J Antimicrob Chemother doi:10.1093/jac/dkx193
Evolution and comparative genomics of pAQU-like conjugative plasmids in Vibrio species Ruichao Li1,2, Lianwei Ye1, Marcus Ho Yin Wong1,2, Zhiwei Zheng1, Edward Wai Chi Chan1,2 and Sheng Chen1,2* 1
Shenzhen Key Laboratory for Food Biological Safety Control, Food Safety and Technology Research Centre, The Hong Kong PolyU Shenzhen Research Institute, Shenzhen, P. R. China; 2State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong *Corresponding author. Tel: (852)-3400-8795; Fax: (852)-2364-9932; E-mail:
[email protected]
Received 7 December 2016; returned 30 January 2017; revised 26 April 2017; accepted 25 May 2017 Objectives: To investigate a set of MDR conjugative plasmids found in Vibrio species and characterize the underlying evolution process. Methods: pAQU-type plasmids from Vibrio species were sequenced using both Illumina and PacBio platforms. Bioinformatics tools were utilized to analyse the typical MDR regions and core genes in the plasmids. Results: The nine pAQU-type plasmids ranged from 160 to 206 kb in size and were found to harbour as many as 111 core genes encoding conjugative, replication and maintenance functions. Eight plasmids were found to carry a typical MDR region, which contained various accessory and resistance genes, including ISCR1-blaPER-1-bearing complex class 1 integrons, ISCR2-floR, ISCR2-tet(D)-tetR-ISCR2, qnrVC6, a Tn10-like structure and others associated with mobile elements. Comparison between a plasmid without resistance genes and different MDR plasmids showed that integration of different mobile elements, such as IS26, ISCR1, ISCR2, IS10 and IS6100, into the plasmid backbone was the key mechanism by which foreign resistance genes were acquired during the evolution process. Conclusions: This study identified pAQU-type plasmids as emerging MDR conjugative plasmids among important pathogens from different origins in Asia. These findings suggest that aquatic bacteria constitute a major reservoir of resistance genes, which may be transmissible to other human pathogens during food production and processing.
Introduction Plasmids play a pivotal role in bacterial adaptation to changing environments by conferring new phenotypic characteristics on the host organism, such as resistance to antimicrobials and heavy metals, as well as expression of virulence factors.1–3 Acquisition of multiple resistance genes poses a significant health threat worldwide.2 To track MDR plasmids and study the characteristics of organisms harbouring such plasmids, different plasmid typing methods based on PCR assays targeting the replicon or relaxase genes have been devised.4 Abundant complete plasmid sequences have become available. Accordingly, novel plasmid families that were previously undetectable by conventional typing methods can now be identified. Bacteria inhabiting aquatic environments are an important reservoir of antibiotic resistance genes.5 Some plasmid-mediated quinolone resistance (PMQR) genes appear to originate from an aquatic environment and have spread to human pathogens.6 Recently, a type of MDR plasmid, i.e. the pAQU type (namely pAQU1 and pAQU2), was identified in marine pathogens in Japan.7,8 Our laboratory has recovered a plasmid, pVPH1, that had a similar backbone to pAQU-type
plasmids but contained different resistance genes.9 Sequence analysis indicated that the backbone of pAQU-type plasmids was rare in the NCBI database, suggesting the necessity to investigate the origin of these plasmids. Although scattered data regarding the prevalence of resistance genes in aquatic environments are available,10 there have been no systematic studies aimed at identifying and delineating the genetic characteristics of the typical MDR plasmids in aquatic organisms. In order to characterize resistance genes in Vibrio species systematically, we utilized a third-generation sequencing approach to obtain the complete plasmid sequences of six pAQU-type plasmids, followed by analyses using comparative genomics methods and delineation of the evolution route.
Materials and methods Bacterial strains and characterization A total of 154 Vibrio parahaemolyticus and 23 Vibrio alginolyticus isolates were obtained from different food samples during the period 2013–15 in Shenzhen, China.11,12 Primers specific for the traI gene of pAQU-type plasmids (traI-F, TCATGCCTGTAATTGGCCGT; traI-R, TTGCGGATGCTTTAGGCTGA) were used to screen different Vibrio isolates. Screening for ESBL genes was
C The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. V
For Permissions, please email:
[email protected].
1 of 4
Li et al.
Table 1. Sources and basic information of pAQU-type plasmids analysed in this work Bacterial species
Plasmid name
Size (bp)
Accession number
Location
Year of isolation
VPS62 VPS91 VAS19 VAS114 V36 V43 2011VPH2 04Ya311
V. parahaemolyticus V. parahaemolyticus V. alginolyticus V. alginolyticus V. parahaemolyticus V. parahaemolyticus V. parahaemolyticus P. damselae
pVPS62 pVPS91 pVAS19 pVAS114 pVPH1 pVPS43 pVPH2 pAQU1
184719 163005 187130 206274 183730 201098 198487 204052
KX957971 KX957972 KX957968 KX957969 KP688397 KX957970 KP791968 AB571865
Shenzhen, China Shenzhen, China Shenzhen, China Shenzhen, China Hong Kong, China Shenzhen, China Hong Kong, China Japan
2015 2015 2015 2015 2010 2013 2011 2004
04Ya090
Vibrio species
pAQU2
160406 AB856327 Japan
Strain
conducted with primers reported previously.13 Information about the pAQU-type plasmids is presented in Table 1. The ability of the complex class 1 integron to form a circular intermediate was tested by reverse PCR with outward primers as previously described.9
Conjugation assay, S1-PFGE and hybridization In order to determine the transferability of pAQU-type plasmids, conjugation experiments were performed by a filter-mating assay using azide-resistant Escherichia coli J53 as the recipient strain. Transconjugants were recovered from LB plates supplemented with 100 mg/L sodium azide and 4 mg/L ceftazidime. S1-PFGE and hybridization with the blaPER-1 probe was performed on both parental strains and transconjugants as previously described.9,12
2004
Source chicken, supermarket shrimp, supermarket shrimp, wet market shrimp, wet market shrimp, supermarket shrimp, supermarket shrimp, supermarket seawater, coastal aquaculture site sediment, coastal aquaculture site
Complex class 1 integrons Reference # # ! ! ! ! ! # #
this study this study this study this study 9
this study this study 7
8
plasmids were obtained and subjected to comparative analysis together with three published pAQU-type plasmids, i.e. pVPH1, pAQU1 and pAQU2.9 Two mosaic regions were detected within these plasmids, one of which contained an MDR region encoding various resistance genes (Figure 1). ResFinder analysis indicated that the number of resistance genes within the MDR region ranged from 0 to 10 (Table S1, available as Supplementary data at JAC Online). No resistance genes and ISs were found on pVPS91, suggesting that it may be the prototype of this type of plasmid. These MDR regions from the eight plasmids could be divided into two categories: the first type harboured the typical complex class 1 integron, and the second category harboured a Tn10-like structure (Figure S1).
Plasmid sequencing Plasmid sequencing was performed as previously described using Illumina and PacBio RS II platforms.14 All plasmid sequences were submitted to the RAST tool for annotations and modified manually by BLAST.15 BRIG software was used to compare plasmids.16 The INTEGRALL database was used to annotate and designate class 1 integrons.17 ResFinder was used to screen the resistance genes.18 All complete plasmid sequences were submitted to the NCBI database with accession numbers listed in Table 1.
Core genome and pan genome of plasmids After obtaining the complete sequences of nine pAQU-type plasmids (six of them were sequenced in this study), their core genomes were analysed using bioinformatics tools. Prokka was used to annotate the plasmid sequences19 and the gff files generated were analysed with the pan genome pipeline Roary.20 The CLC Genomics Workbench was used to create a phylogenetic tree with UPGMA (Unweighted Pair Group Method using Arithmetic averages) and 100 bootstraps based on the multiple core gene alignment (concatenated core genes) file, which was the output file from Roary. Combining the formed tree file and the gene_presence_absence file, Roary plots were utilized to generate the plasmid phylogeny tree with a matrix describing the presence and absence of core and accessory genes.
Results and discussion Epidemiology of pAQU-type plasmids Complete sequences of four blaPER-1-bearing pAQU-type conjugative plasmids and two blaPER-1-negative pAQU-type conjugative 2 of 4
Structure of MDR plasmids Among the nine pAQU-type plasmids analysed, typical MDR regions with different resistance genes were found to be conserved in the backbones of eight MDR plasmids from different species of bacteria, such as V. parahaemolyticus, V. alginolyticus and Photobacterium damselae. In this study, two typical complex class 1 integrons, which contained different class 1 integrons (In152 and In825, respectively), an ISCR1-blaPER-1-gst-abct gene cluster and duplicated 30 -CS regions, were detected among the five blaPER-1-bearing plasmids (Figure S1). It has been reported that the complex class 1 integron in pVPH1 can generate a circular intermediate (ISCR1-blaPER-1-gst-abct-qacE䉭1-sul1).9 In this study, reverse PCR assays showed that all plasmids containing the ISCR1 could generate the circular intermediate structure (data not shown). This finding indicated that this circular form could be integrated into the classical class 1 integrons to form new complex class 1 integrons. According to the plasmid alignment result, pVAS114 and pVPS43 exhibited a high degree of sequence homology (Figure S1). The structures of the MDR regions in these two plasmids were nearly identical, except that the ISCR2-tet(D)-tetR fragment was found to have integrated into the existing ISCR2 element in pVAS114, forming the structure ISCR2-tet(D)-tetRISCR2, whereas only one copy of ISCR2 was found in pVPS43. Owing to the absence of complex class 1 integrons, another three plasmids were grouped together (Figure S1). Plasmids pAQU1 and
Evolution of MDR plasmids in Vibrio species
JAC
Figure 1. Circular maps depicting the plasticity of pAQU-type plasmids. The plasmid pVPS43 with the largest number of resistance genes (n " 10) was used as the reference to compare with eight other plasmids. The outer circle depicted by red arrows represents annotations of pVPS43. With two mosaic regions (MDR region and mosaic region 2) inserted, the plasmids can be divided into four parts, among which two core plasmid genome regions are responsible for plasmid conjugation and maintenance. In the MDR region, complex class 1 integrons with blaPER-1 exist in five plasmids. Linear alignment of the eight MDR pAQU-type plasmids is shown in Figure S1. This figure appears in colour in the online version of JAC and in black and white in the print version of JAC.
pAQU2, found in Japan, are known to contain different resistance genes, both of which do not have class 1 integrons and ISCR1blaPER-1.
Another mosaic region was present upstream of the type I restriction-modification system, and this region was found to exist in all pAQU plasmids (Figure 1). Three qnrVC6-positive
3 of 4
Li et al.
plasmids were identified out of the nine pAQU-type plasmids. Sequences harbouring qnrVC6 from the NCBI database were aligned (Figure S2). Apart from class 1 integron-mediated qnrVC6, qnrVC6 can also be mobilized and integrated into different loci of plasmids, together with its attC site.
Characterization of core genome and pan genome of plasmids After annotation with Prokka and analysis with Roary, there were 511 unique genes identifiable from 1916 predicted genes in the nine plasmids. One hundred and eleven genes were found to be shared by all the plasmids as core genes. Another 400 accessory genes were shared by fewer than nine plasmids. The core genes comprised plasmid maintenance genes, while the accessory genes were composed of resistance genes, ISs, toxin–antitoxin systems and hypothetical genes of unknown functions. Through alignment of the 111 core genes, a phylogenic tree was constructed (Figure S3a). The evolutionary tree indicated that two major clusters were generated, which matched the emergence of resistance genes among the plasmids. Plasmid pVPS91, without resistance genes and ISs, was distinguished from the other eight MDR plasmids. The clusters generated by distribution of resistance genes (Figure S4) and by homology of shared core genes (Figure S3) were not strictly matched. This implied that the evolution of the plasmids is the result of evolution of the core genes and accessory genes, respectively. Bacterial strains carrying these pAQU-type plasmids are mainly of aquatic bacteria. Upon increasing exposure to antimicrobials, this type of conjugative plasmid is expected to be transmissible between different bacteria, and possess the ability to acquire diverse resistance genes with the help of mobile elements. According to the analysis of MDR regions of different plasmids (Figure S1), IS26, ISCR1, ISCR2, IS10 and IS6100 were the most important mobile elements in shaping the plasticity of pAQU plasmids. Furthermore, this plasmid category could be conjugated from the donor aquatic strains to E. coli strains, which raised the concern that the resistance genes can be transmitted from the aquatic ecosystem to clinical pathogens via pAQU-type conjugative plasmids. In conclusion, we conducted a systematic study on the conjugative pAQU-type plasmids. These plasmids represent newly emerged MDR plasmids, which may be transmissible to human pathogens through the food chain. The different types of resistance genes distributed among pAQU plasmids prompted us to hypothesize that abuse or overuse of antimicrobials in aquaculture may continue to select for organisms harbouring pAQU plasmids, and introduction of new resistance genes into such plasmids with the help of mobile elements is a common event.
Supplementary data Table S1 and Figures S1 to S4 are available as Supplementary data at JAC Online.
References 1 Smalla K, Jechalke S, Top EM. Plasmid detection, characterization, and ecology. Microbiol Spectr 2015; 3: PLAS-0038-2014. 2 Smillie C, Garcillan-Barcia MP, Francia MV et al. Mobility of plasmids. Microbiol Mol Biol Rev 2010; 74: 434–52. 3 Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother 2009; 53: 2227–38. 4 Alvarado A, Garcillan-Barcia MP, de la Cruz F. A degenerate primer MOB typing (DPMT) method to classify gamma-proteobacterial plasmids in clinical and environmental settings. PLoS One 2012; 7: e40438. 5 Cabello FC, Godfrey HP, Buschmann AH et al. Aquaculture as yet another environmental gateway to the development and globalisation of antimicrobial resistance. Lancet Infect Dis 2016; 16: e127–33. 6 Poirel L, Cattoir V, Nordmann P. Plasmid-mediated quinolone resistance; interactions between human, animal, and environmental ecologies. Front Microbiol 2012; 3: 24. 7 Nonaka L, Maruyama F, Miyamoto M et al. Novel conjugative transferable multiple drug resistance plasmid pAQU1 from Photobacterium damselae subsp. damselae isolated from marine aquaculture environment. Microb Environ 2012; 27: 263–72. 8 Nonaka L, Maruyama F, Onishi Y et al. Various pAQU plasmids possibly contribute to disseminate tetracycline resistance gene tet(M) among marine bacterial community. Front Microbiol 2014; 5: 152. 9 Li R, Wong MH, Zhou Y et al. Complete nucleotide sequence of a conjugative plasmid carrying blaPER-1. Antimicrob Agents Chemother 2015; 59: 3582–4. 10 Marti E, Variatza E, Balcazar JL. The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends Microbiol 2014; 22: 36–41. 11 Ye L, Li R, Lin D et al. Characterization of an IncA/C multidrug resistance plasmid in Vibrio alginolyticus. Antimicrob Agents Chemother 2016; 60: 3232–5. 12 Li R, Lin D, Chen K et al. First detection of AmpC b-lactamase blaCMY-2 on a conjugative IncA/C plasmid in Vibrio parahaemolyticus of food origin. Antimicrob Agents Chemother 2015; 59: 4106–11. 13 Dallenne C, Da Costa A, Decre D et al. Development of a set of multiplex PCR assays for the detection of genes encoding important b-lactamases in Enterobacteriaceae. J Antimicrob Chemother 2010; 65: 490–5. 14 Li R, Xie M, Zhang J et al. Genetic characterization of mcr-1-bearing plasmids to depict molecular mechanisms underlying dissemination of the colistin resistance determinant. J Antimicrob Chemother 2017; 72: 393–401. 15 Overbeek R, Olson R, Pusch GD et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res 2014; 42: D206–14. 16 Alikhan NF, Petty NK, Ben Zakour NL et al. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 2011; 12: 402.
Funding This research was supported by the Chinese National Key Basic Research and Development (973) Program (2013CB127200) and the Hong Kong Research Grant Council Collaborative Research Fund (C7038–15G).
Transparency declarations None to declare.
4 of 4
17 Moura A, Soares M, Pereira C et al. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics 2009; 25: 1096–8. 18 Zankari E, Hasman H, Cosentino S et al. Identification of acquired antimicrobial resistance genes. J Antimicrob Chemother 2012; 67: 2640–4. 19 Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics 2014; 30: 2068–9. 20 Page AJ, Cummins CA, Hunt M et al. Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015; 31: 3691–3.
