Oct 30, 1992 - containing the binding site of Zif268 (Christy and Nathans,. 1989 ..... Gualberto,A., Patrick,R.M. and Walsh,K. (1992) Genes Dev., 6,815-824;.
The EMBO Journal vol.12 no.2 pp.443-449, 1993
Muscle-specific expression of the acetylcholine receptor a-subunit gene requires both positive and negative interactions between myogenic factors, Spi and GBF factors Jean-Louis Bessereau, Daniel Mendeizon, Chantal LePoupon, Marc Fiszman1, Jean-Pierre Changeux2 and Jacques Piette3 Neurobiologie Moleculaire and 1Biochimie, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France 2Corresponding author 3Present address: Departnent of Molecular Biology, Princeton University, Princeton NJ 08544-1014, USA Communicated by J.-P.Changeux
The dependence of the muscle-specific enhancer of the acetylcholine receptor a-subunit gene on other domains of the promoter has been analysed by performing point mutagenesis and modular reconstitution of the enhancer-promoter sequences. The enhancer is inactive in the absence of the proximal region containing an Spl binding site and an overlapping G-C homopolymer binding factor site (referred to as GBF). The proximal region can be replaced by an Spl binding site from SV40 or an MEF-2 binding site from the muscle creatine kinase gene. Specific mutation of the Spl site markedly affects transactivation by CMD1 or myogenin. Mutation of the GBF binding site leads to higher promoter activity in primary cultures of chick myotubes or in quail fibroblasts. In addition, binding of a purified Spl protein prevents the binding of GBF in vitro. It is proposed that in the case of the a-subunit promoter, the myogenic factors activate transcription in cooperation with Spl, and that GBF contributes to muscle-specific expression of the promoter by interfering with Spl binding in nonmuscle cells or myoblasts. Key words: acetylcholine receptor/muscle/MyoD/Spl/ transcription
Introduction Differentiation of a muscle cell is a complex process that requires the sequential activation and repression of numerous genes. Myogenic factors of the MyoD family play a central role in this process. These factors were initially discovered on the basis of their potential to transform non-muscle cells into myoblasts (Davis et al., 1987; Olson, 1990; Weintraub et al., 1991). Four different myogenic genes have been described: MyoD (Davis et al., 1987), myogenin (Wright et al., 1989), Myf-5 (Braun et al., 1989) and MRF-4 (Rhodes and Konieczny, 1989). Their products belong to the same family of proteins characterized by a conserved basic helix-loop-helix domain (B-HLH), required for binding to related CANNTG sequences, through which the myogenic factors transactivate several genes expressed in skeletal muscle (Lassar et al., 1989; Murre et al., 1989; Sartorelli et al., 1990; Piette et al., 1990; Yutzey et al., 1990; Wentworth et al., 1991). © Oxford University Press
The four genes are expressed at different times during development (Sassoon et al., 1989; Bober et al., 1991; Hinterberger et al., 1991; Ott et al., 1991) and their expression pattern most often does not coincide with that of structural genes in skeletal muscle (Lyons et al., 1990, 1991). Cooperation of myogenic genes with ubiquitous factors or other factors appearing during muscle differentiation has been proposed to account for these discrepancies (Sartorelli et al., 1990; Chakraborty and Olson, 1991; Duclert et al., 1991; Lin et al., 1991; Lyons et al., 1991). Plausible candidates for the ubiquitous factors are Spl (Sartorelli et al., 1990; Lin et al., 1991) and SRF (Sartorelli et al., 1990) and, for the tissue-specific factors, MEF-2 (Cserjesi and Olson, 1991). The at-subunit promoter (Klarsfeld et al., 1987) of the acetylcholine receptor (AChR) is particularly suitable for the analysis of factors susceptible to cooperate with myogenic factors. Indeed, 110 bp upstream of the transcription startpoint are sufficient to confer muscle-specific expression to a reporter gene (Piette et al., 1989). A 36 bp musclespecific enhancer has been identified in this fragment (Wang et al., 1988); it contains two MyoD binding sites that are important for muscle-specific expression (Piette et al., 1990). Interestingly, in contrast to muscle-creatine kinase (M-CK) transcripts, those for the a-subunit of the AChR are detected shortly after the detection of CMD1 (the MyoD homologue) transcripts in chicken (Lyons et al., 1991; Piette et al., 1992). The expression of the AChR a-subunit gene and of some myogenic genes is also enhanced after muscle denervation or decreased by electrical activity (Asher et al., 1991; Duclert et al., 1991; Eftimie et al., 1991; Witzemann and Sakmann, 1991; Piette et al., 1992), adding further evidence in favour of a dependence of AChR gene expression upon that of myogenic genes. An Spl factor binding site and an overlapping G-C homopolymer binding factor (GBF) site in the proximal region (ARM) of the promoter (Piette et al., 1989) has been identified. It is shown here that the enhancer sequence is not functional in primary chicken myotubes in the absence of the proximal region containing overlapping Spi and GBF sites. Evidence is presented that suggests that this is due to a requirement for direct or indirect interactions between Spl and myogenic factors. The SpI binding site can be effectively replaced by a MEF-2 binding site. It is further demonstrated that GBF functions as a negative regulator of promoter activity and that GBF and purified Spl compete for AR III binding in vitro.
Results The enhancer is not active in the absence of the proximal element containing the Sp 1 and GBF sites To investigate the potential role of factors binding outside the enhancer of the a-subunit promoter, we tried to 443
J.-L.Bessereau et al.
reconstitute a functional promoter by the combination of different elements. These elements were (i) the 33 bp enhancer (E) as characterized by functional tests (Wang et al., 1988; Piette et al., 1989), (ii) a 17 bp distal region (D) containing a CAAT-like sequence (Breathnach and Chambon, 1981) and an AP2-like sequence (Imagawa et al., 1987) (this region corresponded to footprint region ARIlc, Piette et al., 1989), (iii) a 15 bp proximal region (P) containing an Spl site and part of the GBF site (this region corresponds to part of footprint region ARIII, Piette et al., 1989) and (iv) a 50 bp initiation region (I) containing the TATA-box (Breathnach and Chambon, 1981) and the transcription start point (Klarsfeld et al., 1987) (see Figure 1 and Materials and methods for details of the constructions). These elements were assembled in various combinations, inserted in front of the luciferase gene and tested by transient expression assays in primary chick myotubes (de Wet et al., 1987; Piette et al., 1989). Addition of the enhancer E to the initiator I did not result in any enhancement of the basal activity obtained with region I alone, even when the spacing between both regions was increased by insertion of linker DNA (Figure 2; results not MUT-PH A
-!10
MUT-B T A
MUT-CAAT MUT-D
AT
CrCATGCCTGGA4ICAGGGTGTAAG
CCT
MyoD -60
MyoD
g
MUT-SP
MUT-G
AT
AT
CGTGCTCCcc ccccc p
Spi
AT CCCTGGGCAGC
shown). From this it is concluded that it is necessary for the enhancer to cooperate with other regions of the promoter to be active in our assay. To identify these sequences, the distal region D and the proximal region P were added, respectively. Only a marginal enhancement was obtained with the E-D-I construct. In contrast, addition of the enhancer fragment E to the PI construct causes a > 10-fold increase of the promoter activity (Figure 2). Additional enhancement was observed when the correct spacing between E and P was restored (E. 17.PI) and interestingly, further increases in the distance between the enhancer and the proximal region led to a decline in promoter activity (E.29.PI and E.41.PI, Figure 2). An optimal spacing between enhancer and proximal region may thus be required. The magnitude of the enhancement obtained with the E -I and E - PI constructs varied to a limited extent and in some cases reached values as high as 20- to 30-fold increase of the E -I basal activity. Such variations most probably reflect the variable differentiation rate of muscle primary culture cells from one set of experiments to the other. Yet, in all these instances, the activity ratio between constructs was systematically preserved. These data suggest that factors binding to the enhancer most likely cooperate with factors binding to the proximal region to activate transcription. The distal region, however, is necessary to obtain wild type promoter activity levels.
-10
GGCCGACC1TTAAGGCGCTGCGTGTGCCCTGGCTCCTCCGTGCT
GBF
Fig. 1. Nucleotide sequence of the a-subunit promoter of the AChR. Start point of transcription and numbering are as described by Klarsfeld et al. (1987). Homologies with MyoD binding consensus sites (Davis et al., 1987), CAAT-box (Breathnach and Chambon, 1981), Spl binding site (Dynan and Tjian, 1983) and TATA-box (Breathnach and Chambon, 1981) are boxed, as is the binding sequence of GBF, as characterized by Piette et al. (1989). Point mutations are indicated as are the elements that were used for the promoter reconstitution experiments (see Materials and methods for details).
The distance between the two E-boxes is not critical for a-subunit promoter activity It was then proposed to check the effect of the spacing of the two E-boxes (MyoD binding sites) on promoter activity. Indeed, although the distance between adjacent sites may vary between promoters, the two sites in the a-subunit promoter are located in such a way that both molecules are positioned on the same side of the DNA helix (Piette et al., 1990). In addition, Weintraub et al. (1989) showed that two sites are necessary for promoter activity in the context of the thymidine kinase promoter. Cooperative interactions were also found for MyoD binding to adjacent sites (Weintraub et al., 1989). Precise spacing between two E-
"
-i
-Z'I N
1"
It\
Il
. ,-
.
*_
IL
x\
:, :\
Fig. 2. Transient expression experiments with promoter constructs in primary cultures of chicken myotubes. Transfections were done as described by Piette et al. (1989). 2 /4g of the indicated constructs were transfected 3 h after plating and extracts were prepared 3 days later. W.T. reflects the activity obtained with the KS-l 1O-ALA construct (see Materials and methods). Each point was done in quadruplicate in the same experiment, bars represent standard deviations.
444
---I
-
A\
Fig. 3. Transient expression experiments with point mutants in primary cultures of chick myotubes. Transfections were done as described by Piette et al. (1989). 2 /tg of the indicated constructs were transfected 3 h after plating and extracts were prepared 3 days later. Each construct was tested several times in different experiments, bars represent standard deviations.
Muscle-specific expression of the acetylcholine receptor
boxes could thus be an important determinant of promoter activity. Therefore a Nsil site was introduced between the E-boxes by mutating a single base pair (MUT-Ph) (Figure 1). This mutation had no significant effect on promoter activity in primary chick myotubes as measured by transient expression assays (Figure 3). Subsequently, an 11 bp oligonucleotide was inserted into the NsiI site, which should result in the displacement of the two E-boxes to opposing sides of the DNA helix. In fact, an increase in promoter activity was found using this construct (MUT-Ph 15) (Figure 3). Addition of up to 41 bp had no negative effect on promoter activity (results not shown). It is concluded that the spacing between the two MyoD sites is not optimal in the wild type promoter and that an integral number of DNA helical turns between both sites is not required. Disruption of the Sp 1 binding site has a negative effect while disruption of the GBF binding site has a positive effect on promoter activity Next, point mutations were introduced to evaluate the importance of different sites in the context of the minimal
12
110 bp promoter (Figure 1). Mutation of the MyoD sites ARHp and ARIUb' have already been described in the context of the 850 bp construct (Piette et al., 1990). MUT-B was reintroduced in the context of the 110 bp promoter in order to verify the effect of mutations of the MyoD sites in this shorter promoter construct. Similar effects were obtained as with the 850 bp construct, i.e. 30% of wild type activity (Piette et al., 1990; Figure 3). Next, mutations were introduced in respectively the CAAT-box (MUT-CAAT), the AP2-like sequence (MUT-D), the Spl site (MUT-Sp), and the GBF site (MUT-G) (Figure 1). The effectiveness of the two latter mutations on factor binding was verified in gel-shift experiments (Figure 4). Fragment ARIJI containing MUT-Sp was unable to compete for the band specifically removed by an oligonucleotide containing the Spl site of SV40 (lanes 6 and 7, and 4 and 5 respectively), while fragment ARHII containing MUT-G was unable to compete for the band corresponding to GBF (lanes 8 and 9). Note that both mutants still compete for the cluster of bands refered to previously as ARIIb (Piette et al., 1989). The competition with fragment B from the troponinI promoter, which shows a striking sequence homology with -
3) 4 5 6 7 8 9 I() 11 12 13 .~~~~~~~~~
Spi _
. :
b
GBF_m
Free _
conmp
probe
AR III
Spi Mut-S Mut-G AR III
r
I
1
I
Zif
Fig. 4. Gel-shift experiments. 1 ng of radioactively labelled ARIH probe was used in each lane. 10 and 20 ng respectively of competitor doublestranded oligonucleotide were used. lanes 2 and 3, ARIII-W.T.; lanes 4 and 5, Spl site of SV40; lanes 6 and 7, ARIH-MUT-Sp; lanes 8 and 9, ARIII-MUT-G; lanes 10 and 11, region B of the troponin I promoter (Lin et al., 1991); lanes 13 and 14, Zif268 binding site of the zif268 gene promoter (Christy and Nathans, 1989). 5 tig protein of a nuclear extract from primary chick myotubes (day 7) were used in each lane. The gel contained 8% polyacrylamide. 445
J.-L.Bessereau et al.
the proximal region of the AChR a-subunit promoter (Lin et al., 1991), was also tested. The whole series of bands is competed, showing that both elements are homologous (lanes 10 and 11). In contrast, a GC-rich DNA fragment containing the binding site of Zif268 (Christy and Nathans, 1989; sequence in Materials and methods) did not compete for any band. It is concluded that MUT-Sp specifically knocks out binding of Spl, while MUT-G specifically eliminates binding of GBF. Both factors bind to the troponin I promoter. The effect of the mutations was next tested in transient expression experiments in chick primary myotubes (Figure 3A). Weak effects were noticed for MUT-CAAT and MUT-D, while a stronger negative effect was noticed for MUT-Sp and a positive effect for MUT-G. This points to an important role for the Spi site. Moreover, it suggests a repressor role for GBF, in keeping with the fact that the two proteins are binding to overlapping sites and may thus compete with each other for binding to the promoter (Piette etal., 1989). GBF and Sp 1 competitively bind the AR 111 region in vitro In an attempt to test for competitive binding of Spi and GBF, an electrophoresis mobility shift assay was carried out using purified Spl protein, muscle nuclear extracts and the AR HI DNA fragment (Figure 5). The Spl factor used was originally purified from HeLa cells infected by a vaccinia
S \I
S Ip;i
S
virus-based expression vector (gift from S.P.Jackson and J.Ham). Experiments were performed with a quantity of labelled probe that had been previously determined as limiting (data not shown). Interaction of Spl with the AR III fragment generates a complex whose electrophoretic properties are identical to that of the complex referred to as 'Spl' obtained with muscle nuclear extracts (compare lanes 1 and 10, Figure 5). An AR III fragment containing the MUT-Sp mutation poorly competes for Spl binding (lanes 13 and 14), while MUT-G oligonucleotide efficiently removes the SpI band (lanes 11 and 12). Using the same incubation conditions, similar results were obtained with the muscle nuclear extracts (lanes 1-5). This confirms that SpI binds to the AR 111 region and that the Sp and G mutants are respectively specific for the Spi and GBF binding sites. In order to determine whether there is an interaction between GBF and Spi, muscle nuclear extracts and purified Spl protein were incubated together with limiting amounts of labelled AR III fragment. In one experiment, nuclear extracts were added to the incubation first and SpI was added 10 min later and incubated for an additional 10 min with the probe (lanes 6 and 7); no change of the GBF band intensity was observed. In contrast, preincubation of Spl led to a significant decrease in the amounts of GBF complex (lanes 8 and 9), without formation of any new band that would have reflected the fixation of both factors on the probe. Since nuclear extracts contain both Spi and GBF, it was not possible to prevent Spl binding by saturating amounts of GBF. Taken together, these results strongly support the hypothesis of mutually exclusive binding of Spl and GBF on the AR mI region, most probably as a result of an overlap between their binding sites. An Sp 1 site is essential for cooperation with the enhancer
.
To determine if an SpI site is sufficient by itself for cooperation with the enhancer, the SpI site from the SV40 early promoter was introduced into the E -I construct (Dynan and Tjian, 1983). Although the activity of the Sp-I construct was higher than that of PI, high levels of activation
.W..
I..
'I
N.-f
S.
at'
ILI! G; NILS '',!' 1 \lu( ~ ~ ~ T -U ...
1
Fig. 5. Gel retardation experiments with purified Spi factor and muscle nuclear extracts. 20 pg of labelled AR Im probe were used in each lane. 0.5 and 2.5 ng of competitor double-stranded oligonucleotide were used: lanes 2, 3, 11 and 12, AR HI-MUT G; lanes 4, 5, 13 and 14, AR Ill-MUT Sp. Lanes 1-9, 5 ,ug protein of a nuclear extract from primary chick myotubes (day 7) were used; 0.5 ng (lanes 6 and 8) or 5 ng (lanes 7 and 9-14) of purified Spl factor were respectively used. n.s. indicates a non-specific band that was obtained with the nuclear extracts in the incubation conditions used.
446
Fig. 6. Transient expression experiments with promoter constructs in primary cultures of chicken myotubes. Transfections were done as described by Piette et al. (1989). 2 Ag of the indicated constructs were transfected 3 h after plating, and extracts were prepared 3 days later. Each point was done in quadruplicate in the same experiment, bars represent standard deviations.
Muscle-specific expression of the acetylcholine receptor
were noticed when the enhancer was inserted in front of Sp-I (E-Sp-I) (Figure 6). Similar results where obtained with the Spi site in the reverse orientation (results not shown). Thus, it is concluded that an Sp I site can cooperate with the at-subunit enhancer in muscle cells.
Synergism also occurs between the enhancer and the muscle-specific factor MEF-2 It was then asked if cooperation could also occur between the enhancer and other muscle-specific transactivators. Therefore the muscle-specific factor MEF-2, which binds to the M-CK enhancer (Gosset et al., 1989), was chosen and the MEF-2 binding site was inserted into the I or E-I background, obtaining the constructs M -I and E -M -I. The M -I construct did not have a higher activity than the I construct (Figure 6). In contrast, strong enhancement was obtained with E -M -I, which indicates that the enhancer can cooperate also with the MEF-2 factor. The Sp 1 site is necessary for transactivation of the a-subunit promoter by myogenin and MyoD To analyse further the role of myogenic factors in the cooperation of the Spl site with the enhancer sequence, transactivation experiments were performed in quail QT6 fibroblasts (Figure 7). A 0.01- and 1-fold molar equivalent of CMD 1 or myogenin expression vector were transfected together with the AChR a-subunit promoter-luciferase test vectors. It was noticed that a surprisingly high level of expression occurred in the absence of transactivator. Nevertheless, an 10-fold transactivation was obtained with equimolar amounts of CMD1 or myogenin expression vectors. This is of the same magnitude as the amplification obtained in primary chicken fibroblasts (Piette et al., 1992). The level of basal expression of MUT-G was higher than wild type, but transactivation with CMD 1 or myogenin led
to equivalent expression levels as compared with wild type. With MUT-Sp, however, low expression levels were obtained after transactivation. It is concluded that MUT-Sp is clearly less able to be activated than wild type by CMD1 or myogenin, and therefore that the requirement of the enhancer for an SpI site might be due to positive interactions of the myogenic factors binding to the enhancer with Spl binding to the proximal site.
Comparable activities are obtained in quail muscle cells Finally, it was found important to repeat the transient expression experiments in a homogeneous cell population. Therefore quail muscle cells that had been transformed by a temperature-sensitive mutant of Rous sarcoma virus (RSV ts NY68) were used, which differentiate at the nonpermissive temperature of 42°C. As shown in Figure 8, slightly higher levels of expression than those found in primary cultures were obtained with several constructs. A notable exception is MUT-G, which displayed lower activity levels. Together with the higher activity of MUT-G compared with WT found in QT6 fibroblasts, this suggests that the activity of MUT-G in primary cultures may be due at least partially to contaminating fibroblasts or undifferentiated myoblasts.
Discussion E-boxes are present in the promoters of numerous musclespecific genes, which are expressed at different times during muscle development or in different fiber types. It was thus of interest to investigate the possibility that myogenic factors could cooperate with other factors, in order to understand the differential expression of muscle-specific genes. There are several pieces of evidence that indicate that SpI
rIF I ( }_
(I'. 1, }
-7: .i .i II
1I
:I
11
I1
i~~~~~~~~~~~~~~~~~~~~~~~~~~~
'I
:1 .i
!i
:i
1
1
.
_l~ ., ~ ~~\ L~~~~~N -1I
..s_ -1 1, Hl
_ 1;
II
ii :1
_
I
.t .i i.
-.i
Fig. 7. Transactivation experiments of point mutants by CMDl and myogenin in QT6 fibroblasts. Cells were grown in DMEM supplemented with 10% fetal calf serum. Transactivation experiments were done as described by Piette et al. (1992). 2 /tg of the indicated mutant DNAs were transfected together with respectively 0, 0.2 1tg or 2 jg of CMD1 or myogenin expression vector. Activity is expressed relative to that obtained with the W.T. construct cotransfected with the CMDl expression vector. Each point was done in duplicate.
447
J.-L.Bessereau et a!.
I -7-
() ...
K'
V
\
.*
