Am. J. Pot Res (2009) 86:304–314 DOI 10.1007/s12230-009-9084-0
Validation and Implementation of Marker-Assisted Selection (MAS) for PVY Resistance (Ryadg gene) in a Tetraploid Potato Breeding Program Ryon J. Ottoman & Dan C. Hane & Charles R. Brown & Solomon Yilma & Steven R. James & Alvin R. Mosley & James M. Crosslin & M. Isabel Vales
Published online: 24 March 2009 # Potato Association of America 2009
Abstract The gene Ryadg from S. tuberosum ssp. andigena provides extreme resistance to PVY. This gene has been genetically mapped to chromosome XI and linked PCRbased DNA markers have been identified. Advanced tetraploid russeted potato clones developed by the U.S. Pacific Northwest Potato Breeding (‘Tri-State’) Program with Ryadg PVY resistance were used in this study. The objective of this work was to assess the usefulness of molecular markers linked to Ryadg as a tool for selecting PVY resistance in a tetraploid potato breeding program. To achieve this, a full-sib tetraploid population segregating for Ryadg was screened with molecular markers linked to Ryadg,
R. J. Ottoman : S. Yilma : M. I. Vales (*) Department of Crop and Soil Science, Oregon State University, Corvallis, OR 97331, USA e-mail:
[email protected] D. C. Hane Hermiston Agricultural Research and Extension Center, Oregon State University, Hermiston, OR 97838, USA C. R. Brown : J. M. Crosslin United States Department of Agriculture (USDA)-Agricultural Research Service (ARS), Prosser, WA 99350, USA S. R. James Central Oregon Agricultural Research Center, Oregon State University, Madras, OR 97741, USA A. R. Mosley Department of Crop and Soil Science, Oregon State University, Corvallis, OR 97331, USA
artificially inoculated with PVYO and evaluated in the greenhouse. A large percentage (96.4%) of the segregating lines showed coincidence between molecular markers and ELISA results at 40 days after inoculation. This justifies the use of molecular markers as an alternative to artificial inoculation followed by ELISA. Segregation (resistant vs. susceptible) based on ELISA and molecular marker results in the full-sib population indicated the presence of Ryadg as a simplex in the PVY resistant parent OR00030-1. Additional full-sib populations segregating for the Ryadg gene coming from OR00030-1 and from a related clone, AOR00628-3, were evaluated under field conditions. MAS can be used as a fast and efficient tool to select for PVY resistance, reducing the number of PVY susceptible lines retained for succeeding field evaluations, and thereby increasing the odds of generating PVY resistant potato varieties. Resumen El gen Ryadg de S. tuberosum ssp. andígena ofrece resistencia extrema contra el virus Y de la papa (PVY). Este gen ha sido genéticamente mapeado en el cromosoma XI y se han identificado marcadores ligados de ADN basado en PCR (reacción en cadena de la polimerasa). Clones avanzados tetraploides de papa rugosas, desarrollados por el Programa de Mejoramiento del Pacífico Noroeste de los Estados Unidos (`Tri-State´) con resistencia Ryadg al PVY fueron utilizados en este estudio. El objetivo de este trabajo fue evaluar la utilidad de los marcadores moleculares ligados a Ryadg, como una herramienta para seleccionar resistencia al PVY en un programa de mejoramiento de papa tetraploide. Para lograr esto, una población tetraploide de hermanos completos, segregantes para Ryadg fue tamizada mediante marcadores moleculares ligados al Ryadg, inoculada artificialmente con PVYo y
Am. J. Pot Res (2009) 86:304–314
evaluada en invernadero. Un alto porcentaje (96.4%) de las líneas segregantes mostró coincidencia entre los marcadores moleculares y los resultados de ELISA 40 días después de la inoculación. Esto justifica el uso de marcadores moleculares como una alternativa a la inoculación artificial seguida por ELISA. La segregación (resistente vs. susceptible) basada en ELISA y los resultados de los marcadores moleculares en la población de hermanos completos, indicó la presencia de Ryadg como un simplex en el progenitor PVY resistente OR00030-1. Poblaciones adicionales de hermanos completos segregantes para el gen Ryadg y provenientes de OR00030-1 y de un clon relacionado, AOR00628-3, fueron evaluadas bajo condiciones de campo. MAS (selección asistida por marcadores) puede ser utilizada como una herramienta rápida y eficiente para seleccionar resistencia al PVY, reduciendo el número de líneas susceptibles al PVY retenidas para evaluaciones de campo futuras y así incrementar las probabilidades de generar variedades de papa resistentes al PVY. Keywords Potatoes . PVY . Ryadg . Extreme resistance . Marker-assisted selection . ELISA . Solanum tuberosum . Breeding
Introduction Potato Virus Y (PVY, Potyvirus) is a pathogen of great concern to both commercial and seed potato growers. The symptoms of PVY infection include vein necrosis, mottling, yellowing of leaflets, leaf-dropping, plant dwarfing and premature plant death (deBokx and Huttinga 1981), but differences in symptom expression can be highly cultivar and virus strain specific. There are three main strains of this virus: PVYO, PVYN, and YC (Brunt 2001). Additional strains have also been documented including PVYNTN, responsible for the potato tuber necrotic ringspot disease, PVYNW, and PVYN:O (Chrzanowska 1987; Kerlan et al. 1999; McDonald and Singh 1996; Weidemann 1988). PVY is transmitted in a non-persistent manner by more than 50 species of aphids (Radcliffe and Ragsdale 2002). Once the plant is infected, the virus spreads throughout the plant including tubers held for seed (deBokx and Huttinga 1981), making it difficult to eradicate from seedlots. The vegetative propagation of potato enables systemic viruses to persist from 1 year to the next resulting in an overall decline in productivity. Depending on the cultivar, time of infection, and environment, yield losses associated with PVY range from 10–80% (deBokx and Huttinga 1981; Rykbost et al. 1999). Methods for controlling the spread of PVY include both direct and indirect approaches. Direct PVY control is achieved by roguing infected plants. This is not an easy
305
task, since some genotypes do not show symptoms clearly, especially in the case of asymptomatic/tolerant genotypes and with some PVY strains. The main indirect PVY control methods used include the use of limited-generation potato seed production and insecticide applications (Franc 2001; Gutbrod and Mosley 2001). The limited-generation potato seed production and certification programs place restrictions on how long (generations or years) seed may be retained based on the percentage of plants infected with viruses and other pathogens. Insecticides control aphid populations, but are particularly ineffective to prevent PVY spread. Despite the controls methods used and because of the non-persistent virus transmission by aphids, PVY still remains as serious problem affecting potato production, thus additional control options are necessary. The use of PVY resistant cultivars is an alternative or complementary control method. This option is environmentally friendly, cost-effective and easy to implement by the growers since the solution is to plant resistant varieties. PVY-resistant cultivars can be obtained through genetic transformation (Bukovinszki et al. 2007; Missiou et al. 2004; Berger and German 2001; Stark and Beachy 1989) or by traditional breeding (Brown and Corsini 2001). Traditional breeding is the current means of developing PVYresistant cultivars due to the non-acceptance of transgenic varieties by the potato industry and consumers. Traditional breeding for resistance to PVY starts with the identification of potato clones resistant to PVY, followed by the introgression of the resistant gene(s) into advanced breeding populations. PVY resistance present in potato germplasm or wild relatives can be classified into three distinct groups: hypersensitivity, tolerance, and extreme resistance. Hypersensitivity is a necrotic response to PVY infection and is regulated by N genes that provide strain-specific resistance (Barker 1996). Tolerance to PVY infection allows plants to carry a high concentration of virus but show little phenotypic damage (Swieżyński 1994). Extreme resistance or complete resistance to PVY is provided by Rgenes (Cockerham 1970). Extreme resistance to PVY in potato has been identified in S. stoloniferum, S. hougasii, S. tuberosum ssp. andigena and several other Solanum species (Brown and Corsini 2001). The S. tuberosum ssp. andigena resistant gene is referred to as Ryadg (Ross 1986) and is non-specific to PVY strain infections (Mihovilovich et al. 1998). The extreme resistance and non-specific strain characteristics of Ryadg have made it an ideal source of PVY resistance for our breeding program. The traditional way to phenotype potato clones as PVY susceptible or resistant is to expose the clones to the virus and subsequently evaluate symptoms or presence of the virus. The clones can be exposed to the virus under field conditions using natural or artificial inoculations or under more controlled conditions in the greenhouses/growth
306
chambers by using artificial inoculations with aphids carrying the virus, by grafting, or mechanical inoculation techniques. Classifying clones as resistant or susceptible can be based on visual observation for virus expression, or immunological tests like the enzyme-linked immunosorbent assay (ELISA) and with reverse transcriptase-polymerase chain reaction (RT-PCR) amplification. These options can be time consuming, tedious and impractical when screening large segregating populations. In addition, there are many other aspects that could lead to false classifications, like environmental conditions (temperature, humidity and wind), presence of aphids carrying the virus, technical skills, asymptomatic cultivars, etc. In an effort to maximize selection efficiency for genotypes resistant to PVY (Ryadg source), genetic markers previously identified in the literature as linked to this PVY resistance gene were used in this study. Utilizing restriction fragment length polymorphism (RFLP) analysis, marker TG508 was identified as tightly linked to the Ryadg locus with an estimated map distance of 2.0 cM. (Hämäläinen et al. 1997). That marker was then used to develop the resistance-gene-like (RGL) DNA fragment ADG2 which was located to a resistant gene family on chromosome XI (Hämäläinen et al. 1998). The ADG2 fragment was found to be 77% homologous to the N gene that provides resistance to tobacco mosaic virus in Nicotiana glutinosa and 53% homologous to RPP5 resistance to Peronospora parasitica (Sorri et al. 1999). It was later discovered that the fragment ADG2 contained a nucleotide-binding domain (NBS) characteristic of a class of R genes with a Cproximal leucine-rich repeat (LRR) region (Ellis et al. 2000; Vidal et al. 2002). The gene Y-1 contained in ADG2 has been characterized. When Y-1 was transformed into potato plants, no significant resistance was observed, and systemic PVY infection was reported (Vidal et al. 2002). Therefore, the Y-1 and Ryadg genes are different genes but tightly linked. Several PCR-based and user friendly markers for the gene Y-1 such as RYSC3 and ADG2 BbvI have been developed, (Kasai et al. 2000; Sorri et al. 1999). Markers RYSC3 and ADG2 BbvI do not represent the Ryadg gene, but are closely linked and thus can be used for MAS for PVY resistance. In this study, we used advanced russet type tetraploid clones containing the Ryadg gene as a source of extreme and non-isolate specific PVY resistance and we evaluated the practical use of MAS for PVY resistance in the Oregon Potato Breeding Program. The objectives of this research were 1) to determine the association of the markers RYSC3 (Kasai et al. 2000) and ADG2 BbvI (Sorri et al. 1999) with PVY resistant phenotypes based on ELISA and visual observations; and 2) to implement MAS for PVY resistance in a tetraploid breeding program.
Am. J. Pot Res (2009) 86:304–314
Materials and Methods Plant Material The plant material used in this study included PVY resistant and susceptible tetraploid potato clones, and full-sib segregating populations. OR00030-1 is an advanced russetted potato clone developed by the U.S. Pacific Northwest Potato Breeding (‘Tri-State’) Program from a cross made in Oregon in 2000. This clone has good yield and quality potential and resistance to PVY, coming from S. tuberosum ssp. andigena (see pedigree in Fig. 1). AOR00628-3 is a PVY resistant clone related to OR00030-1, both share A88597-7 as source of PVY resistance. AO95245-2 is an advanced russet clone with good agronomic and processing quality and is susceptible to PVY. Russet Norkotah and Russet Burbank were used as additional susceptible controls. The full-sib segregating populations included one population for genetic studies (OR05030, derived from the cross between OR00030-1 and AO95245-2) and several populations for field selection (OR03145, OR04155, OR04158, OR04159, OR05004, OR05005, OR05011, OR05036, OR05067 and OR05093). Crosses to generate these populations were made in 2003, 2004, and 2005 in Corvallis, Oregon, USA. The berries were harvested and seedling tubers were produced from the true potato seeds. Genetic Studies: Validation Plant Growth The full-sib population OR05030 (84 lines) used for genetic studies and the corresponding parental lines (OR00030-1 and AO95245-2), the controls Russet Norkotah (PVY susceptible and asymptomatic) and Russet Burbank (PVY susceptible) were planted in greenhouses at Oregon State University in 4×4 inch plastic pots using SUN GRO™ professional blend media in a completely randomized block design with two replications. Greenhouse conditions were
ND9526-4 Russet Norkotah
ND9687 5 ND9687-5 A82580-1
OR00030-1 A88597-7
R241-16
AO95495 7 AO95495-7
A77236-6 Summit Russet
TND329-1
Fig. 1 Pedigree of the PVY resistant clone OR00030-1. The female parent is listed above the male parent. R241-16 is the source of the Ryadg gene
Am. J. Pot Res (2009) 86:304–314
set at 18.3°C day and 15.5°C night. Artificial light was provided for 16 h per day to extend the winter day length. Plants were watered and fertilized to maintain health.
307
Sunnyvale, CA.). Phenotypic distributions were based on the absorbance raw values. The resistance threshold cutoff was set at absorbance levels two times greater than the mean for negative controls (Sutula et al. 1986).
Virus Inoculation DNA Isolation and Molecular Marker Assays Plants were mechanically inoculated using verified PVYO (PVY) maintained in tobacco tissue provided by Dr. James Crosslin (USDA/ARS, Prosser, WA). Infected fresh tobacco tissue (2.5 g) was ground in 25 ml of cold 1 mM potassium phosphate pH8 virus buffer. Two young leaves of each plant were dusted with Carborundum and were then lightly rubbed with cheesecloth dipped in virus buffer. The inoculated leaves were marked and observed for virus symptoms. Visual PVY symptoms were divided into three severity classes: typical PVY virus expression, questionable PVY virus expression, and no virus expression. Typical PVY virus expression was classified as leaf mottling and vein burning. Plants with questionable virus expression displayed a slight mottling less distinct than classical PVY leaf mottling. Plants were evaluated at 20 days and 40 days after inoculation for virus expression and tested by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Tubers produced by the inoculated plants were planted and tested by ELISA to verify PVY transmission to the tubers. PVY titers were determined using ELISA with PVYO-N polyclonal anti-bodies (AGDIA, Inc., Elkhart, IN). Fresh tissue from the third compound leaf (counting from the top) from artificially inoculated plants was collected and ground in a buffer ratio of 1:10 (50 mg tissue: 500μL grinding buffer) using a Qiagen/Retsch MM 300 mixer mill (Qiagen Inc, Valencia, CA.) The assay was conducted using the method recommend by AGDIA. Two negative and two positive controls (included in the AGDIA kit) were used in each 96-well ELISA plate. After incubating for one hour, absorbance values were measured at 405 nm (A405 nm) using a VERSAmax microplate reader (Molecular Devices
Genomic DNA was extracted from 30 mg of young leaf tissue. The leaf samples were cut into four pieces, placed in Qiagen collection tubes (Qiagen Inc, Valencia, CA) and stored at −80°C until DNA was extracted. The tissue was ground using a Qiagen/Retsch MM 300 mixer mill (Qiagen Inc, Valencia, CA) and DNA was isolated as described by Riera-Lizarazu et al. (2000). DNA concentration and quality were determined on a 1% agarose gel by comparison with lambda DNA of known concentration. Polymerase chain reaction (PCR) amplification of markers linked to Ryadg was carried out using a Techne thermocycler (Techne Inc, Burlington, NJ.) with primers developed by Kasai et al. (2000) and Sorri et al. (1999) (Table 1). Each reaction contained 0.03 U/μL of Taq polymerase (Qiagen Inc, Valencia, CA), 1 X Taq buffer, 2% sucrose in 0.04% cresol red, 0.1 mM of each deoxynucleotide, 0.5μM of each primer and 10 ng template DNA. The PCR reaction volume was 10μL for the marker RYSC3. The PCR program consisted of an initial denaturation step at 93°C for 9 min., followed by 35 cycles of denaturation at 94°C for 45 s, primer annealing at 60°C for 45 s, and extension at 72°C for 60 s, followed by a final extension at 72°C for 5 min. PCR products were checked in a 2% agarose gel in 0.5 X TBE. Presence of a 321 base pair (bp) band was associated with PVY resistance from Ryadg and absence of the band indicated association with susceptibility to PVY as in Kasai et al. (2000). The reaction volume for the ADG2 marker was 20μL. The PCR consisted of an initial denaturation step at 93°C for 2 min., followed by 35 cycles of denaturation at 93°C for 45 s, primer annealing at 45°C for 45 s, and primer extension at 72°C for 60 s,
Table 1 Forward and reverse primer sequences for the RYSC3 and ADG2 DNA-based markers, annealing temperatures, PCR product sizes and chromosome location. ADG2 was digested with BbvI Markera
Primer
Forward and reverse primer sequences (5′–3′)
Tab
Digestion enzyme
Product sizes (bp)c
Chromosome
Reference
RYSC3
3.3.3 s ADG23R ADG2-F ADG2-R
ATACACTCATCTAAATTTGATGG AGGATATACGGCATCATTTTTCCGA ATACTCTCATCTAAATTTGATGG ACTGAACAGCATCATGTTCAAG
60°C
None
XI
Kasai et al. (2000)
45°C
BbvI
(R) 321 (S) absent (R) 355 (S) 270
XI
Sorri et al. (1999)
ADG2 BbvI
a
Names used in this study
b
Annealing temperature
c
R band associated with PVY resistance, S band associated with PVY susceptibility
308
followed by a final extension at 72°C for 5 min. PCR products were checked in a 2% agarose gel in 0.5 X TBE. The PCR products of ADG2 were digested in a reaction volume of 12μL with approximately 125 ng of PCR product, 0.1 U/μL BbvI enzyme (Fermentas Life Sciences), 10 X enzyme buffer. Samples were digested at 65°C for 3 h and products were then visualized on a 2% agarose gel in 0.5 X TBE. Presence of an undigested product of 355 bp was associated with the PVY resistance gene Ryadg. Presence of two digested products of 270 bp and 85 bp were associated with PVY susceptibility as in Sorri et al. (1999). Field Selections: Implementation of MAS in the Oregon Potato Breeding Program The breeding populations OR03145 (151 lines), OR04155 (165 lines), OR04158 (198 lines), OR04159 (106 lines), OR05004 (55 lines), OR05005 (58 lines), OR05011 (98 lines), OR05036 (510 lines), OR05067 (658 lines), and OR05093 (665 lines) were planted as single hill units at the potato research center in Powell Butte, Oregon, during the 2005 and 2006 growing seasons. Seed pieces were spaced 0.91 m between rows and 0.68 m within rows. Standard production practices for Central Oregon were used throughout the growing season. Criteria for cultivar selection emphasized tuber size, shape and type. The selected clones (29) were stored at 3.3–4.4°C. A single apical eye was removed from each selection in early spring and planted in the greenhouse in Corvallis, Oregon. Greenhouse temperatures were held at 18.3°C day and 15.5°C night. Plants were watered as needed until large enough for DNA extraction. DNA isolation and molecular marker assays were performed as described above. Final selection was based on the association of markers with the PVY resistance gene (Ryadg).
Am. J. Pot Res (2009) 86:304–314
Results OR00030-1, the advanced russetted tetraploid clone used as parent and source of extreme resistance to PVY (Ryadg gene introgressed from S. tuberosum ssp. andigena) (Fig. 1) in our experimental population (OR05030), was declared PVY resistant based on its pedigree (Fig. 1), on graft inoculation followed by ELISA (C. Brown, personal communication), on mechanical inoculation followed by ELISA (this study) and on field evaluations under high pressure of aphids carrying PVY (D. Hane, personal communication). Molecular marker evaluations indicated the presence of marker alleles associated with PVY resistance (Ryadg) in OR00030-1 [RYSC3 (Kasai et al. 2000): 321 bp band and ADG2 BbvI (Sorri et al. 1999): uncut 355 bp band] (Fig. 2a and b). AO95245-2, the advanced russetted tetraploid potato clone used as a parent and source of high tuber quality but susceptible to PVY, revealed patterns associated with PVY susceptibility (Ryadg absent) when tested with the same markers (RYSC3: no band; ADG2 BbvI: 270 bp and 85 bp bands) (Fig. 2a). At 20 days
a
M 1
2 3 4 5
6 7 8
9 10
- 321 bp
b
M 1
2 3 4 5
6 7 8
9 10
Statistical Analyses The ELISA results obtained 20 days and 40 days after artificial inoculation with PVY were tested for normality using the PROC UNIVARIATE statement of SAS (SAS Institute 2001). Chi-square tests for homogeneity were conducted to compare the ELISA results and visual PVY symptom scores (phenotype) between 20 days and 40 days after inoculation. Chi-square tests for a fixed ratio were used to fit the marker and ELISA scores to the segregation of a single dominant resistance allele (simplex) in a tetraploid with tetrasomic inheritance under chromosome (1:1) or chromatid (0.87:1) assortment models (Allard 1960). Regressions between traits were performed using the PROC REG statements of SAS (SAS Institute 2001).
- 355 bp - 270 bp - 85 b bp
Fig. 2 a Polymerase change Reaction (PCR) amplification products with marker RYSC3. Presence of a 321 bp product indicates association with PVY resistance. Absence of the band indicates association with PVY susceptibility. b Restriction products of marker ADG2 cut with the enzyme BbvI. Presence of an uncut product of 355 bp indicates association with PVY resistance. Successful digestion resulted in two bands, 270 bp and 85 bp (very faint) indicating association with PVY susceptibility. Samples from left to right: M: 100 bp DNA ladder, 1: water control, 2: OR00030-1 (PVY resistant parental clone), 3: AO95245-2 (PVY susceptible parental clone), 4–10: subset of the OR05030 full-sib tetraploid population
Am. J. Pot Res (2009) 86:304–314
309
after inoculation (DAI) with PVYO, both parental lines, OR00030-1 and AO95245-2, where classified as PVY resistant by ELISA (A405 nm values of 0.198 and 0.263, respectively; the resistance threshold value was 0.371) (Fig. 3a). At the phenotypic level, OR00030-1 and AO95 245-2 showed no symptoms of PVY infection. It was not until 40 DAI, that AO95245-2 was declared susceptible based on ELISA (A405 nm: 2.120) (Fig. 3b) while OR00 030-1 was still resistant (A405 nm: 0.149; the resistance threshold value was 0.285). The phenotypic evaluations at 40 DAI showed light mosaic symptoms in AO95245-2 (PVY susceptible) while OR00030-1 appeared to be completely healthy (PVY resistant). Of the 84 plants in the full-sib family OR05030 screened with marker RYSC3, 36 (class N1) produced a 321 bp band associated with resistance to PVY (Ryadg present), while the remaining 48 plants (class N0) showed no band, indicating PVY susceptibility (Table 2, Fig. 2a). A screening of the full-sib population OR05030 with ADG2 BbvI provided the same results: 36 plants showed a molecular marker pattern associated with PVY resistance (Ryadg present) (an undigested product of 355 bp) and 48 plants had a pattern
20 Days after inoculation
A Number of individuals
35
AO95245-2
30 25 20 15
OR00030-1
10 5 0 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0.90 1.00 2.00 3.00 4.00 Absorbance 405nm
B
40 Days after inoculation
Number of individuals
30 25
O OR00030-1 AO95245 2 AO95245-2
20 15 10 5 0 0.10 0.20 0.30 0.40 0.50 0.60 0.70 0.80 0.90 1.00 2.00 3.00 4.00 Absorbance 405nm
Fig. 3 a Distribution of absorbance values at 405 nm for the full-sib population OR05030 at 20 days after inoculation. OR00030-1 (PVY resistant parent, A405: 0.198) and AO95245-2 (PVY susceptible parent, A405: 0.263). The resistance threshold cutoff value was 0.371. b Distribution of absorbance values at 405 nm for the full-sib population OR05030 at 40 days after inoculation. OR00030-1 (PVY resistant parent, A405: 0.149) and AO95245-2 (PVY susceptible parent, A405: 2.120). The resistance threshold cutoff value was 0.285
associated with PVY susceptibility (Ryadg absent) (270 bp and 85 bp bands resulting from the digestion of the PCR ADG2 product with the enzyme BbvI ) (Table 2, Fig. 2b). The markers segregated at a ratio that fit the hypothesis for a single dominant gene; no significant deviations from a 1:1 [chromosome assortment, (χ2 =1.714, P=0.190)] or 0.87:1 [chromatid assortment, (χ2 =0.431, P=0.512)] were observed. This provided convincing evidence that OR000301, the PVY resistant parent, had simplex allelic configuration for the gene Ryadg as shown by markers linked to the trait. ELISA results for the OR05030 population at 20 and 40 DAI (Fig. 3a and b) showed bi-modal distributions. Since the parental lines were not properly classified with respect to PVY resistance at 20 DAI, we focused on results at 40 DAI. The segregation of PVY resistance based on ELISA at 40 DAI indicated the presence of a resistance gene in simplex configuration [1:1 ratio, χ2 =2.333, P=0.127; 0.87:1 ratio, χ2 =0.766, P=0.382)]. ELISA scores obtained at 20 and 40 DAI were significantly different (χ2 =4.667, P=0.031). At 40 DAI, more individuals fell in the PVY susceptible class (35 susceptible at 20 DAI vs 49 at 40 DAI) (Table 2). Similar results were observed when visual symptom scores obtained at 20 and 40 DAI were compared (χ2 =7.522, P=0.006), at 40 DAI, more individuals were declared PVY susceptible based on visual symptoms (22 susceptible at 20 DAI vs 45 at 40 DAI) (Table 2). Plants with questionable PVY symptoms were excluded from the calculations. Regression analysis between the markers linked to the Ryadg gene (RYSC3 and ADG2 BdvI) and ELISA values, and between the markers and visual virus expression scores at 20 DAI indicated that the markers explained 46% of the phenotypic variation that was observed by ELISA and 40% of the variation observed by visual observation of the symptoms (Table 2). At 40 DAI, the markers explained a larger proportion of the phenotypic variation (86% and 85%, respectively). Out of the 35 plants declared resistant by ELISA at 40 DAI (class X1) only one (2.9%) was scored as susceptible by the markers (N0, X1 at 40 DAI). Out of the 49 plants declared susceptible by ELISA at 40 DAI (class X0), two (4.1%) were scored as resistant based on molecular marker results (N1, X0 at 40 DAI). Overall, at 40 DAI, a 96.4% (81 of 84 plants) match (X1, N1 and X0, N0, bold numbers) was observed between the markers and ELISA scores (Table 2). The agreement between visual symptoms and marker data at 40 DAI (E1, N1 and E0, N0, bold numbers), excluding plants with questionable symptoms (E? class), was 96.8% (61 of 63 plants) (Table 2). Eighty plants out of 84 in the full sib family OR05030 produced tubers. Tuber-derived ELISA results matched ELISA results obtained at 40 DAI in 77 out of 80 cases (96.3%) (results not shown). From the three plants with disagreements, two that were PVY resistant in the mother
310
Am. J. Pot Res (2009) 86:304–314
Table 2 Comparison of molecular marker genotyping with ELISA and visual symptoms (phenotype) at 20 days and 40 days after inoculating the tetraploid full-sib population OR05030 with PVYO Test
Time (DAI)
ELISA
20
Phenotype
20
ELISA
40
Phenotype
40
Classa
Genotypic classb
Regression equation
R2
N1
N0
Total
X1 X0 Total E1 E0 E? Total X1 X0 Total
35 1 36 18 1 17 36 34 2 36
14 34 48 9 22 17 48 1 47 48
49 35 84 27 23 34 84 35 49 84
Y=0.29+0.68×
0.46
Y=0.29+0.66×c
0.40c
Y=0.02+0.92×
0.86
E1 E0 E? Total
17 1 18 36
1 44 3 48
18 45 21 84
Y=0.02+0.92×c
0.85c
Bold font indicates matches between the molecular marker results and results obtained using other testing procedures (listed on the first column) a
Classes are distinguished by absence (resistance, X1) or presence (susceptibility, X0) of virus detected by ELISA or by visual observation of virus symptom expression (E1 no PVY symptoms, resistance; E0 PVY symptoms, susceptibility; E? questionable symptoms)
b
Genotypic classes based on screenings with molecular markers RYSC3 and ADG2 BbvI: N1 allele associated with Ryadg (PVY resistance), N0 allele associated with the absence of Ryadg (PVY susceptibility) c
E? class was excluded from the calculations
plants produced PVY susceptible tubers and one PVY susceptible mother plant produced PVY resistant tubers. Overall, PVY susceptible plants produced PVY infected tubers and PVY resistant plants produced healthy tubers. To implement MAS for PVY resistance in our potato breeding program, progeny from ten full-sib families segregating for the Ryadg PVY resistant gene were planted as single hill units for field selection. Field selection was based on tuber shape and size resulting in very stringent selection pressure (1.1% selected) (Table 3). The parental lines, OR00030-1 and AOR00628-3, contained the PVY resistant gene Ryadg associated with PVY resistance introgressed from S. tuberosum ssp. andigena. Screening of the selected lines with the markers indicated that six out of 14 (42.9%) lines derived from crosses involving the OR00030-1 PVY resistant parent contained alleles associated with PVY resistance; five out of 15 (33.3%) lines derived from crosses involving the AOR00628-3 PVY resistant parent contained alleles associated with PVY resistance at the Ryadg locus. Overall, eleven out of 29 plants (37.9%) contained alleles associated with PVY resistance. The segregation ratios were not significantly different than 1:1 (progeny derived from OR00030-1: χ2 = 0.286 P=0.593; progeny derived from AOR00628-3: χ2 = 1.667, P=0.197; progeny derived from both PVY resistant
parents: χ2 =1.690, P=0.194) indicating simplex allelic configuration in both PVY resistant parents. The clones selected based on visual tuber observations and confirmed to contain alleles associated with Ryadg resistance will be evaluated in the field for agronomic, quality, and disease resistance traits in subsequent trials.
Discussion Since 1990, more than 40 major qualitative genes conferring resistance to important diseases and pests affecting potatoes (R-genes) have been genetically mapped; around 1/4 of them have been cloned and characterized. In addition to major genes, a substantial number of QRL (quantitative resistance loci) have also been mapped (modified from Simko et al. 2007). The validation and practical application of those discoveries in the form of MAS in potato breeding programs has been moving at a slower speed. Published examples of the use of molecular markers for MAS of disease/pest resistance are mainly limited to diploid material and a small number of genes i.e. Ns for PVS resistance (Marczewski et al. 2002); Ryadg for extreme resistance to PVY, Gro1 for resistance to G. rostochiensis, Rx1 for extreme resistance to PVX or Sen1 for resistance to
Am. J. Pot Res (2009) 86:304–314
311
Table 3 Full-sib families evaluated under field conditions as single hills in Powell Butte, OR, and numbers of selections containing markers associated with resistance to PVY (Ryadg) Family
Female
Malea
OR03145 OR04155 OR04158 OR04159 OR05004
AO95145-2 Premier Russet AO94007-1 R. Norkotah GemStar Russet
OR00030-1 OR00030-1 OR00030-1 OR00030-1 OR00030-1
GemStar Russet Premier Russet AO95245-2 R. Norkotah#3 PA97B3-2
AOR00628-3 AOR00628-3 AOR00628-3 AOR00628-3 AOR00628-3
Subtotal OR05005 OR05011 OR05036 OR05067 OR05093 Subtotal GrandTotal a
Number of individuals per family 151 165 198 106 55 675 58 98 510 658 665 1,989 2,664
Number of individuals selectedb
Number of selected individuals containing RYSC3 and ADG2 BbvI resistant allelesc
4 5 3 1 1
2 2 0 1 1
14 (2.1%) 2 2 6 3 2 15 (0.8%) 29 (1.1%)
6 (42.9%) 2 0 0 2 1 5 (33.3%) 11 (37.9%)
The male parents are PVY resistant
b
Single-hill selections were based on tuber appearance
c
Alleles associated with PVY resistance
potato wart (Gebhardt et al. 2006). Lately, markers tagging QTL’s conferring resistances to P. infestans, V. dahlia and V. albo-atrum have been developed and effectively tested on sizable tetraploid populations (reviewed by Simko et al. 2007). As more resistance/pest loci are tagged, it is expected that the application of MAS in the development of new potato cultivars will increase in importance. In MAS for PVY, results for classifying a selection as resistant or susceptible may be obtained when tissue (tubers, sprouts or leaves) is available for DNA extraction and subsequent PCR assays. The genetic distance between the molecular markers used and the gene of interest dictates the level of success of MAS for the trait under consideration. Screening progeny using PVY artificial inoculation (with infected aphids, grafting or mechanically) followed by ELISA can be used as an accurate selection method, but requires more time and is prone to some level of experimental error. For example, time of evaluation is critical as shown with our experiments comparing ELISA results at 20 and 40 DAI (Fig. 3a, b). Waiting 20 DAI was not enough time to classify the parental line AO95245-2 as PVY susceptible. Virus detection can also be plant genotypedependent, virus strain dependent and/or environmentallydependent (greenhouse temperature, humidity, etc). Mechanical inoculation is commonly used (Langham 2004) as a screening method and even though it does not represent aphid transmission that occurs in nature (Radcliffe and Ragsdale 2002), it works for controlled artificial inoculations. In our study, parental lines and additional susceptible
clones (Russet Burbank, susceptible to PVY, and Russet Norkotah, susceptible to PVY but asymptomatic) were properly classified using mechanical inoculations. Our study also confirms the difficulty of classifying clones as PVY resistant or susceptible based on visual evaluations and discourages this practice alone as a diagnostic method (Table 2). Visual observations should be accompanied by ELISA tests in order to confirm resistance or susceptibility to PVY. ELISA was more reliable than visual observation of symptoms (phenotype) for evaluating resistance to PVY; all individuals were declared as resistant or susceptible to PVY based on ELISA, but a relatively larger number of individuals (21 out of 84) presented questionable visual symptoms (E? phenotype class at 40 DAI) and were not assigned to either the resistant or susceptible classes based on visual observations of PVY symptoms (Table 2). If performing ELISA tests on a large number of individual is time/cost prohibitive (like for seed certification purposes) the recommendation would be to perform a first round of visual observations in which around 75% [(18+45)/84*100] of the plants (E1 and E0 phenotypic classes at 40 DAI) (Table 2) could be accurately classified as resistant or susceptible. On a second round, tissue should be collected from the plants with questionable symptoms (around 25%) in order to perform ELISA and declare the plants as susceptible or resistant to PVY. The previous recommendation could vary depending on the type of PVY host resistance present and on the genotypes under consideration. For example, if susceptible asymptomatic clones are present, the best way to detect
312
susceptible plants will be to collect tissue from all the plants and to perform ELISA due to the great challenge of performing visual assessments on this type of germplasm. In the case of evaluating populations segregating for Ryadg, molecular markers could be used to predict the response of the clones to the disease without the presence of the disease. Our results showed that the markers used in this study, RYSC3 and ADG2 BbvI (Kasai et al. 2000 and Sorri et al. 1999), may not be totally linked to the Ryadg gene, but they are close enough to justify their use as tools to identify PVY resistant clones. At 40 DAI with PVY, a 96.4% (81 of 84 plants) match (X1, N1 and X0, N0) was observed between the marker RYSC3 (same for ADG2 BbvI) and ELISA scores (Table 2). The discrepancies between marker and ELISA results may be due to escapes from inoculation, errors in ELISA or PCR assays, recombination between the markers and the Ryadg gene, and/or effect of time of evaluation. Even though both markers, provided the same results we recommend using both. The use of the marker developed by Sorri et al. (1999) was a good complement to confirm results from the dominant (presence/absence) marker developed by Kasai et al. 2000. The discrepancy rate (N1 X0 and N0 X1) between molecular markers and ELISA at 40 DAI was relatively low (3.6%, 3/ 84*100) (Table 2). The type I error (declaring individuals as PVY resistant when they are not) is of concern to us in order to avoid maintaining susceptible individuals in the program. If we consider artificial inoculation of PVY
Fig. 4 Proposed PVY-resistance selection scheme integrating marker-assisted selection (MAS) and conventional breeding. MAS would be applied to selected single hill clones retained following the first year of field evaluations. The selected lines would be classified as resistant or susceptible to PVY based on markers linked with the PVY resistance gene Ryadg. All lines would be evaluated again in the field. The PVY resistant clones with acceptable tuber appearance will continue in the cultivar development process and/or used as parental lines. Lines declared PVY susceptible would be discarded unless they have other outstanding traits
Am. J. Pot Res (2009) 86:304–314
followed by ELISA as a more reliable method, the type I error would represent individuals declared resistant to PVY based on molecular marker evaluations but declared susceptible to PVY based on ELISA (N1, X0), this percentage was 2.4% (2/847*100) in our experimental population OR05030 evaluated at 40 DAI (Table 2). The type II error (declaring individuals as PVY susceptible when they are not) is not as problematic since these would be normally discarded. The type II error would correspond to individuals declared susceptible to PVY based on molecular marker evaluations but declared resistant to PVY based on ELISA (N1, X0), this value is 1.2% in our experimental population OR05030 evaluated at 40 DAI (Table 2). As expected, PVY was transmitted to the tubers. Eighty plants out of 84 members of full-sib family OR05030 used for genetic studies produced tubers. Tuber-derived ELISA results matched foliar ELISA results from mother plants obtained 40 days after inoculation in 77 out of 80 cases (96.3%). There were two plants (2.5%) that were declared PVY resistant 40 DAI based on ELISA that produced tubers infected with PVY and there was one plant (1.3%) declared susceptible 40 days after inoculation that produced PVY resistant tubers. The disagreements could be due to technical problems or to biological reasons related with virus transmission to the new growths and to the tubers. The level of agreement between tuber-derived ELISA results and molecular marker results was 96.3% (32+45/
Hybridizations (PVY Res. x PVY Sus.)
Year 1 - Greenhouse
and TPS seedling production
Full-sib families Single hill selection stage
DNA analysis y PVY Res.
Retain
Laboratory - MAS
PVY Sus.
S l t d clones Selected l Four hills selection stage PVY Res.
Year 2 - First year in the field Visual selection
PVY Sus. Discard
Continue conventional breeding scheme Confirm PVY resistance
Year 3 - Second year in the field Visual selection
Am. J. Pot Res (2009) 86:304–314
80*100), almost the same as between ELISA performed at 40 DAI on the original OR05030 population and molecular markers (96.4%, ((34+47)/84*100)) (Table 2). None of the potato varieties released up to date by the Tri-State Program contain alleles associated with PVY resistance at the Ryadg and Rysto loci (Vales, personal communication). Thus, the incorporation of PVY resistance genes from S. tuberosum ssp. andigena (Ryadg) and S. stoloniferum (Rysto) sources should benefit our Potato Variety Development Program. The practical application of MAS for PVY resistance was shown (Table 3). By generating and testing more populations with a large number of individuals per population, the chances of generating PVY resistant clones that will end up being a cultivated potato variety will be greatly increased. In our proposed MAS program for PVY resistance (Fig. 4), fullsib lines derived from crossing susceptible and resistant PVY parents would be evaluated and selected in the field based on tuber type and shape. MAS would be applied to selected single hill clones retained following the first year of field evaluations. The selected lines would be classified as resistant or susceptible to PVY (presence or absence of the Ryadg gene) based on markers linked with the PVY resistance gene Ryadg. All clones selected at the single hill stage would be evaluated at the four hill level (second year in the field). The PVY resistant clones with acceptable tuber type and shape will continue in the cultivar development process for subsequent years of evaluation for agronomic, quality and disease resistant traits and/or used as parental lines in our recurrent selection program. Lines declared PVY susceptible (using markers) would be discarded unless they have other outstanding traits. By reducing the number of PVY susceptible lines that move to the next years of field evaluations using MAS for PVY resistance, the odds of generating PVY resistant potato varieties will increase. Before lines are advanced to a cultivar status, evaluations of the selected lines under artificial inoculation and/or under field conditions with high PVY pressure should be performed to confirm molecular marker results. An alternative MAS strategy to select PVY resistant lines earlier would require molecular marker evaluation of all true potato seed seedlings derived from crosses involving PVY resistant parents. This option would identify potential PVY resistant clones faster, but would not let us take into consideration other traits we are breeding for. The use of PVY resistant parental lines with multiple copies (duplex, triplex or quadruplex) of the PVY resistance gene is desirable in order to maximize the chances of obtaining PVY resistant lines within the full-sib progeny. We are in the process of developing these stocks utilizing MAS in tetraploid potato clones adapted to the Pacific NW of the USA. The PCR assays we use are not dosage
313
sensitive, so we depend on progeny testing to determine the number of resistant alleles present in a particular clone. Our study is specific to the use of extreme resistance to PVY from the S. tuberosum ssp. andigena source (Ryadg) against PVYO, the ordinary strain of this virus. The Ryadg gene has been shown to be non-strain specific providing durable resistance to several sources of (Mihovilovich et al. 1998), however in order to confirm non-strain specificity and durability, it will be necessary to test the resistant clones against all PVY strains including new and recombinant types and over multiple growing seasons. In a parallel study (Ottoman 2006), we have explored the use of PVY extreme resistance provided by S. stoloniferum (Rysto). Pyramiding of several genes for resistance to PVY (for example Ryadg and Rysto) in a parental line would also greatly enhance the development of PVY resistant clones. Marker-assisted selection would be the only way for tracking the presence of both major genes conferring extreme resistance to PVY. Further pyramiding with other disease/pest/quality genes or QTL would be highly advantageous. This has not yet been explored in depth in tetraploid potato breeding programs, but initial attempts using major gene-mediated pathogen resistance have demonstrated its feasibility (Gebhardt et al. 2006). Acknowledgments The Oregon Potato Commission and the USDA/ CSREES Special Potato Research Grant program provided financial support for this research. The authors thank Dr. Oscar Gutbrod for providing advice to assess visual PVY symptoms in the greenhouse. Thanks are extended to Kandy Marling, Eda Karaağaç, and several undergrad students for technical assistance.
References Allard, R.W. 1960. Inheritance in autopolyploids. In: Principles of plant breeding, 385–399. New York, USA: Wiley. Barker, H. 1996. Inheritance of resistance to potato viruses Y and A in progeny obtained from potato cultivars containing gene Ry: evidence for a new gene for extreme resistance to PVA. Theoretical and Applied Genetics 93: 710–716. Berger, P., and T. German. 2001. Biotechnology and resistance in potato viruses. In Virus and virus-like diseases of potatoes and production of seed-potatoes, eds. G. Loebenstein, et al., 341–363. Dordrecht/Boston/London: Kluwer Academic. Brown, C.R., and D.C. Corsini. 2001. Genetics and breeding of virus resistance: Traditional methods. In Virus and virus-like diseases of potatoes and production of seed-potatoes, eds. G. Loebenstein, et al., 323–340. Dordrecht/Boston/London: Kluwer Academic. Brunt, A.A. 2001. The main viruses infecting potato crops. In Virus and virus-like diseases of potatoes and production of seedpotatoes, eds. G. Loebenstein, et al., 65–67. Dordrecht/Boston/ London: Kluwer Academic. Bukovinszki, A., Z. Diveki, M. Csanyi, L. Palkovics, and E. Balazs. 2007. Engineering resistance to PVY in different potato cultivars in a marker-free transformation system using a ‘shooter mutant’ A-tumefaciens. Plant Cell Reports 26: 459–465. Chrzanowska, M. 1987. Nowe izolaty wirusa Y zagrazajace ziemniakom w Polsce. I Nasiennictwo 5–6: 8–11.
314 Cockerham, G. 1970. Genetical studies on resistance to potato viruses X and Y. Heredity 25: 309–348. deBokx, J.A., and H. Huttinga. 1981. Potato Virus Y. In Description of plant viruses, Vol. 242, eds. B.D. Harrison, and A.F. Murant. Wellesbourne, Warwick, UK: Commonwealth Mycological Institute, Kew and Association of Applied Biologist. Ellis, J., P. Dodds, and T. Pryor. 2000. Structure, function and evolution of plant disease resistance genes. Current Opinion in Plant Biology 3: 278–284. Franc, G.D. 2001. Seed certification as a virus management tool. In Virus and virus-like diseases of potatoes and production of seedpotatoes, eds. G. Loebenstein, et al., 407–420. Dordrecht/Boston/ London: Kluwer Academic. Gebhardt, C., D. Bellin, H. Henselewski, W. Lehmann, J. Schwarzfischer, and J.P.T. Valkonen. 2006. Marker-assisted combination of major genes for pathogen resistance in potato. Theoretical and Applied Genetics 112: 1458–1464. Gutbrod, O.A., and A.R. Mosley. 2001. Common seed potato certification schemes. In Virus and virus-like diseases of potatoes and production of seed-potatoes, eds. G. Loebenstein, et al., 421– 428. Dordrecht/Boston/London: Kluwer Academic. Hämäläinen, J.H., K.N. Watanabe, J.P.T. Valkonen, A. Arihara, R.L. Plaisted, E. Pehu, L. Miller, and S.A. Slack. 1997. Mapping and marker-assisted selection for a gene for extreme resistance Potato Virus Y. Theoretical and Applied Genetics 94: 192–197. Hämäläinen, J.H., V.A. Sorri, K.N. Watanabe, C. Gebhardt, and J.P.T. Valkonen. 1998. Molecular examination of a chromosome region that controls resistance to Potato Y and A potyviruses in potato. Theoretical and Applied Genetics 96: 1036–1043. Kasai, K., Y. Morikawa, V.A. Sorri, J.P.T. Valkonen, C. Gebhardt, and K.N. Watanabe. 2000. Development of SCAR markers to the PVY resistance gene Ryadg based on a common feature of plant disease resistance genes. Genome 43: 1–8. Kerlan, C., M. Tribodet, L. Glais, and M. Guillet. 1999. Variability of potato virus Y in potato crops in France. Journal of Phytopathology 147: 643–651. Langham, M.A.C. 2004. Mechanical inoculation of plant viruses. In Pathology: Concepts and laboratory exercises, eds. R.N. Trigiano, M.T. Windham, and A.S. Windham, 33–40. Boca Raton, FL: CRC. Marczewski, W., J. Hennig, and C. Gebhardt. 2002. The potato virus S resistance gene Ns maps to potato chromosome VIII. Theoretical and Applied Genetics 105: 564–567. McDonald, J.G., and R.P. Singh. 1996. Host range, symptomology, and serology of isolates of potato virus Y (PVY) that share properties with both the PVYn and PVYo strain groups. American Potato Journal 73: 309–315.
Am. J. Pot Res (2009) 86:304–314 Mihovilovich E., L.F. Salazar, F. Saguma, and M.W. Bonierbale. 1997–1998. Survey of the durability of extreme resistance to PVY derived from Solanum tuberosum subsp. andigena, CIP Program Report 1997–1998. Lima, Peru. 123–128. Missiou, A., K. Kalantidis, A. Boutla, S. Tzortzakaki, M. Tabler, and M. Tsagris. 2004. Generation of transgenic potato plants highly resistant to potato virus Y (PVY) through RNA silencing. Molecular Breeding 14: 185–197. Ottoman, R.J. 2006. Marker-assisted selection for resistance to potato virus Y. M.S. Thesis. Oregon State University, Corvallis, OR, USA. Radcliffe, E.B., and D.W. Ragsdale. 2002. Aphid-transmitted potato viruses: The importance of understanding vector biology. American Journal of Potato Research 79: 353–386. Riera-Lizarazu, O., M.I. Vales, E.V. Ananiev, H.W. Rines, and R.L. Phillips. 2000. Production and characterization of maize chromosome 9 radiation hybrids derived from an oat-maize addition line. Genetics 156: 327–339. Ross, H. 1986. Potato breeding: Problems and perspectives. In Advances in Plant Breeding, eds. J. Brandes, et al.. Berlin, Germany: Parey. Rykbost, K.A., D.C. Hane, P.B. Hamm, R. Voss, and D. Kirby. 1999. Effects of seedborne potato Virus Y on Russet Norkotah performance. American Journal of Potato Research 75: 91–96. SAS Institute. 2001 The SAS system for Windows v. 8.02. SAS Institute Inc. Cary, NC, USA. Simko, I., S. Jansky, S. Stephenson, and D. Spooner. 2007. Genetics of resistance to pests and diseases. In Potato biology and biotechnology advances and perspectives, eds. D. Vreugdenhil, et al., 117–155. Oxfort/Amsterdam: Elsevier. Sorri, V.A., K.N. Watanabe, and J.P.T. Valkonen. 1999. Predicted kinase3 a motif of a resistance gene analogue as a unique marker for virus resistance. Theoretical and Applied Genetics 99: 164–170. Stark, D.M., and R.M. Beachy. 1989. Protection against Potyvirus infection in transgenic plants: Evidence for broad spectrum resistance. Biotechnology 7: 1257–1262. Sutula, C.L., J.M. Gillett, S.M. Morrissey, and D.C. Ramsdell. 1986. Interpreting ELISA data and establishing the positive-negative threshold. Plant Disease 70: 722–726. Swieżyński, K.M. 1994. Inheritance of resistance to viruses. In Potato Genetics, eds. J.E. Bradshaw, and G.R. Mackay, 339–364. UK: CAB International Wallingford. Vidal, S., H. Cabrera, R.A. Andersson, A. Fredriksson, and J.P.T. Valkonen. 2002. Potato gene Y-1 is an N gene homolog that confers cell death upon infection with Potato Virus Y. American Phytopathological Society 15: 717–727. Weidemann, H.L. 1988. Importance and control of potato virus Yn (PVYn) in seed potato production. Potato Research 31: 85–94.
