven for each primer. Despite this polymorphism, the allele frequencies were relatively homogeneous for both UB and NP strains, with no significant G2 values except for the OPI021720, OPN041370, OPU10950, and SSR30220 alleles, which indicates low genetic differentiation between the UB and NP populations (Table 2). Genotypic variation. The genotypic diversity among UB and NP X. fastidiosa strains was calculated based on RAPD and VNTR multilocus genotype data as suggested by Stoddart and Taylor (39). The maximum value of G is obtained when all strains show different genotypes. Stoddart’s measure of geno-

GENETIC STRUCTURE OF XYLELLA FROM CITRUS VARIETIES

VOL. 68, 2002

TABLE 2. Frequency of RAPD and VNTR polymorphic markers and G2 test for allele frequencies for X. fastidiosa isolated from different sweet orange varieties (UB population) and a clonal sweet orange variety (NP population) Polymorphic allele

Frequency UB

NP

G2 testa

RAPD locus OPA02900 OPA03923 OPD201634 OPG191268 OPH071480 OPH121890 OPH121367 OPH18920 OPI021720 OPI021008 OPI02870 OPN041227 OPN041370 OPU101330 OPU10950

0.77 0.22 0.22 0.22 0.22 0.72 0.27 0.22 0.22 0.22 0.00 0.22 0.00 0.03 0.22

0.67 0.33 0.33 0.35 0.35 0.67 0.33 0.33 0.43 0.36 0.01 0.10 0.10 0.08 0.08

2.22ns 2.22ns 2.22ns 2.78ns 2.78ns 0.52ns 0.52ns 2.22ns 7.20** 3.38ns 1.39ns 2.78ns 10.06** 2.21ns 5.53*

VNTR locus SSR20100 SSR20120 SSR20130 SSR20150 SSR20170 SSR20190 SSR20230 SSR30220 SSR30230 SSR30260 SSR30300 SSR30320 SSR30360 SSR40160 SSR40260 SSR40320 SSR40350 SSR40400

0.00 0.03 0.36 0.00 0.028 0.37 0.22 0.00 0.50 0.07 0.30 0.11 0.028 0.30 0.00 0.17 0.4861 0.0278

0.01 0.00 0.36 0.03 0.08 0.32 0.22 0.11 0.39 0.12 0.22 0.11 0.04 0.36 0.01 0.28 0.34 0.00

1.39ns 2.80ns 0.00ns 0.09ns 0.13ns 0.48ns 0.00ns 11.56** 1.80ns 1.28ns 1.29ns 0.00ns 0.21ns 0.50ns 1.39ns 2.59ns 2.8ns 2.80ns

a Likelihood ratio G2 test. A null hypothesis of no differences in allele frequencies between or among the two sets was used. ns, not significant; **, significant (P ⬍ 0.01); *, significant (P ⬍ 0.05).

typic diversity for some strains from a few plants reached values of ⬇43 and 75% of the maximum possible for multilocus RAPD and VNTR genotypes, respectively. Out of a maximum value of 72, the G values for the overall UB population were 3.5% for RAPD markers and 11.2% for VNTR markers, while the G values for the overall NP collection were 3.9% for RAPD markers and 14.4% for VNTR markers (Table 3). Population structure. Despite the facts that the UB population was obtained from 12 different varieties and the NP population was obtained from a clonal orchard, computations of gene diversity indicated that the diversity between UB and NP populations represented a minor and nonsignificant proportion of the total genetic diversity, whereas the diversity within each population (HS) accounted for almost all of the total genetic diversity (HT). For both types of molecular markers, the averages of Nei’s genetic diversity were similar for both the UB and NP populations (Table 4). The HT values for the RAPD loci were 0.10 and 0.09, while those for the VNTR loci were higher, with values of 0.28 and 0.26, respectively, for the

3733

TABLE 3. Genotypic diversity (G) determined using RAPD and VNTR markers and percentage of maximum possible diversity in the UB and NP collections of X. fastidiosa strains RAPD

VNTR

X. fastidiosa strains

No.

G

G/N (%)

UB collection NP collection

7 8

2.51 2.81

3.5 3.9

a

No.

G

G/N (%)

19 18

8.07 10.40

11.2 14.4

a Percentage of maximum possible value of G (G ⫽ 72), when all strains show different genotypes.

UB and NP populations for both types of markers. The proportion of the total genetic diversity attributable to the population differentiation (GST) between the UB and NP populations was very low and nonsignificant, being 0.02 for RAPD markers and 0.009 for VNTR markers (Table 4). When the population structure within each orchard was analyzed, strains from the same plant were considered a subpopulation. Larger values of GST were obtained for both the UB and NP populations, showing a significant differentiation among the subpopulations. In the UB population the variation level within the plants was higher than that in the NP population, but for both populations the variations among plants were still the major component of the total variation (Table 4). Calculation of ␾STAT by using AMOVA confirmed that almost all (⬇95% for RAPD markers and 100% for VNTR markers) of the estimated diversity occurred within the populations of strains. In contrast, only ⬇4% of the genetic diversity based on RAPD markers and 0% of the diversity based on VNTR markers was attributable to differences among the UB and NP populations of strains (data not shown). A more detailed analysis based on AMOVA partition of the total variance indicated the proportions of total genetic diversity of the UB and NP populations of X. fastidiosa strains that were attributed to diversity among different plants (78% for RAPD markers and ⬇68% for VNTR markers) and to diversity within the same plant (23% for RAPD markers and ⬇37% for VNTR markers) (Table 5). The percentage of genetic diversity attributed to diversity between the UB and NP populations of strains was very low and nonsignificant, being ⫺1.44% for RAPD markers and ⫺4.88% for VNTR markers (Table 5). Estimates of Nei’s unbiased genetic distance between the UB and NP populations were only 0.0037 based on

TABLE 4. Mean values of Nei’s coefficient of gene diversity in the total population of X. fastidiosa and its components (within and between UB and NP populations) as determined using RAPD and VNTR markersa Comparison

Between UB and NP Among plants within UB Among plants within NP

RAPD HT

0.08 0.10 0.09

HS

0.08 0.03 0.003

VNTR GST ns

0.02 0.637* 0.966*

HT

HS

GST

0.22 0.28 0.26

0.21 0.12 0.05

0.009ns 0.574* 0.799*

a Values of genetic diversity as described by Nei (23). HT, overall genetic diversity (over both NP and UB populations); HS, genetic diversity within each component of the global population (orchard or plants within orchard); GST [(HT ⫺ HS)/HT], proportion of total genetic diversity attributable to population differentiation according to orchards or plants within the orchards. *, significant (P ⬍ 0.01); ns, not significant.

3734


APPL. ENVIRON. MICROBIOL.

TABLE 5. AMOVA within and among UB and NP populations of X. fastidiosa strains from different sweet orange plants as determined by RAPD and VNTR markers Source of variationa

df

␾STAT

Variance component (%)

P valueb

RAPD markers Among strains from UB and NP Among plants within UB and NP Within the same plant from UB and NP

1 23 143

0.014 0.769 0.766

⫺1.44 76.75 23.25

0.431 ⬍0.001 ⬍0.001

VNTR markers Among strains from UB and NP Among plants within UB and NP Within the same plant from UB and NP

1 23 143

0.049 0.650 0.633

⫺4.88 64.11 35.89

0.968 ⬍0.001 ⬍0.001

a The global population of X. fastidiosa was partitioned into hierarchical components, i.e., among UB and NP orchards (collections of strains from orchards), among plants (strains from the plants) within the UB and NP orchards, and within UB and NP plants (strains from the same plant). b Probability of having larger values than those observed with 1,000 randomizations of the different treatments.

RAPD markers and 0.0052 based on VNTR markers, confirming the small genetic distance between these two sets of strains. DISCUSSION In the research presented in this paper, we analyzed the genetic diversity of 144 X. fastidiosa strains from sweet orange trees with symptoms of CVC growing in neighboring orchards. One of these orchards contained 12 different sweet orange varieties (the UB orchard), while the other was a sweet orange (C. sinensis cv. Peˆra) clonal orchard (the NP orchard). In agreement with previous papers (19, 30, 34), our RAPD and VNTR analysis showed a low genetic diversity across CVCcausing X. fastidiosa strains. Compared to RAPD markers, the VNTR markers were more polymorphic as estimated by HT values (Table 4), which was in accord with our previous data (7). The HT values for the VNTR markers from the X. fastidiosa populations analyzed in this study (Table 4) were smaller than those reported for other collections of X. fastidiosa strains isolated from citrus (H ⫽ 0.45) (7) and also smaller than most of the values obtained with other bacterial species (1, 15, 37). The X. fastidiosa strains analyzed in our previous study (7) came from the southern and southeastern regions of Brazil, which are very different geographic locations and environments compared to those in the study described in this paper. It appears that such factors may be responsible for this difference between studies, since the genomic variability of the repeat region might be induced by environmental pressure (40). Host selection is a critical determinant of the genetic composition of a pathogen population in an agroecosystem (2, 18, 44). To assess the role of host diversity in structuring pathogen populations, an attempt to correlate the molecular data on the pathogen X. fastidiosa and the number of sweet orange varieties grown in the orchards was carried out. In contrast to the case for several pathosystems in which the varieties of host plants have been observed to determine the genetic structure of bacterial populations (5, 11, 32), in our study, sweet orange varieties did not have any effect on the population structure of

CVC-causing X. fastidiosa, as was shown by the low and statistically insignificant levels of genetic differentiation between the UB and NP populations (Tables 4 and 5). However, the genetic variation in X. fastidiosa was restricted to each orchard, whereas the total variability of X. fastidiosa was attributed to significant variations of the pathogen among and within the plants. The higher values of GST estimated for the NP population in comparison to the UB population are caused by small values of gene diversity within subpopulations (HS), indicating a low variation of pathogens within plants and a major variation of pathogens among plants (Tables 4 and 5). In practical terms, these results showed that in order to better estimate the variability in X. fastidiosa from naturally infected plants, the samples must be collected from several plants within the orchard. It is clear that different strains of X. fastidiosa occurred within the same plant. This might have resulted from either multiple inoculations by vectors from different sources of inoculum or natural genetic recombination between X. fastidiosa strains. Supporting the first hypothesis, Freitag (10) identified at least 28 families of plants as natural hosts of Pierce disease X. fastidiosa in California, whereas in citrus orchards in Saõ Paulo state, researchers found up to 10 species of wild plants hosting X. fastidiosa (S. A. Lopes, P. G. Roberto, and S. C. França, 32th Congr. Brazil. Phytopathol. Soc., abstr. 250, 1999). Regarding the possibility of natural recombination between strains, it has not yet been established whether X. fastidiosa is naturally competent. However, phages, integrons, transposons, and native plasmids have been observed in this species (13, 36), and their role as natural gene vectors in microorganisms is uncontested (2). Diversity arises and is maintained through the interplay between a variety of ecological factors (ecological opportunity and competition) and genetic factors (mutation and recombination) (38). We believe that the potential ecological factors involved in generating diversity in X. fastidiosa are the climatic conditions, the population dynamic of sharpshooter vectors, and the community of natural plants hosting X. fastidiosa. Since UB and NP are bordering orchards, the potential ecological factors causing the diversity in the pathogen are believed to operate in the same way for both orchards, resulting in similar values of genetic diversity, as indicated by our data. Although we cannot be certain about the origin of the genetic diversity found in X. fastidiosa, the data suggest that this pathogen is not indigenous to citrus plants and that a few genetically and closely related X. fastidiosa genotypes were introduced into sweet orange plants and spread by the transference of X. fastidiosa clones via contaminated citrus vegetative material. Based on ecological considerations and DNA profiling, some studies have suggested that CVC-causing X. fastidiosa could have migrated from coffee plants and adapted to citrus plants (19, 26, 30). However, studies of X. fastidiosa strains from wild host plants and from vectors present on orchards will be necessary for better understanding of the origin of genetic variation observed. The systemic occurrence of X. fastidiosa and its limitation to xylem vessels hinder the development of chemical or biological control measures. Nowadays, the management of CVC is based mainly on planting healthy nursery trees, chemical control of the vector, and removal of inoculum by eradicating

GENETIC STRUCTURE OF XYLELLA FROM CITRUS VARIETIES

VOL. 68, 2002

symptomatic young plants (⬍2 years old) and pruning branches of foliar symptoms in older trees (6). Thus, the development of sweet orange varieties with resistance to X. fastidiosa may be the most realistic control method for this disease. Our data also show that a low genetic variation does occur in CVC-causing X. fastidiosa strains, and the population structure data (GST and AMOVA) suggest that at this time there is no coevolution between orange varieties and X. fastidiosa. This low variability and lack of specialization found in X. fastidiosa among varieties of sweet orange are advantageous for the management of breeding strategies. First, populations with little variation are less able to adapt to environmental changes. More importantly, the resistance of hybrids or lines obtained from sweet orange breeding programs has high potential for a broad spectrum and longevity. However, information about the durability of genetic resistance is acquired only after the release of improved plants, the planting of large and distinct areas, and assessment over several years in the presence of a high inoculum concentration (14). In order to learn more about the population dynamics within X. fastidiosa, the next step is a broad study of geographic effects on the genetic makeup of this pathogen’s population in order to better understand genetic variation in CVC-causing X. fastidiosa and give better support to CVC resistance breeding programs. ACKNOWLEDGMENTS We thank the Montecitrus group for providing access to the citrus trees used in this study. We also thank C. I. Aguilar-Vildoso and two anonymous reviewers for critical suggestions and G. Astua-Monge and M. A. Takita for reviewing the English in the manuscript. Marcos Antonio Machado is supported by a CNPq fellowship. REFERENCES 1. Adair, D. M., P. L. Worsham, K. K. Hill, A. M. Klevytska, P. J. Jackson, A. M. Friedlander, and P. Keim. 2000. Diversity in a variable-number tandem repeat from Yersinia pestis. J. Clin. Microbiol. 38:1516–1519. 2. Arber, W. 2000. Genetic variation: molecular mechanisms and impact on microbial evolution. FEMS Microbiol. Rev. 24:1–7. 3. Chang, C. J., M. Garnier, L. Zreik, V. Rossetti, and M. L. Bove´. 1993. Culture and serological detection of the xylem-limited bacterium causing citrus variegated chlorosis and its identification as a strain of Xylella fastidiosa. Curr. Microbiol. 27:137–142. 4. Chen, J., O. Lamikanra, C. J. Chang, and D. L. Hopkins. 1995. Randomly amplified polymorphism DNA analysis of Xylella fastidiosa Pierce’s disease and oak leaf scorch pathotypes. Appl. Environ. Microbiol. 61:1688–1690. 5. Clerc, A., C. Manceau, and X. Nesme. 1998. Comparison of random amplified polymorphic DNA with amplified fragment length polymorphism to assess genetic diversity and genetic relatedness with genospecies III of Pseudomonas syringae. Appl. Environ. Microbiol. 64:1180–1187. 6. Coletta-Filho, H. D., E. F. Carlos, M. L. P. N. Targon, M. Cristofani, A. A. Souza, and M. A. Machado. 2000. Distribution of Xylella fastidiosa within sweet orange trees: influence of age and level of symptom expression of citrus variegated chlorosis, p. 243–248. In J. V. da Graça, R. F. Lee, and R. K. Yokomi (ed.). Proceedings of the 14th Conference of the International Organization of Citrus Virologists. International Organization of Citrus Virologists, Riverside, Calif. 7. Coletta-Filho, H. D., M. A. Takita, A. A. Souza, C. I. Aguilar-Vildoso, and M. A. Machado. 2001. Differentiation of strains of Xylella fastidiosa by a variable number of tandem repeat analysis. Appl. Environ. Microbiol. 67: 4091–4095. 8. Davis, M. J., B. C. Raju, R. H. Brlansky, R. F. Lee, L. W. Timmer, R. L. Norris, and R. E. McCoy. 1983. Periwinkle wilt bacterium: axenic culture, pathogenicity and relationships to other gram-negative, xylem-inhabiting bacteria. Phytopathology 73:1510–1515. 9. Excoffier, L., P. E. Smouse, and J. M. Quattro. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131:479–491. 10. Freitag, J. H. 1951. Host range of the Pierce’s disease virus of grape as determined by insect transmission. Phytopathology 41:920–934.

3735

11. Haubold, B., and P. B. Rainey. 1996. Genetic and ecotypic structure of a fluorescent Pseudomonas population. Mol. Ecol. 5:747–761. 12. He, C. X., W. B. Li, A. J. Ayres, J. S. Hartung, V. S. Miranda, and D. C. Teixeira. 2000. Distribution of Xylella fastidiosa in citrus rootstocks and transmission of citrus variegated chlorosis between sweet orange plants through natural root grafts. Plant Dis. 84:622–626. 13. Hendson, M., A. H. Purcell, D. Chen, C. Smart, M. Guilhabert, and B. Kirkpatrick. 2001. Genetic diversity of Pierce’s disease and other pathotypes of Xylella fastidiosa. Appl. Environ. Microbiol. 67:895–903. 14. Johnson, R. 1984. A critical analysis of durable resistance. Annu. Rev. Phytopatol. 22:309–330. 15. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Chupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J. Bacteriol. 182:2928–2936. 16. Laranjeira, F. F., J. Pompeu, Jr., R. Harakawa, J. O. Figueiredo, S. A. Carvalho, and H. D. Coletta-Filho. 1998. Cultivares e espećies cítricas hospedeiras de Xylella fastidiosa em condiço ˜es de campo. Fitopatol. Bras. 23: 147–154. 17. Lee, S. W., S. H. Choi, S. S. Hann, D. G. Lee, and B. Y. Lee. 1999. Distribution of Xanthomonas oryzae pv. oryzae strains virulent to Xa21 in Korea. Phytopathology 89:928–933. 18. Leung, H., R. J. Nelson, and J. E. Leach. 1993. Population structure of plant pathogenic fungi and bacteria. Adv. Plant Pathol. 10:157–250. 19. Metha, A., R. P. Leite, Jr., and Y. B. Rosato. 2001. Assessment of the genetic diversity of Xylella fastidiosa isolated from citrus in Brazil by PCR-RFLP of the 16S rDNA and 16S-23S intergenic spacer and rep-PCR fingerprinting. Antonie Leeuwenhoek 79:53–59. 20. Metha, A., R. P. Leite, Jr., and Y. B. Rosato. 2000. Polymorphism of Xylella fastidiosa by RAPD-PCR and SDS-PAGE of proteins. Fitopatol. Bras. 25: 651–656. 21. Mew, T. W., C. M. Vera Cruz, and E. S. Medalla. 1992. Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted in Phillipines. Plant Dis. 76:1029–1032. 22. MacDonald, B. A., J. M. McDermott, S. B. Goodwin, and R. W. Allard. 1989. The population biology of host-pathogen interactions. Annu. Rev. Phytopathol. 27:77–94. 23. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 70:3321–3323. 24. Oliveira, A. C., A. N. Garcia, M. Cristofani, and M. A. Machado. Identification of citrus hybrids through the combination of leaf apex morphology and SSR markers. Euphytica, in press. 25. Oliveira, R. P., M. Cristofani, C. I. Aguilar-Vildoso, and M. A. Machado. Genetic linkage maps of ⬘Peˆra’ sweet orange and ⬘Cravo’ mandarin with RAPD markers. Euphytica, in press. 26. Paradela Filho, O., M. H. Sugimori, I. J. A. Ribeiro, A. Garcia, M. J. G. Beretta, R. Harakawa, M. A. Machado, F. F. Laranjeira, J. Rodrigues Neto, and L. O. S. Beriam. 1997. Constatação de Xylella fastidiosa em cafeeiro no Brasil. Summa Phytopathol. 23:46–49. 27. Pooler, M. R., and J. S. Hartung. 1995. Genetic relationships among strains of Xylella fastidiosa from RAPD-PCR data. Curr. Microbiol. 31:134–137. 28. Pooler, M. R., and J. S. Hartung. 1995. Specific PCR detection and identification of Xylella fastidiosa strains causing citrus variegated chlorosis. Curr. Microbiol. 31:377–381. 29. Purcell, A. H., and D. L. Hopkins. 1996. Fastidious xylem-limited bacterial plant pathogens. Annu. Rev. Phytopathol. 34:131–151. 30. Qin, X., V. S. Miranda, M. A. Machado, E. G. M. Lemos, and J. S. Hartung. 2001. An evaluation of the genetic diversity of Xylella fastidiosa isolated from disease citrus and coffee in Saõ Paulo, Brazil. Phytopathology 91:599–605. 31. Rausher, M. D. 2001. Co-evolution and plant resistance to natural enemies. Nature 411:857–864. 32. Restrepo, S., C. M. Ve´lez, and V. Verdier. 2000. Measuring the genetic diversity in Xanthomonas axonopodis pv. manihotis within different fields in Colombia. Phytopathology 90:683–690. 33. Roberto, S. R., A. Coutinho, J. E. O. Lima, V. S. Miranda, and E. F. Carlos. 1996. Transmissaõ de Xylella fastidiosa pelas cigarrinhas Dilobopterus constalimar, Acrogonia terminalis e Oncometopia facialis em citros. Fitopatol Bras. 21:517–518. 34. Rosato, Y. B., J. R. Neto, V. S. Miranda, E. F. Carlos, and G. P. Manfio. 1998. Diversity of Xylella fastidiosa population isolated from Citrus sinensis affected by citrus variegated chlorosis in Brazil. Syst. Appl. Microbiol. 21:593–598. 35. Rosseti, V., M. Garnier, J. M. Breve, M. J. G. Beretta, A. R. R. Teixeira, J. A. Quaggio, and J. D. De Negri. 1990. Pre´sence de bacte´ries dans le xyle`me d’ orangers atteints de chlorose varie´gee´ une novelle maladie´ des agrumes du Bre´sil. C. R. Acad. Sci. 310:345–349. 36. Simpson, A. J. G., F. C. Reinach, P. Arruda, et al. 2000. The genome sequence of plant pathogen Xylella fastidiosa. Nature 406:151–159. 37. Souza, V., M. Rocha, A. Valera, and L. E. Eguiarte. 1999. Genetic structure of natural populations of Escherichia coli in wild hosts on different continents. Appl. Environ. Microbiol. 65:3373–3385. 38. Spiers, A. J., A. Buckling, and P. B. Rainey. 2000. The causes of Pseudomonas diversity. Microbiology 146:2345–2350.

3736


39. Stoddart, J. A., and J. F. Taylor. 1988. Genotypic diversity: estimation and prediction in samples. Genetics 118:705–711. 40. van Belkun. 1999. The role of short sequence repeats in epidemiologic typing. Curr. Opin. Microbiol. 2:306–311. 41. Wells, J. M., B. C. Raju, H. Y. Hung, W. G. Weisburg, L. Mandelco-Paul, and D. J. Brenner. 1987. Xylella fastidiosa gen. nov. sp.nov.: gram-negative, xylem-limited, fastidious plant bacteria related to Xanthomonas spp. Int. J. Syst. Bacteriol. 37:136–143. 42. Wells, J. M., B. C. Raju, J. M. Thonson, and S. K. Lowe. 1981. Evidence of

APPL. ENVIRON. MICROBIOL. the common etiology of phony peach and plum leaf scald diseases. Phytopathology 71:1156–1161. 43. Wilson, K. 1987. Preparation of genomic DNA from bacteria, p. 2.4.1–2.4.2. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Sudman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Greene Publishing Associates, New York, N.Y. 44. Zhu, Y., H. Chen, J. Fan, Y. Wang, Y. Li, J. Chen, J. Fan, S. Yang, L. Hee, H. Zeung, T. W. Mew, P. S. Teng, Z. Wang, and C. C. Mundt. 2000. Genetic diversity and disease control in rice. Nature 406:718–722.