Finger printing of Ralstonia solanacearum isolates by Rep-PCR and ...

Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

Finger printing of Ralstonia solanacearum isolates by Rep-PCR and RAPD M. K. PRASANNAKUMAR,1 K. N. CHANDRASHEKARA,2# * M. DEEPA,3 A. VANI2 and A. N. A. KHAN1 1

Department of Plant Pathology, University of Agricultural Science, Gandhi Krishi Vigyana Kendra, Bangalore-560 064, India 2 Division of Biotechnology, Indian Institute of Horticultural Research, Hessaraghatta Lake post, Bangalore-560 089, India 3 Division of Soil Science, Indian Institute of Horticultural Research, Hessaraghatta Lake post, Bangalore-560 089, India # Present: Department of Plant Physiology & Biotechnology, UPASI Tea Research Foundation Tea Research Institute, Valparai – 642 127, Tamilnadu, India. *E-mail: [email protected] ABSTRACT: Fifty seven isolates of Ralstonia solanacearum causing wilt on different host plants viz., tomato (Solanum lycopersicum), brinjal (Solanum melongena), potato (Solanum tuberosum), bird of paradise (BOP) (Strelitzia reginae), ginger (Zingiber officinale), chilli (Capsicum annuum), davana (Artemisia pallens) and coleus (Coleus forskohlii) were collected from different agro climatic zones of India. They were differentiated into races on the basis of their pathogenicity to infect different host. The isolates were established as race-1; none of the isolates infected mulberry and banana. Fifty four isolates oxidized and utilized both the disaccharides and sugar alcohols, thus these isolates positioned as biovars-3 as per Haywards classification system. Three isolates from Kerala, two ginger and one tomato strains were not able to utilize dulcitol and lactose. Hence, were categorized into new taxonomic group within biovar system and designated as biovar-3B for the first time in India. Fifty four isolates were confirmed as race-1, biovar-3 and 3 isolates as race-1, biovar-3B by morphological, physiological, biochemical and pathogenicity studies. Two sets of primers (OLI1 & Y2 and Y1 & Y2) were used in this study for authenticate the organism. Further, the identity of the isolates was confirmed by serological diagnostic kit obtained from International Potato Research Center, Lima, Peru and single chain variable fragment antibody specific to R. solanacearum. Isolates collected from different geographical areas of India were categorized into four major groups in Rep-PCR on the basis of 50 percent coefficient of 1.1-linkage distance. However, no relationship could be drawn regarding the biogeographical origin or host preference of the isolates among the groups. Based on RAPD analysis using 15 random decamer primers, all the isolates were classified into seven major groups/cluster. Key words: Ralstonia solanacearum, race, biovar, fingerprinting, Rep-PCR, RAPD

INTRODUCTION Rals tonia solanace ar um (Ps eudomonas solanacearum) (E.F. Smith) (Yabuuchi et al., 1995) as a species has an extremely wide host range, but different pathogenic varieties (races) within the species may show more restricted host ranges. Several hundred species of tropical, subtropical and warm temperature plants are susceptible to one or other races of R. solanacearum causing heavy losses in many economically important c rops (Ha yward, 1991; C ha ndra shekara and Pras anna kuma r, 2010). The spec ie s is highly heterogeneous and complex. It is a major constraint in the production of many important fruit, vegetable and cash crops. It is a devastating, soil-borne plant pathogen with a global distribution and an unusually wide host range, it causes wilt in over 450 host species in 54 botanical families (Allen et al., 2005) which may give

the pathogen an evolutionary advantage and that number of new species continues to increase (Hayward, 1991). The race and biovar classification has gained wide acceptance for subdividing R. solanacearum. The racial pattern system groups the strains of R. solanacearum on the basis of their ability to infect different host plants, viz., race 1 comprises of many strains having wide host range and pathogenic on different solanaceous plants and weed hosts, race 2 restricted to triploid banana and Heliconia, race 3 (potato race) affecting potato, race 4 infecting ginger and race 5 pathogenic on mulberry (He et al., 1983). The biovar scheme divides the species into five groups on the ability of the strains to metabolise or oxidise spec ific hexose suga rs and disaccharides (Hayward, 1991). At present, there is lot of controversy regarding the prevalence of strains in the various parts of the world. In India however, scanty information is 179

Prasannakumar et al.

Pathogenicity test on different hosts Fifty seven isolates of R. solanacearum were multiplied in casein peptone glucose (Casamino acid 1g L-1, Peptone 10g L-1, Glucose 10g L-1 pH 7.2) to inoculate on differential hosts under artificial conditions. The bacterial suspension was adjusted to concentration of 5x10 8 cfu/ml using spec trophotometer rea dings (Spectronic 20 D, M and R, USA) at a wave length of equivalent to A600nm =0.8 to 1.0. Plants used as differential hosts viz., tomato (Lycopersicon esculentum Mill.) cv. Avinash-II, banana (Musa accuminata L.) cv. Yallaki bale, ginger (Zingiber officinale), mulberry (Morus alba) cv. M-5 and potato (Solanum tuberosum) cv. Kufri Jyothi seedlings were grown in greenhouse under artificial conditions. Twenty day old seedlings of tomato were pulled out gently, washed free of soil and few tertiary roots were clipped with sterilized scissors and dipped in bacterial culture for 10 minutes. The inoculated seedlings were transplanted to plastic bags containing sterilized soil. In situ inoculation of potato, banana, mulberry and ginger plants was carried out by scrapping surface soil and 20 ml of bacterial suspension was poured around roots separately with each isolate and then it was covered with soil. Plants similarly inoculated with sterile water served as control.

available about the prevalence of biovars/races and strains in various parts of the country. Therefore, present investigations on 57 isolates of R. solanacearum causing wilt on different host plants were carried out with the objectives of finding the races and biovars prevailing in different agro climatic zones of Karnataka and other parts of India. Strains of R. solanacearum compose a complex taxonomic group (Hayward, 1991). The races and biovar grouping are at intra sub specific level and that are not governed by international code of nomenclature of bacteria. From India Khan et al. (1974), reported var. asiaticum on the basis of comparative studies of the isolate infecting solanaceous crops. Prevalence of race1 and biotype-3 infecting several host plants has been established by several workers. Adequa te information is not available on the characterization of the strains of R. solanacearum in India, especially with respect to the definition of the strains of R. solanacearum into races and biovars and also the characterization of the strains using molecular methods. Hence in recent years molecular techniques have been applied to explain the sub group within R. solanacearum. Several workers have used molecular techniques such as RFLP, RAPD, REP-PCR etc., for genomic finger printing. Hence the experiments have been designed to characterize 57 isolates collected from different parts of Karnataka and India on the basis of genetic diversity.

Sugar utilization test The isolates were differentiated into biovars as per Schaad (1988) using carbohydrate fermentation discs so as to confirm results obtained. The bacterial suspension belonging to 57 isolates containing population of 5x108 cfu/ml were seeded separately with 0.8 Optical Density (OD) in spectrophotometer at 600nm. The flask was mixed to get uniform suspension. The seeded medium was poured to petri plate and was allowed to cool for 3 hrs. Then fermentation discs viz., cellobiose, lactose, maltose and sugar alcohols such as dulcitol, mannitol and sorbitol were placed in marked position in three locations. Total of nine discs was maintained and plates were incubated at 32o C for 48 hrs. The observations were recorded for change in colour. Observations were recorded once at 18-24 hrs and finally at the end of 48 hrs. Hypersensitive test on tobacco was carried out to determine plant pathogen presence and its virulence (Granada and Sequeira, 1975). All tests viz., starch hydrolysis, nitrate reduction, oxidase, indole production, esculin hydrolysis, arginine dihydrolase, curdling of skimmed milk were carried out as per the methods des cribed in the Ma nual of Microbia l me thods (Anonymous, 1957) a nd Laboratory guide for identification of Plant Pathogenic Bacteria (Schaad, 1988).

MATERIALS AND METHODS Isolation of R. solanacearum strains from field Wilt affected host plants viz., tomato (Solanum lycopersicum), brinjal (Solanum melongena), potato (Solanum tuberosum), bird of paradise (Strelitzia reginae), ginger (Zingiber officinale), chilli (Capsicum annuum), caps icum (Capsicum annuum), davana (Artemisia pallens) and coleus (Coleus forskohlii) showing typical symptoms of wilt was collected from different agro climatic zones of Karnataka and other parts of India (Table 1). A presumptive water streaming test was carried out as described by Danks and Barker (2000). Bacterium was isolated on Semi-selective media South Africa (SMSA) media (Elphins tone et al., 1998; Wenneker et al., 1999). The isolates were subjected to ide ntific ation and confirma tion bas ed on the morphological, physiological, cultural, biochemical and pathogencity studies (Kelman, 1954). The isolates were differentiated into biovars as per (Scha ad, 1988; Hayward, 1991). Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

180

Finger printing of Ralstonia solanacearum Table 1. Designation of Ralstonia solanacearum isolates collected from different agro-climatic zones of Karnataka and other states of India Sl. No.

Isolate code

Host

Place

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

SRP-1 SRP-2 SRP-3 KRP-4 CRP-6 ChRP-7 KRP-8 ChRP-6 BRP-9 HRP-10 BRP-11 KERT-1 BRT-2 KRT-3 HRT-4 KRT-5 BRT-6 BRT-7 KRT-8 KRT-9 TRT-10 BRT-11 APRT-12 KRT-13 BRT-14 DRT-15 KRT-16 TuRT-17 MRT-18 KRT-19 ChiRT-20 HRT-21 HRT-22 HRT-23 HRT-24 HRT-25 TuRT-26 HRT-27 BRT-28

Potato Potato Potato Potato Potato Potato Potato Potato Potato Potato Potato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato Tomato

*Shimla (GSC-26) *Shimla (134) *Shimla (JGS 3/118) Sulebele, Kolar Kolar Chikkabalapur Chikamaglur Bagepalli, Kolar Chikamaglur Bangalore Kandli, Hassan Kerala Bangalore GKVK, Bangalore Chintamani, Kolar Hassan Sreenivaspura, Kolar Bangalore Hebbal, Bangalore Gouribidnur, Kolar Chintamani, Kolar Hossur, Tamil Nadu Hoskote, Bangalore Anantapur, Andhra Pradesh Malur, Kolar Anekal, Bangalore Davangere Kaivara, Kolar Tumkur Mysore Sreenivaspura Chitradurga Madenur, Hassan Bhuvaneshwar, Orissa Arkalgud, Hassan Kandli, Hassan Hassan Tumkur Hassan

40 41 42 43 44 45

DhRT-29 SiRT-30 BiRT-31 KRB-1 HRB-2 ARB-3

Tomato Tomato Tomato Brinjal Brinjal Brinjal

Kanakpura Dharwad Sirsi Bijapur Kolar Kandli, Hassan


181

Prasannakumar et al. 46 47 48 49 50 51 52 53 54 55 56 57

ARB-4 BRCa-1 CRD-1 BOP-1 ORT-1 ORT-2 ORB-1 MRT-1 MRT-2 KERG-1 KERG-2 APRC-1

Brinjal Capsicum Davana Bird of Paradise Tomato Tomato Brinjal Tomato Tomato Ginger Ginger Coleus

Arabhavi Arabhavi GKVK, Bangalore Chikkabalapur Bangalore Bhuvaneshwar, Orissa Bhuvaneshwar, Orissa Nasik, Maharastra Nasik, Maharastra Trissur. Kerala Trissur. Kerala Tirupati (AP)

*Indicates reference strains used in the study were provided by Central Potato Research Institute, Shimla, Himachal Pradesh, India. Table 2. Morphology of 57 isolates of bacterium on SMSA media Isolate

Morphology on SMSA media

KERT-1, BRT-2, KRT-3, HRT-4, KRT-5, BRT-6, BRT-7, KRT-8, KRT-9, TRT-10, BRT-11, APRT-12, KRT-13, BRT-14, DRT-15, KRT-16, TuRT-29, MRT-18,

Irregular with smooth margin, slimy dull white colonies with pink to red center

KRT-19, ChiRT-20, HRT-21, ORT-22, HRT-23, HRT-24, HRT-25, TuRT-26, HRT-27, BRT-28, DhRT-29, SiRT-30, BiRT-31

Moderately fluidal, regularly shaped, convex, red colored colonies.

SRP-1, SRP-2, SRP-3, KRP-4, KRT-5, CRP-6, ChRP-7, KRP-8, ChRP-6, BRP-9, HRP-10, BRP-11, BRCa-1

Moderately fluidal, irregularly shaped, convex, dull white colonies with pink colored center and bluish margin.

KRB-1, HRB-2, ARB-3, ARB-4

Dull white colonies with light pink colored center and the colonies were highly fluidal and flowing producing copious slime

ORB-1

The colonies were well-separated, fluidal, white colonies with dark yellow colored and the colonies were relatively small rigid

BOP-1

Fluidal, white colonies with dark red colored center and the colonies were relatively small rigid

CRD-1, ORT-1, ORT-2, MRT-1, MRT-2, KERG-1, KERG-2

Highly fluidal, irregularly shaped, convex, dark reddish colonies with red colored center and whitish margin.

suspended in 10ml of lysis buffer (0.15M NaCl, 0.05M sodium citrate buffer) and further incubated with 200l of lysozyme (10mg/ml) at 37°C for 60 min. The cells were lysed with 500l of 20% SDS by gently shaking. 15ml of extraction buffer was added (2.5ml of 5M sodium per c hlorate and 12.5ml of chloroform: isoamylalcohol mixture (24:1)). The contents were

Genomic DNA extraction and purification The culture of R. solanacearum purified on SMSA was used for inoculation and incubated overnight in 100 ml of casein peptone glucose (CPG) medium at room temperature. Bacterial culture was centrifuged, (7000rpm for 10 min) and pellets were frozen at -20oC for 2 hrs. Frozen bacterial pellets were thawed for 3 min at 37oC, Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

182

Finger printing of Ralstonia solanacearum incubated at –20°C for 2 hrs; centrifuged at 5000rpm for 10 min. Supernatant was precipitated with equal volume of isopropanol, washed with 70% ethanol, DNA was air dried, dissolved in 1ml T 10E1 buffer. After qua ntific ation on a spectrophotometer, DNA was analysed on agarose 0.7% gel electrophoresis.

thermal cycler (Hybrid-Omni Gene, Heidelberg) by using a modification of the program as follows: one initial cycle at 95 0C for 7 min, 29 cycles consisting of denaturation at 94 0C for 1 min, annealing at 50 0C for 1 min and extension at 65 0C for 5 min. T he program was concluded with a single final extension cycle at 65 0C for 10 min.

PCR amplification and serological detection All 57 isolates were PCR amplified using two sets of primers corresponding to 16S rDNA (OLI1 and Y2) and 16S rRNA (Y1 and Y2) as described by (Seal et al. 1993) using unive rs al prime rs (OLI15’GGGGGTAGCT TGCTAC CT GC C3’ & Y25’CCCACTGCTGCC TCCCGTAGGAGT3’) and (Y15’TGGCTCAGAACGAAC GCGGCGGC3’ & Y25’CCCACTGCTGCCTCCCGTAGGAGT3’). PCR products were resolved on 1.2% agrose gel. Serological confirmation was carried out by using CIP’s postenrichment Double Antibody Sandwich ELISA (DASELISA) kit, International Potato Center, Lima, Peru, (Priou et al. 1999). Monoclonal scFv antibody specific to R. solanacearum race-1, biovar-3 (Chandrashekara et al., 2006; Chandrashekara et al., 2012) was used to confirmation bacterial isolates.

RAPD reaction (25 ml) containing primers each at a concentration of 5 pmols, MgCl2 (2mM), a mixture of dNTP’s each at a concentration of 200 mM, 10X PCR buffer, 1 U of Taq polymerase and 50 ng of template DNA. Amplification was performed in Thermal cycler (Biometra, Germany) for 35 cycles after an initial denaturation at 93 0C for 3 minutes. Each cycle consisted of 30 seconds at 93 0C (denaturation), 30 seconds at 35 0 C (annealing), 72 0C for one minute (extension) and final extension for eight minutes at 72 0C. The PCR products were then resolved on 1.5% agarose gel. Electrophoresis was carried out at 50 V for three hours and the image was captured in Chemi Imager. The scoring of presence of band at each position was recorded as 1 (one) and absence as 0 (zero), using this data pair wise squared Euclidean distance was calculated (Sokal and Sneath, 1973). Based on this distance matrix, cluster analysis was done using minimum variants a lgorithm using the software for cluster analysis (STATISTICA).

Fingerprinting with Rep-PCR and RAPD The DNA finger printing of the 57 isolates of R. solanacear um was carried out by two molecular techniques viz., Rep-PCR and RAPD in order to study genetic diversity. Characterization of bacterial genomes has led to the recognition of repeated DNA sequence that is conserved within diverse bacterial genera, particularly Gram negative ones. Three repetitive PCR were achieved to fingerprint genomic DNA of R. solanacearum strains, corresponding to Repetitive Extragenic Palindromic (REP) regions (Gillson et al., 1984; Higgins et al., 1982), Primer sequences were synthesised by Operon, Biotech, USA, c orre sponding to REP (REP1RI 5’IIIIC GICGIC AT CIGGC3’ and REP2I 5’ICGICTTATCIGGCCTAC3’). The PCR amplifications were carried out essentially as described by Debrujin (1992) and Louws et al. (1994). Master mixers were prepared with PCR reagents. Each reaction consisted of a 50-ml mixture containing 200 mM dNTPs, 1.5 mM MgCl2, 0.5 U Taq DNA polymerase, 5% of 5 x PCR buffer (335 mM Tris-HCl pH 8.8, 83 mM (NH4)2 SO4, 3.75 mM EDTA, 25% glycerol, 0.1% tween 20), and in this case, 25 pmol of each primer. Negative controls were used by adding HPLC water instead of nucleic acid to the PCR tubes. DNA template (80 ng) was used per reaction. PCR amplifications were performed with a Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

RESULTS AND DISCUSSION The bacterium was isolated on SMSA medium (Elphinstone et al., 1998; Wenneker et al., 1999) where it produced irregular-shaped white colonies with pink centers, resembling those of R. solanacearum. All the isolates grown on SMSA medium were similar in characteristics with minor variations which are depicted in Table. 2. The colonies were highly fluidal, white colour with slight pink center and bluish margin, round to irregular shape (Kelman, 1954) but brinjal isolate produced copious slime and were highly fluidal, while BOP isolate produced miniature colonies with dark red pigmentation in the center of the colony. Thus the isolates did not differ much in cultural characters except the brinjal isolates. Further all the isolate s produced typical wilt symptoms in their respective hosts upon artificial inoculation by root injury technique (Wang and Berk, 1997). Artificial inoculation of the pathogen plants which expressed symptoms in 4-5 weeks time, while BOP isolate took longer time. Two ginger isolates could infect all other solanaceous host plants but failed to infect mulberry and Musa plants. Thus on the basis of host 183

Prasannakumar et al. range, and the ability to cause wilt in solanaceous and non solanaceous plants the 57 isolates were designated as race-1. Similar results were also reported in past by several workers about prevalence of race in India as race-1 (Khan, 1974). The R. solanacearum isolates was classified into different biovars on the basis of their ability to utilize or oxidize three hexose alcohols (mannitol, sorbitol and dulcitol) and three disaccharides (lactose, maltose and cellobiose) (Hayward, 1964). Among 57 isolates, 54 isolates oxidized disaccharides and hexahydric alcohols tested are presented in Table 2. The three isolates from Kerala viz. KERT-1, KERG-1 and KERG-2 behaved differently and were unable to utilize dulcitol and lactose. Hence, a new taxonomic group at the sub species level within the biotype was created and these three isolates have been designated as biovar-3B (Chandrashekara et al., 2012).

located in the intergeneric regions of many bacterial genomes are considered to be highly conserved (Stern et al., 1984; Hulton et al., 1991 and Martin et al., 1992) as such they are useful in elucidating relationship within and between bacterial species. RAPD analysis and repPC R wa s used to examine the ge netic variation, relationship between the 57 isolates of R. solanacearum. The plants were collected from different geographical locations of India and different agroclimatic area of Karnataka. Amplification of rep-PCR primers (REP1R1 and REP2-1) was done by Martin and Rudolph (2002) twice, reproduced five bands which were used for analysis of different levels of affinity and dissimilarity value levels for R. solanacearum. Rep-PCR derived genome fingerprints generated from purified DNA showed reproducible banding pattern and a dendrogram was generated based on DNA amplification (Fig. 1). The finger print analysis does not show any biogeographically trends consistent with the conclusion drawn by earlier workers (Martin and Rudolph, 2002; Debrujin, 1992). The cluster analysis of the data does not indicate any specific origin of the isolates, collected from different geographical parts of country, unlike Thwaites et al. (1999) who marked strains of R. solanacearum from Central America. Dendrogram developed on the basis of similarity value of all pair wise combinations, enabled us to classify the 57 isolates into the four groups at 50 per cent coefficient at 1:1 linkages distance. All the isolates expressed the genetic similarity value of 2.1 with variation starting from 2.1 as a line base. The first major group showed different band profile comprising of strains from different agroclimatic areas Chikkabalapur (zone-5), Dharwad (zone -7) and Kolar (zone-5). However, majority of host plants collected belonged to tomato. Second major group comprised of diverse host plants from agroclimatic zones of Karnataka as well as different geographical locations of India (Fig. 2). This group comprised of 33 strains of different origin and host plants and biovar-III and atypical biovars-IIIB (Two ginger isolates of Kerala). Third major group cluster includes four isolates mostly obtained from tomato except for one brinjal isola te . Howe ve r, the y do not refle ct in homogeneity in geographical origin. Fourth major group comprised of mainly tomato isolates except two isolates of potato from Himachal Pradesh, Bangalore and one from capsicum (SRP-3, BRCA-1, HRT-23, DRT-29, TuRT-26, KRTF9, ORT-2, BRT-31, SRT-30, KRT-6, BRP-11, MRT-1, BRT-7). However, the isolates belonged to different geographical zones of Karnataka and geographical origins in India, Maharastra (western India, Orissa and Himachal Pradesh (north India).

Sequences of 16Sr DNA and 16Sr RNA genes are often species-specific and are present as multiple copies in microbial genomes, hence they make excellent targets for identification of bacteria at the species level and the corresponding specific rDNA and rRNA sequences have been used as targets for PCR amplification (Woese, 1987). The PCR amplification resulted in a 300 base pair (bp) and 292 bp product from all the 57 isolates of R. solanacearum respectively for (Y2 & OLI1) and (Y1 & Y2). The amplification conditions allowed the specific detection of R. solanacearum isolates. This confirmed that all 57 isolates tested were R. solanacearum. Similar results were obtained by Seal et al. (1993) and hence isolates tested were grouped in race-1. All the isolates produced bright purple coloration at a concentration of 107 cfu/ml on the nitrocellulose membrane which was compared with positive control strips provided in the kit (Priou et al., 1999). Further the scFv monoclonal (antiR. solanacearum-ALP) antibody confirmed the detected R. s olanacearum is olates ha s ra ce -1, biova r-3 (Chandrashekara et al., 2006; Chandrashekara et al., 2012). Genomic DNA finger printing by PCR amplification with random primer, termed RAPD’s (Random Amplified Polymorphic DNA) Williams et al. (1990) has gained popularity as a useful technique for comparative genome analysis. More recently, PCR amplification with primer specific to the repetitive genetic elements REP (Repetitive Extragenic Palindromic), ERIC (Enterobacterial Repetitive Intragenic Consences) and Box A, B and C subunits collectively known as rep-PCR (Martin et al., 1992) has been useful for genomic finger printing of Gram negative bacteria (Louws et al., 1994). These repetitive elements, Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

184

Finger printing of Ralstonia solanacearum comprised of eight isolates infecting solanaceous host plants, tomato, potato, brinjal and also ginger from Kerala. Nevertheless it appears that isolates belonging to group-3 and group-6 are closely related since as they are isolated from tomato plants and has closer geographical proximity. Ito et al., 1996 from Japan identified genetic diversity among 18 isolates of R. solanacearum isolated from aubrgines and tomato collected from different agricultural fields. Group-5 comprises of isolates from Maharashtra, Kerala, Karnataka and Himachal Pradesh infecting only tomato and potato. The isolates were collected from different parts of India and Karnataka. This group comprises cluster of 23 heterogeneous isolates infecting different host plants and isolated from different geographical area of India, while group-6 includes only three tomato isolates obtained from Kolar and Hassan.

Fig. 1. Dendrogram showing the similarities between R. solanacearum isolates based on REP-PCR The 57 isolates from various host plants collected from different parts of India were grouped into seven clusters on the basis of RAPD analysis, 15 random primers, which yielded 145 reproducible bands. These 15 random primers were s elected on the basis of polymorphic bands produced during the initial screening 44 primers from OPA, OPF, OPE and OPH groups (Fig. 3 to 6). RAPD clearly differentiated group 1 comprising of only two isolates viz., ORB-1 and HRT-27 collected from Orissa and Hassan infecting brinjal and tomato plants respectively. This group does not reflect any host and geographical affinity. Whereas group-2 comprises of six isolates obtained from southern dry tract of Bangalore and Kolar infecting three major crops tomato, potato and brinjal. Group-3 comprises of only tomato isolates, however it does not reflect biogeographically origin, as the tomato isolates were collected from Bangalore, Kolar, Hassan, Mysore and Dharwad, which belonged to different agroclimatic zones of Karnataka. Group-4

Fig. 3. Representative RAPD PCR on 1.5% agrose gel of OPH-19 primer




Fig. 2. Dendrogram showing the similarities between R. solanacearum isolates based on RAPD-PCR Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

185

Prasannakumar et al. Whereas group-7 has a very broad host range infecting solanaceous host plant, ginger, davana and coleus plants.

host plants for Ralstonia solanacearum from India. Plant Pathology, 59(6): 1178.

Variation in RAPD cluster in our study revealed genomic diversity among 57 isolates suggesting that the pathogen population constituted of independent clonal lines. He et al. (2003) studied genetic diversity among 37 isolates of R. solanacearum by RAPD using 17 selected primers. The frequency of genetic diversity was 89.5 per cent. They were able to categories 37 isolates into four major clusters. These results confirmed our pres ent findings revea ling e xistence of obvious differences in pathogencity among the 57 isolates collected from different host plants and geographical are as. RAPD ana lysis of different isolates of R. solanacearum with different primers revealed two clusters, comprising of American and Asiaticum strain (Thwaites et al., 1999). Shobha (2002) divided 14 isolates from various host plants into two major groups/ clusters using odd minimum variances. She stated that potato isolate clustered away from the other solanaceous hosts indicating that strain infecting plant could be different strain. However, in our present investigation we did not find such variations.

Chandrashekara, K. N., Prasannakumar, M. K., Deepa, M., Vani, A. and Khan, A.N.A. 2012. Prevalence of races and biotypes of Ralstonia solanacearum in India. Journal of Plant Protection Research, 52(1): 26-31.

ACKNOWLEDGEMENTS The authors are grateful to Indian Council of Agricultural Research (ICAR) for providing funds to carry out the research in National Agricultural Technology Programme - Competitive Grant Program (NATP-CGP) mode. We would like to thank Indian Institute of Horticultural Research and University of Agricultural Science, Bangalore for facilities provided.

Gillson, E., Clement, J. M., Perrin, D. and Hofnung, M. 1984. A family of dispersed repetitive extragenic palindromic DNA sequence in E.coli. The EBBO J., 3: 14-17.

Danks C. and Barker, I. 2000. On-site detection of plant pathogens using lateral flow devices. OEPP-EPPO Bulletin, 30: 421–426. Debrujin.1992. Use of repetitive extragenic palindromic and entero bact erial repeti tive intragenic consensus sequences and the PCR to finger print the genomes of Rhizobium melilotii, isolate and other soil bacteria. Appl. Environ. Micro. Biol., 58: 2180-2187. Elphinstone, J. G., Stanford, H. M. and Stead, D. E. 1998. Detection of Ralstonia solanacearum in potato tubers, Solanum dulcamara, and associated irrigation water. In: Bacterial Wilt Disease: Molecular and Ecological Aspects (Ed. Prior, P., Allen, C and Elphinstone, J), 133-139. Granada, G. A. and Sequeira, L. 1975. Characteristics of Colombia isolates of Pseudomonas solanacearum from tobacco. Phytopathology, 65: 1004-1009.

Hayward, A.C. 1991. Biology and Epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Annual Review of Phytopathology, 29: 65-87.

REFERENCES

Hayward, A.C. 1964. Characteristics of Pseudomonas solanacearum. Journal of Applied Bacteriology, 27: 265-271.

Allen, C., Prior, P. and Hayward, A. C. 2005. Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. APS Press: St. Paul, Minnesota, USA.

He, L.Y., Sequiera, L. and Kelman, A. 1983. Characteristics of strains of Pseudomonas solanacearum from China. Plant Disease, 67: 1357-1361.

Anonymous., 1957. Manual of Microbial Methods (Ed). So ciet y of American Bacteriolo gist s, McGraw, NewYork, 315.

He, Z.F., Yu, H. and Luo, F.F. 2003. Differentiation of pat hogenici ty and RAPD analysis o f Ra lst on ia solanacearum. Guangdong, 33: 415-420.

Chandrashekara, K. N., Jagadish, K., Krishnamurthy, K. B., Rashmi, S., Prasannakumar, M. K., Sathya L., Ibem, H. K., Ramachandra, Y. L. and Vani, A. 2006. Single chain antibody fragments transcriptionally fused to ALP specific against Ralstonia solanacearum virulent and avirulent strains to detect field samples of infected plants. Presented in: International Bacterial Wilt symposium held on 17-20th July 2006 at York, England, United Kingdom, 34.

Higgins, C.F., Mc Laran, Barnes, W.M., Clement, J.M. and Half Long. 1982. A novel intra cystanic mRNA and gene expressed regulatory elements of eukaryotic organisms. Nature, 298: 152-156. Hulton, C.S.J., Higgins, C.F. and Sharp, P.M. 1991. ERIC Sequences: A novel family of repetitive elements in the genomes of E. coli, Solmonella typhimurium and other enterobacteria. Molecular Micology, 5: 825-834. Ito, S., Ushijima, Y., Fuji, T., Tanaka, S., Kameya, I.M., Yoshwara, S. and Kishi, Y. 1996. Genomic diversity of

Chandrashekara, K.N. and Prasannakumar, M.K. 2010. New Pest Management in Horticultural Ecosystems, Vol. 18, No. 2 pp 179-187 (2012)

186

Finger printing of Ralstonia solanacearum field isolates of Burkholderia solanacearum in Japan. Journal of Phytopathoogy, 144: 501-504.

R. solanacearum causing wilt of solanaceous plants and their prevalence in Karnataka. Ph.D. thesis, University of Agricultural Sciences, Bangalore.

Kelman, A. 1954. The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance in tetrazolium medium. Phytopathology, 44: 693-695.

Sokal, R.R. and Sneath, P.H.A. 1973. Numerical Taxonomy. San Francisco, USA, Freeman.

Khan, A. N. A. 1974. Studies on Pseudomonas solanacearum (E.F. Smith) causing wilt of brinjal, potato and tomato in Mysore state. Mysore Journal of Agricultural Sciences, 8: 478-479.

Stern, M.J., Aims, G.F., Smith, L., Robinson, N.H. and Higgens, E.C. 1984. Repetitive extragenic palindromic sequences: A component of bacterial genome, Cell, 37:1015-1026. Thwaites, R., Mansfield, J., Eden, G.S. and Seal, S.E. 1999. RAPD and rep-PCR based fingerprinting of vascular bacterial pathogens of Musa spp. Plant Pathology, 48: 121-128.

Louws, F.J., Fulbright, D.W. and Stephens Debrujin, F.J. 1994. Specific DNA finger printing of Phytopathogenic Xanthmonas and Pseudomonas pathovars and strains generated with repeated sequence and PCR. Applied Envirotal Microbiology, 60: 2286-2295.

Wang, J.F. and Berk, T. 1997. Sources of resistance to Bacterial Wilt in Capsicum annuum. ACIAR Bacterial Wilt Newsletter, 14: 3-4.

Martin, B., Humbert, O., Camara, N., Guenzi, E., Walker, J., Mitchell, T., Andrew, P., Prudhomme, M. and Alling, G. 1992. A highly conserved reparative DNA element located in the chromosomes o f St rep tococcus pneumoniae. Nucleic Acid Research, 20: 3479-3483.

Wenneker, M., Verdel, M.S.W., Van Beuningen, A.R., Derks, J.H.J. and Janse, J.D. 1999. Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in surface water and natural weed hosts: first report on stinging nettle (Urticadioica). European Journal of Plant Pathology, 105: 307–315.

Martin, O.M. and Rudolph, K. 2002. Variability of Ralstonia solanacearum strains using repetitive extragenic. International Bacteria Newsletter, 4-5.

Williams, J.G.K., Kubelik, A.R., Livak, Rafalski, J.A. and Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful genetic markers. Nucleic Acid Research, 18: 6531-6535.

Priou, S., Gutarra, L., Fernandez, H. and Aley, P. 1999. Highly sensitive detection of Ralstonia solanacearum in latently infected potato tubers by post enrichment ELISA on nitrocellulose membrane. OEPP/EPPO Bulletin, 29: 117-125.

Woese, C.R. 1987. Bacterial Evolution. Microbiology Review, 51: 221-271.

Schaad, N.W. 1992. Laboratory guide for the identification of plant pathogenic bacteria, 2nd Edition. APS Press: St. Paul, Minnesota, USA.

Yabuuchi, E., Kosako., Yano, I., Hotta, H. and Nishiuchi, Y. 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia Gen. Nov. Proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) Comb. Nov. Ralstonia solanacearum (Smith 1896) Comb. Nov. and Ralstonia eutropha (Davis 1969) Comb. Nov., Microbiology and Immunology, 39: 897-904.

Seal, S.E., Jackson, L.A., Young, J.P.W. and Daniels, M.J. 1993. Differentiation of P. solanacearum, P. syzygii, P. pickettii and the blood disease bacterium by partial 16S RNA sequencing, construction of oligonucleotide pri mers for sensiti ve detection by polymerase chain reaction. Journal of General Microbiology, 139: 1587-1594.

MS Received : 1 Oct 2012 MS Accepted : 25 Nov 2012

Shobha, G. 2002. Molecular, biochemical studies and pathogenicity test in the detection of races/strains of


187