ELSEVIER
Journal of Orthopaedic Research
Journal of Orthopaedic Research 22 (2004) 1188-1 192
www.elsevier.com/locate/orthres
Expression of bone morphogenetic proteins, receptors, and tissue inhibitors in human fetal, adult, and 0steoarthritic articular cartilage Andrew L. Chen, Carrie Fang, Chuanju Liu, Michael P. Leslie, Eric Chang, Paul E. Di Cesare * Department of Orthopaedic Surgery, Musculoskeletal Reseurch Center, N YU-Hospital for Joint Diseases Orthopaedic Institute, 301 East 17th Street. New York, N Y 1003, USA Received 15 October 2003; accepted 25 February 2004
Abstract
Coordinate expression of BMPs and their receptors and inhibitors is likely necessary for physiologic BMP regulation and activity. To characterize the expression of such factors in fetal, normal adult, and end-stage osteoarthritic articular cartilage, samples from these sources were analyzed. PCR-amplified sequences (BMPs 1-1 l), receptors (IA, IB, II), TGF-PI, TGF-Pz, inhibitors noggin and follistatin, CDMP-1, COMP, and GAPDH from cDNAs generated from extracted total RNA were resolved by gel electrophoresis. Protein levels of BMPs 3,7, and 8 were also analyzed by SDS-PAGE and Western blotting. RT-PCR revealed that BMPs 1, 2, 4 6 . and 11, BMPR-IA and 11, noggin, follistatin, CDMP-1, COMP, and GAPDH mRNAs were expressed in similar fashion in both fetal and adult (normal or osteoarthritic) cartilage. BMPs 9 and 10 mRNAs were not expressed in either group. BMPs 7, 8, and BMPR-IB mRNAs were consistently expressed in fetal but not in adult cartilage. BMP-3 mRNA was expressed in fetal and normal adult, but not in osteoarthritic samples. TGF-P1 was expressed in both adult normal and osteoarthritic, but not fetal, samples. Similarly, Western blotting demonstrated BMPs 7 and 8 to be present in fetal but not in adult samples. BMP3 protein was present in fetal and adult normal samples, to a lesser extent, but absent in osteoarthritic cartilage. 0 2004 Orthopaedic Research Society. Published by Elsevier Ltd. All rights reserved. Keywords: Bone morphogenetic proteins; Fetal; Adult; Osteoarthritis; Cartilage
Introduction
In 1965, Urist demonstrated that demineralized bone extract can induce bone formation at ectopic sites [17]. Subsequently the factors responsible for the osteoinductive activity of bone organic matrix were identified, including the growing family of growth factors known as bone morphogenetic proteins (BMPs), which are known to have crucial roles in cellular growth, differentiation, and expression of phenotype of various cell types, including osteoblasts and chondrocytes [ 141. With the exception of BMP-I, a tolloid-like procollagen C-proteinase, the BMPs are members of the transforming growth factor (TGF) superfamily. Post* Corresponding author. Tel.: +I-212-598-6567; fax: +I-212-5986096. E-mail address:
[email protected] (P.E. Di Cesare).
translational processing, including cleavage of a mature domain, cysteine-disulfide bridge formation, dimerization, variable intracellular glycosylation, and protein assembly may influence the activity and biological effects of BMPs [18]. BMPs initiate cellular signals by high-affinity binding to a heterotetrameric transmembrane complex formed by types IA (BMPR-IA), IB (BMPR-IB), and 11 (BMPR-11) serine-threonine kinase receptor proteins. Specificity of binding is conferred by the type I receptor, while evidence suggests that type I1 receptor is constitutively active (autophosphorylating) but that it cannot independently initiate cellular signals [4,19]. Specific binding of BMP to the receptor complex results in transphosphorylation of the type I receptor in the glycinelserine-rich region, with kinase-activation of Smad proteins and downstream effects in the nucleus at the level of gene transcription [12].
0736-02666 - see front matter 0 2004 Orthopaedic Research Society. Published by Elsevier Ltd. All rights reserved. doi: 10.10l6/j.orthres.2004.02.013
A.L. Chen et al. I Journal of Orthopaedic Research 22 (2004) 1188-1192
Further regulation of BMP occurs at the extracellular level. Studies in mouse and Xenopus embryos identified extracellular inhibitors of BMP-including noggin, follistatin, chordin, fetuin, gremlin, cerebrus, and danthat regulate effects of BMP by direct binding to the growth factors or their receptors and thus are mediators of cartilage and skeletal morphogenesis [15]. Autoregulation of BMP expression has also been demonstrated, with BMP-2 upregulation of its own expression, as well as those of BMP-4 and BMP-6 [5]. BMP studies employing animal models as well as human clinical trials have focused primarily on fracture healing, osseous fusion, and healing of critical-size defects [9-ll]. Recent interest has focused on the expression of BMPs and their receptors in articular cartilage. The present study sought to characterize the expression of BMPs, BMP receptors, and BMP inhibitors in human fetal and adult articular cartilage.
Table 1 Oligonucleotide primers used for RT-PCR (primer sequences correspond to human cDNAs) Target template
PCR primers
Product size (bP)
BMP-1
5' -AGGTACAGCAGGCTGTGGAT 5'- AACTTCCTGAAGATGGAGCC 5' -TTGCGGCTGCTC AGCATGTT 5'-TTCCGAGAACAGATGCAAGATG 5'-AGGTCTCTGAACACATGCTG 5'-ATCAAGCTTACAGGGAC ACC 5'-AGCCATGCTAGTTTGATACC 5'-TCAGGGATGCTGCTGAGGTT 5'-AGACAATCATGTTCACTCCAGTT 5'- AGCTGTAAGCCC AAATTATTCTGG 5'-ACATGGTC ATGAGCTTTGTGA 5'-GTAGAGCGATTACGACTCTGT 5'-C AGCCTGC AAG AT AGCC ATT 5'- AATCGG ATCTCTTCCTGCTC 5'-CGTGCAGCGCGAGATCCTGG 5'-GCCTCTATGTGGAGACTG AG 5'-GAAGATGTTTCTGGAGAACG 5'-GCTTCTTCCCCTTGGCTGAC 5'-CAGCTTACTTGGTTTCTGGC 5'-CGGCTAGAAATAGATACCAG 5'-TGCAGCAGATCCTGGACC 5'-GGAGCTTCGAGTCCTAGAG A 5' -TGTTCAAGGACAGA ATCTGG 5'-TTGATGGCAGCATTCGATGG 5'-AAGAAAGAGGATGGTGAGAG 5'-CCTGGACCC AGTTGTACCTA 5'-AGATCCGTATCAGCAAGACC 5'-GGCTGACTGGAAATAGACTG 5'-GCACCCAGCGACAACCTGCCC 5'-GCTGCCCACCTTCACGTAGCG 5' -GAACTGAGCAAGGAGGAGTG 5'-CACTTTCCCTCATAGGCTAATCC 5'-GCCCTGGACACCAACTATTGC 5'-TCAGCTGCACTTGCAGGAGC 5'-CAGCTTGTGCTCCAGACAGT 5'- ATATGTGGAGGTGCC ATCAAT 5'-ACCACAGTCC ATGCCATCAC 5'-TCCACCACCCTGTTGCTGTA 5'- ACAGAAAGGGAGGCA ACAGC 5'- ATG ACTGCATG ATTCGTGGGC 5'-TTTTGAATTCGCGACACTGAC 5'-GTCCCGAGAGTCCGT ATGTC
563
BMP-2 BMP-3 BMP-4 BMP-5 BMP-6 BMP-7 BMP-8 BMP-9
Methods
BMP-I0
Samples
BMP-11 Fetal articular cartilage was obtained from the distal femora of four electively aborted fetuses (average gestational age 21.2 weeks, range 19-23 weeks) without history of developmental abnormalities. Approval for fetal tissue research and use of aborted fetuses for this investigation was obtained prior to initiation of the study. Osteoarthritic articular cartilage was obtained from the distal femora of eight patients (average age 68.4 years, range 59-76 years) undergoing elective total knee arthroplasty for end-stage osteoarthritis. Normal adult articular cartilage was obtained from the femoral heads of three patients (average age 66.7 years, range 63-74 years) undergoing hip hemiarthroplasty for proximal femoral fractures. Care was taken to ensure that these cases were without radiographic or intraoperative evidence of osteoarthritis. Articular cartilage was frozen immediately after isolation and ground under liquid nitrogen using the Tri-Spin method described previously [7]. Isolation of RNA and synthesis of cDNA
Total RNA was extracted by acid-guanidium thiocyanate-phenolchloroform single-step method followed by RNAeasy kit (Qiagen). Five micrograms of total RNA per sample was reverse-transcribed in a 20 p1 sample volume consisting of 500 ng oligonucleotide ( ~ l i g o ) ( d T ) ~500 ~ - ~pm ~ , dNTPs, 25 mM Tris-HCI (pH 8.3), 37.5 mM KCI, 1.5 mM MgC12, 10 mM DTT, and 200 U SUPERSCRIPT I1 (Life Technologies, Grand Island, NY) for 50 min at 42 "C. The reactions were terminated at 70 "C for 15 min, and the RNA template was degraded using Dnase-free RNase H. Then 5 pl of a 1:10 dilution of the oligo(dT)12,*-primed cDNA was used as the template for PCR amplification of the desired genes. PCR amplijication and electrophoresis
The primers used were as outlined in Table 1. GAPDH was amplified as a control for the reverse-transcriptase reaction. Cartilage oligomeric matrix protein (COMP) and chondrocyte-derived morphogenetic protein-1 (CDMP-I) primers were used as positive controls for chondrocytes. For each set of primers, PCR amplification was performed using 5 p1 of the RT product in a final reaction volume of 50 pl containing 20 mM Tris-HC1 (pH 8.4), 50 mM KCI, 1.5 mM MgC12, 200 mM each dNTPs, 200 nM each primer, and 1.25 U Taq polymerase (Life Technologies, Grand Island, NY). After initial denaturation at 94 "C for 4 min, 38 cycles of PCR were performed in a thermal cycler (Perkin Elmer GeneAmp 2400, Perkin Elmer, Foster City, CA).
1189
BMP R -IA BMPR-IB BMPR-I1 Noggin Follistatin TGF-P, TGF-Bz GAPDH CDMP-I COMP
315 604 382 722 528 276 539 914 649 545 399 79 1 983 425 571 339 474 452 795 805
Each cycle included denaturation at 94 "C for 1 min, annealing at either 59 "C (BMPs 1, 2, 4, 6, 7, 9-1 1; BMPRs IA, IB, 11; TGF-Dl and 02; and GAPDH) or 63 "C (BMPs 3, 5, 8; noggin) for 30 s, and extension at 72 "C for 90 s, with a final extension of 7 min at 72 "C. Five microliters of PCR-amplified sequences were then electrophoresed and analyzed on 1.O% agarose-ethidium bromide gels. Preparation of cartilage extracts and Western blotting
The cartilage extracts (1-2 g wet weight) were frozen (-80 "C) and then ground in liquid nitrogen using a freezer mill (Spex Industries, Edison, NJ) to obtain a fine particulate. The cartilage was then extracted with 4 M guanidinelHCl in 50 mM Tris-HC1, pH 7.4 containing 1 mM phenylmethanesulfonyl fluoride (PMSF), 2 mM N-ethylmaleimide (NEM), and 0.025 mg/ml leupeptin. For extraction, the tissue was briefly homogenized on ice with Polytron homogenizer
1190
A. L. C ~ KeiHu1. I Journal of' Orthopaedic Research 22 (2004) 1188-1 I92
(Kriens, Littau, Switzerland) at full speed and shaken at 4 "C for I h. After centrifugation for 30 min at 8000 rpm at 4 "C, the supernatant was dialyzed and desalted using Tube-0-Dialyzer (Upstate, Lake Placid, NY). Cartilage extracts were mixed with an equal volume of 2X SDS-PAGE loading buffer and subjected to 4-1 5% gradient gel. The proteins were electrotransferred to nitrocellulose at 40 mA for 12 h. After blocking with 5%) non-fat milk, the membranes were incubated with antibodies against either BMP-3 (1500, Santa Cruz Biotechnology, Santa Cruz, CA), BMP-7 (1500, Genex Bioscience, Hayward, CA), or BMP-8 (1:500, Santa Cruz Biotechnology), followed by incubation with corresponding horse radish peroxidase (HRP)-conjugated secondary antibodies (0.2 pglml) for 1 h. The signal was detected using the ECL chemiluminescent system (Amersham Pharmacia Biotech, Piscataway, NJ).
Results
A systematic RT-PCR was performed to investigate the overall expression of BMPs, BMP receptors, and BMP antagonists. Fig. 1 shows randomly selected rep-
Fig. 1. Expression analysis of BMPs, receptors, and tissue inhibitors by reverse transcription-PCR. Amplification products for BMPs, receptors, and inhibitors from one sample selected randomly in each group (fetal, normal, and OA cartilage) were resolved by 1.0% agaroseethidium bromide gel electrophoresis. Routine positive control GAPDH and chondrocyte-specific positive control COMP and CDMP are indicated. Similar expression patterns were repeated with all samples from each group.
resentative samples (expression patterns were consistent with all of samples from each group three samples for normal, eight samples for OA and four samples for the fetal group). BMPs 1, 2, 4-6, and 11, BMPR-IA and 11, noggin, follistatin, COMP, CDMP-1, and GAPDH mRNA were consistently (100%) present in fetal, adult normal, and adult osteoarthritic cartilage samples. Conversely, BMP-9 and BMP-10 mRNA were not present (Oo/n) in either fetal or adult cartilage samples, although control samples were positive, ensuring integrity of the experimental system. BMPs 7 and 8, and BMPR-IB mRNA were present in fetal articular cartilage (100"/0), but not in adult samples. TGF-P, mRNA was consistently present (100%) in both adult normal and osteoarthritic cartilage, but not in fetal samples. BMP-3 mRNA was present in fetal and normal adult articular cartilage (~OOYO),but not in osteoarthritic samples. BMP-3, 7, and 8 mRNAs showed a high level of expression in human fetal articular cartilage, but a markedly reduced or non-detectable expression in adult tissues (see Fig. 1). Western blotting was performed to examine their protein level in fetal and adult cartilage. As shown in Fig. 2, BMP-3 was present in fetal cartilage and detectable in normal adult tissues at a lower level, but absent in the osteoarthritic samples. In accordance with the mRNA expression pattern, both BMP-7 and BMP-8 protein were positive in fetal articular cartilage, but undetectable in adult normal and osteoarthritic samples.
1
2
3
Fig. 2. Western blotting assay for examining the expression of BMPs 3, 7, and 8. Protein samples extracted from one representative sample of those tested (fetal, normal, and osteoarthritic articular cartilage) were subjected to 4 1 5% SDS-PAGE and Western-blotted with specific antibodies against BMPs 3, 7, or 8. Arrows indicate the positions of BMPs 3, 7, and 8.
A. L. Chen et al. I Journal of Orthopaedic Research 22 (2004) 1188-1 I92
Discussion
Although the exact role of BMPs in growth plate morphogenesis has not been established, BMP-7 has been shown to be present in the hypertrophic chondrocytes of the physis in developing long bones [8]. Zou et al. demonstrated that BMPR-IB expression is necessary for the initial steps of chondrogenesis; its presence in the embryonic limb prefigures the future cartilage primordium [2!]. Mutations of BMP-3 have been associated with fibrodysplasia ossificans progressive [ 151. BMP-8 has been previously reported to maintain spermatogenesis and epididymal function [20], and it is also highly expressed in osteosarcomas [16]. Its presence in fetal articular cartilage suggests a developmental function. Our findings confirm the presence of these factors during chondrogenesis. T G F - ~and I p2 are known to be produced by chondrocytes of articular cartilage, serving as protective cytokines that inhibit the degradatory effects of IL-I and enhance synthesis of matrix components, such as proteoglycan [13]. These findings are in keeping with observation that levels of TGF-PI and pz in osteoarthritic cartilage samples are higher than those in fetal articular cartilage. Surprisingly, mRNA of direct inhibitors of BMPs were present in both fetal and adult osteoarthritic articular cartilage. In addition to the consistent presence of BMPs 1,2,4-6, and 11 and BMPR-IA and I1 mRNA in both groups, these results suggest that a major contributor to BMP regulation may occur at the extracellular level, with direct inhibition through specific binding of the receptor, of the BMP-receptor complex, or of the growth factor itself. It is not unreasonable to speculate, based on the presence of BMPs in fresh fracture sites and repair blastema, that inactive, inhibitor-bound BMPs serve as a reservoir from which BMPs may be readily released in direct response to injury, such as a fracture [ 1.51. Alternatively, the constitutive expression of these factors (BMPs 1, 2, 4-6, and 11 and BMPR-IA and 11) may be necessary for phenotypic maintenance of osteoblasts and chondrocytes, with modulation of active BMPs mediated through inhibitor binding. Interestingly, BMP-3 mRNA was present in fetal and normal adult articular cartilage, but not osteoarthritic samples. Aspenberg et al. recently demonstrated reduced expression of BMP-3 in cartilage with mechanical loading in vitro, suggesting that mechanically induced downregulation of inhibiting effects of BMP-3 may allow induction of cartilage formation [ 11. BMP-3, the most abundant BMP in demineralized bone matrix, may play a critical role as a modulator of osteogenic BMP activity. Daluiski and coworkers reported that BMP-3 not only lacks osteogenic potential, but it is also an antagonist of osteogenic BMPs capable of inhibiting BMP-2-mediated differentiation of osteoprogenitor cells
1 I91
into osteoblasts and has been observed to be associated with diminished bone mineral density [6]. Bahamonde and Lyons suggested that BMP-3 inhibition of BMP-2 activity resulted from competition for signaling components common to TGF-p/activin and BMP pathways, thus antagonizing the ability of BMP-2 to induce osteogenic commitment and differentiation in vitro [2]. They attributed this to competition between the activin and BMP signal transduction cascades for a finite pool of Smad-4 and activin type I1 receptors, resulting in limited signaling output [2,3]. This laboratory study demonstrated differential expression of BMPs, receptors, and TGF-p in fetal articular cartilage and in adult osteoarthritic cartilage. Previous studies have suggested that the bone morphogenetic proteins play a variety of roles, from skeletal morphogenesis and chondrogenesis to potential chemoprotective mediators that regulate matrix metabolism. The current investigation suggests that differential expression between fetal and adult articular cartilage may reflect age-dependent metabolic and morphogenic requirements; moreover, the roles of BMPs within fetal articular cartilage and adult cartilage may vary. Future studies, with immunohistochemical localization of factors, are necessary to elucidate the roles of BMPs. Acknowledgements
This study was made possible in by a grant from the National Institutes of Health (NIH R 0 1 AR4561201A2). References Aspenberg P, Basic N, Tagil M, Vukicevic S. Reduced expression of BMP-3 due to mechanical loading: a link between mechanical stimuli and tissue differentiation. Acta Orthop Scand 2000;71(6): 558-62. Bahamonde ME, Lyons KM. BMP-3: to be or not to be a BMP. J Bone Joint Surg [Am] 2001;83(Suppl I , part 1):56-62. Candia AF, Watabe T, Hawley SH, Onichtchouk D, Zhang Y, Derynck R, et al. Cellular interpretation of multiple TGFP signals: intracellular antagonism between activin/BVgl and BMP-2/4 signaling mediated by Smads. Development 1997;124: 4467-80. Carcamo J, Weis FM, Ventura E, Wieser R, Wrana J, Attisano L, et al. Type I receptors specify growth inhibitory and transcriptional responses to transforming growth factor P and activin. Mol Cell Biol 1994;143810-21. Croteau S, Rauch F, Silvestri A, Hamdy RC. Bone morphogenetic proteins in orthopedics: from basic science to clinical practice. Orthopedics 1999;22(7):68&95. Daluiski A, Engstrand T, Bahamonde ME, Gamer LW, Agius E, Stevenson SL, et al. Bone morphogenetic protein-3 is a negative regulator of bone density. Nat Genet 2001;27(1):84-8. DiCesare PE, Morgelin M, Carlson CS, Subhalakshmi P, Paulsson M. Cartilage oligomeric matrix protein: isolation and characterization from human articular cartilage. J Orthop Res 1995; 13(3):422-8.
1192
A.L. Chen et al. I Journal
of
Orthopaedic Research 22 (2004) 1188-1192
[8] Helder MN, Ozkaynak E, Sampath KT, Luyten FP, Latin V, Oppermann H, et al. Expression of osteogenic protein-I (bone morphogenetic protein 7) in human and mouse development. J Histochen Cytochem 1995;43:1035-44. [9] Johnson EE, Urist MR. One stage lengthening of femoral nonunion augmented with human bone morphogenetic protein. Clin Orthop 1998;347:105-16. [lo] Johnson EE, Urist MR, Finerham GAM. Repair of segmental defects of the tibia with cancellous bone grafts augmented with human bone morphogenetic protein. Clin Orthop 1988;236:249-57. [I I] Love11 TP, Dawson EG, Nilsson OS, Urist MR. Augmentation of spinal fusion with bone morphogenetic protein in dogs. Clin Orthop 1989;243:26674. [12] Massague J. TGF p signaling: receptors, transducers, and Mad proteins. Cell 1996;85:947-50. [13] Poole AR. Imbalances of anabolism and catabolism of cartilage matrix components in osteoarthritis. In: Kuettner KE, Goldberg VM, editors. Osteoarthritic disorders. American Academy of Orthopedic Surgeons; 1994. p. 247-60. [14] Reddi AH. Regulation of cartilage and bone differentiation by bone morphogenetic proteins. Curr Opin Cell Biol 1992;4:850-5.
[15] Schmitt JM, Hwang K, Winn SR, Hollinger JO. Bone morphogenetic proteins: an update on basic biology and clinical relevance. J Orthop Res 1999;17:269-78. [I61 Sulzbacher I, Birner P, Trieb K, Pichlbauer E, Lang S. The expression of bone morphogenetic proteins in osteosarcoma and its relevance as a prognostic parameter. J Clin Path01 2002;55(5): 381-5. [17] Urist MR. Bone formation by autoinduction. Science 1965;150: 893-9. [I81 Wozney JM. Bone morphogenetic proteins and their expression. In: Noda M, editor. Cellular and molecular biology of bone. Academic Press; 1993. p. 131-65. [I91 Wrana J, Attisano L, Wiesner R, Ventura E, Massague J. Mechanism of activation of the TGF p receptor. Nature 1994; 370:341-7. [20] Zhao GQ, Chen YX, Liu XM, Xu Z , Qi X. Mutation in Bmp7 exacerbates the phenotype of Bmp8a mutants in spermatogenesis and epididymis. Dev Biol 2001;240(1):212-22. [21] Zou H, Wieser R, Maasgue J, Niswander L. Distinct roles of type 1 bone morphogenetic protein receptors in the formation and differentiation of cartilage. Genes Dev 1997;11(17):2191-203.
