Full Text Article - wjpr

World Journal of Pharmaceutical Research Abdul-Hassan et al.

World Journal of Pharmaceutical Research

SJIF Impact Factor 5.045

Volume 4, Issue 3, 141-155.

Research Article

ISSN 2277– 7105

PROMOTER -318C ˃T AND EXON-1 +49A˃G POLYMORPHISMS OF CTLA-4 GENE CONFER SUSCEPTIBILITY TO GRAVES' DISEASE IN IRAQI POPULATION Ismail A. Abdul-Hassan1*, Suad A. Saad2, Mayasah M. Khalid1 1

Genetic Engineering and Biotechnology Institute for Postgraduate Studies, University of Baghdad, Iraq. 2

Ministry of sciences and technology, Iraq.

ABSTRACT Article Received on 20 Dec 2014, Revised on 15 Jan 2015, Accepted on 08 Feb 2015

The present study was carried out in Genetic Engineering and biotechnology Institute- University of Baghdad during a period from November to May 2014, for detecting the association of -318C/T and +49A/G SNPs in CTLA-4 gene with the incidence of Graves’ disease

*Correspondence For

in Iraqi patients. Genomic DNA was extracted by using Geneaid DNA

Author

extraction kit from the whole blood; PCR-RFLP was used to detect the

Dr. Ismail A. Abdul-

-318C/T and +49A/G SNPs in CTLA-4 gene by using specific primers

Hassan Genetic Engineering and

and restriction enzymes (Tru9I and BbvI, respectively). The study

Biotechnology Institute

samples consisted of 40 patients with Graves’ disease who recruited

for Postgraduate Studies,

from

University of Baghdad,

apparently healthy individuals. This study aimed to evaluate possible

Iraq.

association between these polymorphisms in the CTLA-4 gene (-

,

Endocrinology and Diabetes Centre /Al-Kindy Hospital and 40

318C/T and +49A/G), and GD incidence in Iraqi population.The results showed no significant differences in the genotypes distribution of -318C/T and +49A/G (exon 1 between control and GD. Both -318C/T and +49A/G SNPs showed no association with GD incidence. Statistically significant for A/A homozygous normal (p ≤ 0.05), A/G heterozygous mutant

(p ≤ 0.01) but no significant differences in the genotype

GG homozygous mutant (p ≤ 0.5). The results also showed high GD incidence within the age group 31-50 years old with high prevalence in females than males, so that positive family history in GD was 24 (60%) out of 40 cases, the mean for the duration of disease in the patients was 4.77 years.

www.wjpr.net

Vol 4, Issue 3, 2015.

141

Abdul-Hassan et al.


KEYWORDS: Graves' disease, CTLA-4, -318C/T, +49A/G. INTRODUCTION Graves’ disease (GD) is a complex autoimmune thyroid disease, which is caused by excessive production of thyroid hormone and characterized by an enlarged thyroid gland, protrusion of the eyeballs, a rapid heartbeat and nervous excitability (Wen-Ling et al., 2010). As with some other autoimmune endocrine disorders, it is generally accepted that GD has a genetic basis. The majority of autoimmune endocrinopathies are inherited as complex genetic traits, with multiple genetic factors interacting with each other and with environmental factors, which ultimately confer disease susceptibility (Alvarez-Vazques et al., 2011). Several genetic loci have been implicated in the susceptibility to Graves disease. One of the associated genes is the cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) gene which consists of 4 exons and 3 introns. Yanagawa et al. (1997), Marron et al. (1997) and Donner et al. (1997) reported that there was an association between CTLA-4 and Graves' disease. The CTLA-4 gene is located on the long arm of chromosome 2q33 and belongs to the immunoglobulin superfamily. Since the CTLA-4 protein transmits an inhibitory signal to Tcells, it has a strong susceptibility in autoimmunity. One of the CTLA-4 gene polymorphisms is located on exon 1 +49, which causes a threonine to alanine substitution in codon 17 (codon 17 T/A). To date, the CTLA-4 +49A/G polymorphism has been studied in different and numerous groups in humans, and a potential association with GD has been found in many populations, such as Iranian (Esteghamati et al.,2009),Turkish (Sahin et al., 2005), Lebanese (Nakkash-Chmaisse et

al.,2004), Tunisian (

Kacem

et

al.,2001), south

Indian

(Veeramuthumari et al., 2011), Chinese Han (Zhao et al.,2010), Japanese (Yanagawa et al., 1997), Korians (Park et al., 2000), and Italian (Petrone et al., 2005). However, some results suggest that there is no association between CTLA-4 +49A/G polymorphism and GD in other populations, such as Thai (Kimkong et al., 2011), Taiwanese (Weng et al., 2005), Polish ( Frydecka et al., 2004) . Thus, the results are still inconsistent. Another problem is that these published studies only refer to a rather modest sample size that limits their significance. CTLA-4 protein is also implicated in autoimmune thyroid disease, and can downregulate T cell responses by two separate mechanisms. The first of these mechanism is CTLA-4mediated negative signaling in response to T-cell receptor activation (Lee et al., 1998); this requires the cytoplasmic tail of the CTLA-4 protein and can occur in the early stages of an immune response when expression of CTLA-4 and B7 is limited ( Carreno et al., 2000).

www.wjpr.net

Vol 4, Issue 3, 2015.

142

Abdul-Hassan et al.


The second mechanism operates through cell surface competition between CTLA-4 and CD28 for B7 binding, depends on the levels of surface expression of CTLA-4, and can occur in late stages of the immune response when there is increased expression of B7 and CTLA-4. Binding of B7 to CTLA-4 leads to termination of the immune response via limitation of CD28-mediated signaling and T cell apoptosis (Carreno et al., 2000). Three sequence markers located in the CTLA-4 gene have been demonstrated to be associated with GD (Braun et al., 1998; Donner et al., 1997; Yanagawa et al., 1995). The first marker is located in the 3´ untranslated region (UTR) of the CTLA-4 gene, whereas the other two are SNP’s (single nucleotide polymorphisms). One SNP is located in the promoter region (-318 C/T), and the other is an A/G transition at position 49 of the coding region, resulting in an alanine/threonine polymorphism. The association between GD and the CTLA-4 3´ UTR microsatellite and A/G +49 SNP (rs 231775) has been described in several populations with different ethnic backgrounds. Therefore, the aim of this study was to investigate the association between two common SNPs (-318C/T and +49A/G ) within the CTLA-4 gene and the susceptibility to Graves' disease in Iraqi population. MATERIALS AND METHODS This study was conducted during the period from November to May 2014 at University of Baghdad / Institute of Genetic Engineering and Biotechnology for Postgraduate Studies. The study population consisted of 40 subjects with Graves’ disease different chief complaints and clinical features which refer to disorder of thyroid functions, were selected from those attending the Centre of Endocrinology and Diabetes - Al-Kindy Hospital. The age of these patients ranged from >20 - 60 years.

The control group consisted of 40 apparently healthy individuals where their age and sex nearly similar to the patients and have no history of any thyroid disorders (from the friends and relatives). The samples were collected from venous blood samples (5 ml) from both patient with Graves’ disease and apparently healthy persons. DNA was extracted from whole blood samples by using Geneaid DNA Extraction kit (Geneaid, Taiwan). The DNA concentration of samples were estimated by using nanodrop by putting 1µl of the extracted DNA in the machine to detect concentration in ng/µL and the purity detected by

www.wjpr.net

Vol 4, Issue 3, 2015.

143

Abdul-Hassan et al.


noticing the ratio of optical density (OD) 260/280 nm to detect the contamination of samples with protein. The accepted 260/280 ration for pure DNA was between 1.7-1.9 (Sambrook and Russell, 2001). After genomic DNA extraction, agarose gel electrophoresis was adopted to confirm the presence and integrity of the extracted DNA. PCR was performed using specific primers. primer pairs were supplied by Bioneer Company as a lyophilized product of different picomols concentrations. Lyophilized primer was dissolved in a free DNase/RNase water to give a final concentration of (100 pmol/μl) (as stock solution) to prepare 10μM concentration as work primer resuspended 10 pmol/μl in 90 μl of deionized water to reach a final concentration 10μM. The sequences of these primers are listed in Table 1. Table 1. sequences of primers used for detection of exon 1 (+49) and promoter region (318) SNPs in CTLA-4 gene in this study. Primers

Sequence of primers

Promoter -318C/T Forward 5'-AAATGAATTGGACTGGATGGT-3' Reverse 5'-TTACGAGAAAGGAAGCCGTG-3' SNP+49A/G Forward 5'-GCTCTACTTCCTGAAGACCT-3' Reverse 5'-AGTCTCACTCACCTTTGCAG-3' *Fan et al., 2004

PCR Referance Product Size 247bp

*

162bp

**

**Jung et al., 2009 Genotyping SNP-318 T/C in promoter PCR was carried out in a total volume of 25 μl, the reaction components were as described in Table 2, and then PCR eppendroff

tubes were then placed in PCR device and PCR

amplification was started according to the program described in Table 3.Then PCR product was detected as 247 bp on 2% agarose gel for one hour and were visualized by ethidium bromide staining, by used 50 bp DNA ladder. PCR fragments with thymine at position -318 were cut into three fragments (21, 96 and 130bp), whereas fragments with cytosine at the same position only had the restriction site at 21and 226 bp. Then PCR products were digested with 0.5 U Tru9I enzymes for overnight at 60 ºC as described in Table 4. The digested products were separated on 3 % agarose gel and

www.wjpr.net

Vol 4, Issue 3, 2015.

144

Abdul-Hassan et al.


were visualized by ethidium bromide staining. Both 96 and 130 bp represent TT genotype, 21, 96 130, and 226 bp represent TC genotype while 21 and 226 bp only represent CC genotype. Table 2. PCR reaction components for amplification of CTLA-4 SNP-318 T/C . Component PCR pre Mix PCR pre Mix (promega )(Ready-to use):TaqDNA polymerase ,dNTPs, MgCl2 and reaction buffer (pH 8.5) Forward primer reverse primer DNA template D.W Total volume

Quantity (μl ) 12.5 1 1 4 6.5 25

Table 3. PCR amplification program of CTLA-4 SNP -318 T/C. Step Initial denaturation Denaturation Annealing Extension Final extension

Temperature (°C)

Time

No. of Cycles

95

2 min.

1

94 60 72 72

40 sec. 45 sec. 30 sec. 2 min.

40 1

Table 4. Reaction component for Tru9I enzyme digestion. Component PCR product(247bp) Tru9I Enzyme Buffer D.W Total volume

Component of one sample (μl ) 10 µl 0.5 µl 5 µl 4.5 µl 20 µl

SNP +49 A/G in exon 1 PCR was carried out in a total volume of 20 μl, the reaction components were as described in Table 5, and then PCR eppendroff

tubes were then placed in PCR device and PCR

amplification was started according to the program described in Table 6.Then PCR product was detected as 162 bp on 2% agarose gel for one hour and were visualized by ethidium bromide staining, by used 50 bp DNA ladder. Then PCR products were digested with 0.5 U BbvI enzyme for overnight at 37 ºC as described in Table 7. The digested products were separated on 3.5 % agarose gel and were visualized by ethidium bromide staining. Only 162 bp represent GG genotype , 74 and 88 bp represent AA genotype , 74 , 88 and 162 bp represent AG genotype .

www.wjpr.net

Vol 4, Issue 3, 2015.

145

Abdul-Hassan et al.


Table 5. PCR reaction components for amplification of CTLA-4 SNP +49 A/G . Component Quantity (μl ) PCR pre Mix PCR pre Mix (promega )(Ready-to use):TaqDNA polymerase ,dNTPs, MgCl2 and 10 reaction buffer (pH 8.5) Forward primer 1 reverse primer 1 DNA template 3 D.W 5 Total volume 20 Table 6. PCR amplification program of CTLA-4 SNP +49 A/G Step Initial denaturation Denaturation Annealing Extension Final extension

Temperature (°C) 94 94 60 72 72

Time 4 min. 30 sec. 45 sec. 30 sec. 7 min.

No. of Cycles 1 30 1

Table 7. Reaction component for BbvI enzyme digestion. Component PCR product(162bp) BbvI Enzyme Buffer D.W Total volume

Component of one sample (μl ) 10 µl 0.5 µl 5 µl 4.5 µl 20 µl

Sequencing Positive samples in PCR-RFLP analysis for SNP +49 A/G in exon1 were sent for sequencing. Amount of 15µl of PCR product for each sample were sent and 25 µl from the forward primer. The result of the sequence analysis was analyzed by the NCBI according to the refsequence NG_011502.1. Statistical Analysis The Statistical Analysis System- SAS (2012) was used . Chi-square test was used to significant compare between percentage and Odds ratio in this study.

www.wjpr.net

Vol 4, Issue 3, 2015.

146

Abdul-Hassan et al.


RESULTS AND DISCUSSION The -318 T/C SNP in promoter region of CTLA-4 gene PCR was used for amplify the targeted fragment which specified by using specific primers. The fragment size amplified that flanking the -318 T/C SNP was 247 bp in the promoter region of CTLA-4 gene as shown in figure 1.

Figure 1: PCR product (247 bp) of -318T/C SNP visualized under UV light after staining with ethidium bromide. The electrophoresis was on 2% agrose gel at 5 volt/cm for 2 hours. DNA ladder=50 bp; NC=negative control. The CTLA-4 gene promoter polymorphism at position – 318 was defined using PCR-RFLP with Tru9I restriction enzyme. The targeted contain two restriction sites for Tru9I enzyme and the studied SNP (-318T/C) found in one of these two sites (TTAA). PCR fragments with thymine at position -318 were cut into three fragments (21, 96 and 130 bp),whereas fragments with cytosine at the same position only had the restriction site at 21 bp (Figure 2).

Figure 2. PCR-RFLP analysis of the Tru9I digest of the PCR product that contains position – 318 ( promoter region ) of the CTLA-4 gene separated on a 3.5% agarose gel. DNA ladder = 50 bp, NC = negative control, TT = wild-type homozygous ; TC = heterozygous mutant; CC = homozygous mutant.

www.wjpr.net

Vol 4, Issue 3, 2015.

147

Abdul-Hassan et al.


The distribution of genotype and allele frequency at -318 site of CTLA-4 gene promoter presented in Table 8. As shown in Table 8, there are equal percentages in patients with Graves' disease group and apparently healthy subjects group as related with genotypes: 0% for normal (TT), 10% for heterozygous mutant (TC) and 90% for homozygous mutant (CC). Allele frequencies for T and C were 4/80 and 76/80 ,respectively. Table 8. The genotypes and alleles frequency at position -318 in promoter region of CTLA-4 gene in Iraqi patients with Graves' disease and apparently healthy controls. Promoter region Control group Graves' disease -318T˃C (n=40) group (n=40) Genotype frequency, n (%) TT 0 (0%) 0 (0%) TC 4 (10%) 4 (10%) CC 36 (90%) 36 (90%) Allele frequency, n (%) T 4 4 C 76 76 Association studies using the – 318T/C polymorphism have been inconsistent and have produced controversial results, with some studies reporting a disease association and others suggesting no association (Vaidya et al., 2003). As related with -318T/C SNP, the results in this study supported by the results of Kacem et al. (2001) in Tunisian patients with Graves' disease who found that the frequencies of individuals with -318 C/C, C/T, and T/T genotypes were 91, 9, and 0% in patients with Graves' disease and 93.2, 6.8, and 0% in controls, respectively. The absence of the T/T genotype in this study was not surprising. Indeed, T/T genotype frequencies in other populations are not significantly different from zero (Gonzalez-Escribano et al., 1999). Some populations show an association between -318 SNP of CTLA-4 gene and Graves’ disease (Park et al., 2000), while others do not (Kouki et al., 2002; Vaidya et al., 2003; Zhang et al.,2006). Pastuszak-Lewandoska et al. (2013) found a statistically significant association between -318 CT genotype, as well as the presence of T allele, and autoimmune thyroid diseases. They observed a higher frequency of CT genotype and T allele in patients with Graves' disease. However, in some populations (Canadian, German, Slovene) an excess of CC genotype in Graves' disease patients was found (Braun et al., 1998; Zaletel et al., 2006).

www.wjpr.net

Vol 4, Issue 3, 2015.

148

Abdul-Hassan et al.


Our results are in agreement with many reports (Kacem et al., 2001; Kouki et al., 2002; Vaidya et al., 2003; Zhang et al.,2006), while disagree with others (Braun et al., 1998; Park et al., 2000; Zaletel et al., 2006; Pastuszak-Lewandoska et al., 2013). The polymorphism in the promoter region of the CTLA-4 gene may play a role in expression of the CTLA-4 receptor in T cells. It can activate this receptor as a regulatory key to suppress the immune response induced, to inhibit transmission to T cells and interaction of these cells with antigen-acceptor cells. The +49 A/G SNP (g.5206A˃G) in exon1 of CTLA-4 gene PCR was used for amplify the targeted fragment which specified by using specific primers. The fragment size amplified that flanking the +49 position in exon 1 of the CTLA-4 gene was 162 bp as shown in figure 3.

Figure 3: PCR product (162 bp) of +49A˃G SNP visualized under UV light after staining with ethidium bromide. The electrophoresis was on 2% agrose gel at 5 olt/cm for 2 hours. DNA ladder=50 bp; NC=negative control. The CTLA-4 gene polymorphism at position +49 (exon1) was defined using PCR-RFLP with BbvI restriction enzyme. The targeted contain one restriction site for BbvI enzyme and the studied SNP (+49A˃G) found within the enzyme target sequence (GCAGC). PCR fragments with adenine at position +49 were cut into two fragments (74 and 88 bp),whereas fragments with guanine at the same position remain without cutting (162 bp) (Figure 4). As shown in figure 4, the AA genotype carriers had two fragments (74 and 88 bp), while AG genotype carriers ( heterozygous mutant) had three fragments (74, 88 and 162 bp) and the GG genotype carriers ( homozygous mutant) had one fragment (162 bp) because both sequences

www.wjpr.net

Vol 4, Issue 3, 2015.

149

Abdul-Hassan et al.


of restriction sites for BbvI in the DNA of target fragment had changed due to single nucleotide transition in the two strands of DNA.

Figure 4. PCR-RFLP analysis of the BbvI digest of the PCR product that contains position 5206 of the CTLA-4 gene ( Thr +49 Ala substitution, rs231775) separated on a 3.5% agarose gel.DNA ladder= 25 bp; NC = negative control, GG = homozygous mutant ( 74 bp+ 88 bp), AG= heterozygous mutant ( 74 bp+ 88 bp+ 162 bp) and AA = wild type homozygous ( 162 bp) . The results of genotypes and allele frequencies distributions of +49A/G SNP of CTLA-4 gene between patients with Graves' disease and apparently healthy controls are shown in Table 9. The AA genotype frequency was significantly higher in patients with Graves' disease compared with that of apparently healthy controls (65 versus 52%, respectively, OR=0.685, X2=5.028, p˂0.05). The heterozygous (AG) genotype frequency was significantly lower in patients with Graves' disease when compared with that of apparently healthy controls ( 22.5 versus 42.5%, respectively, OR=0.893, X2=7.250,p˂0.05). The odd ratio value for AG genotype indicate that the lower percentage of AG genotype in this study may represent a risk factor for the incidence of Graves' disease. There is no significant difference in GG genotype frequency between patients with Graves' disease and apparently healthy subjects in this study. Moreover, there is approximately equal percentages between patients with Graves' disease and controls as related with A and G allele frequencies.

www.wjpr.net

Vol 4, Issue 3, 2015.

150

Abdul-Hassan et al.


Table 9: The genotypes and alleles frequency at position 49 in exon 1 of CTLA-4 gene in Iraqi patients with Graves' disease and apparently healthy controls. Thr +49 Ala AA AG GG A G

Control group Graves' disease OR (n=40) group (n=40) Genotype frequency, n (%) 21 (52.5%) 26 (65%) 0.685 17 (42.5%) 9 (22.5%) 0.893 2 (5%) 5 (12.5%) 0.078 Allele frequency, n (%) 0.74 0.76 0.26 0.24

X2 5.028 * 7.250 * 2.363 NS

Over the last decade, several authors have reported an association between the A/G +49 SNP marker and Graves’ disease in different populations with distinct ethnic backgrounds (Chu et al., 2011). In Spanish population, Alvarez-Vazques et al. (2011) found that the +49 A/G SNP of the CTLA-4 gene is related to the development of Graves' disease and they found that the frequency of the G allele was higher in the Graves' disease group than in the control group, also, the frequency of the GG genotype was significantly higher in patients with Graves' disease than in the controls. These results are disagree with the results of the present study as related with the frequency of GG genotype and G allele. In Polish population, Frydecka et al. (2004) found no significant differences in the frequencies of the AA, AG and GG genotypes at position A+49G between patients with Graves' disease and controls. These results are in agreement with the results of this study as related with GG genotype, whereas, disagree with the present results as related with AA and AG genotypes. In Iran, Esteghamati et al. (2009) found that the frequency of the G allele at position +49 was significantly higher in patients with Graves' disease than in the control group (27.1 versus 15%, respectively), while in the present study there were no significant differences between patients with Graves' disease and controls as related with G allele ( 24 versus 26%, respectively). In Lebanese population, Nakkash-Chmaisse et al. (2004) found a significant increase in allele and genotype frequencies in patients with Graves' disease compared to control. These results suggest that the CTLA-4 gene might play a role in the development of Graves' disease in the Lebanese population. These results are agree with the results of this study as related with AA genotype frequencies that were 52.5 and 65% for control group and patients with Graves' disease group, respectively. In contrast, the frequencies of AG genotype in this study were 42.5 and 22.5% for control group and patients with Graves' disease group, respectively. Bednarczuk et al. (2003) found that allele G and GG genotype were significantly increased in Caucasian patients with Graves' disease ( 48 and 25%, respectively) and in Japanese patients with

www.wjpr.net

Vol 4, Issue 3, 2015.

151

Abdul-Hassan et al.


Graves' disease ( 69 and 47%, respectively) compared with control groups. These results are disagree with the results of the present study. CTLA-4 exon1 polymorphism analysis showed a significant increase of AA homozygous individuals among Tunisian patients with Graves ' disease ( 21.5 versus 12.7%) ( Kacem et al., 2001). These results are in accordance with our results as related with AA genotype ( 65 versus 52.5%). The A+49G SNP ( g.5206 A˃G mutation) of CTLA-4 gene (exon1) was reported as being associated with Graves' disease in Caucasians ( Yanagawa et al., 1995), Japanese ( Yanagawa et al., 1997), Koreans (Kouki et al., 2000), Tunsians ( Kacem et al., 2001 ) and South Indians ( Veeramuthumari et al., 2010). Positive samples in PCR-RFLP analysis for SNP +49 A/G in exon1 were confirmed by sequence analysis as shown in figure 5.

Query 9

TGAACCTGGCTGCCAGGACCTG 68 ||||||||||| ||||||||||

Subject 5157 TGAACCTGGCTACCAGGACCTG 5216

Figure.5:

G.5206 A>G Rs 231775 Electropherogram depicting the 5206 A>G position (Thr +49 Ala) and its

flanks. REFERENCES 1. Alvarez-Vazques, P. ; Constenla, L.; Carcia-Mayer, R.V. Larrange, A. and Valverde, D. 2011. Association of CTLA-4 gene polymorphism with ophthalmopathy of Graves' disease in a Spanish population. Int. J. Endocrinol. Metab, 9(3): 397-402. 2. Bednarczuk, T.;Hiromatsu ,Y.; Fukutani ,T.; Jazdzewski, .;Miskiewicz, P.; Osikowska, M.; and Nauman, J. 2003. Association of cytotoxic

T-lymphocyte-associated antigen-4

(CTLA-4) gene polymorphism and non-genetic factors with Graves’ ophthalmophathy in European and Japanese populations. European J. of Endocrine, 148: 13-18.

www.wjpr.net

Vol 4, Issue 3, 2015.

152

Abdul-Hassan et al.


3. Braun, J., Donner, H., Siegmund, T., Walfish, P.G., Usadel, K.H., Badenhoop ,K. 1998. CTLA4 promoter variants in patients with Graves’ disease and Hashimoto’s thyroiditis. Tissue Antigens, 51(5): 563-566. 4. Carreno, B.M., Bennett ,F., Chau, T.A., Ling ,V., Luxenberg, D., Jussif, J., et al. 2000. CTLA4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression. J Immunol, 165(3): 1352-1356. 5. Chu, X., Pan, C.M., Zhao, S.X., Liang, J., Gao, G.Q., Zhang, X.M., et al. 2011. A genome-wide association study identifies two new risk loci for Graves’ disease. Nat Genet, 43(9): 897-901. 6. Donner, H.; Rau, H.; Walfish, P.G. et al. 1997. CTLA4 alanine-17 confers genetic susceptibility to Graves' disease and to type 1 diabetes mellitus. J. Clin. Endocrinol. Metab, 82: 143-146. 7. Esteghamati, A.; Khalilzadeh, O.; Mobarra, Z.; et al. 2009. Association of CTLA-4 gene polymorphism with Graves' disease and ophthalmopathy in Iranian patients. Eur. J. Intern. Med, 20: 424-428. 8. Fan, L. , Tu, X., Cheng, Q. , Zhu, Y., Feltens, R., Pfeiffer, T., Zhong, R. 2004. Cytotoxic T lymphocyte associated antigen-4 gene polymorphisms confer susceptibility to primary biliary cirrhosis and autoimmune

epatitis in Chinese population. World Journal of

Gastroenterology, 10(20): 3056-3059. 9. Frydecka, I., Daroszewski, J., Suwalska, K., et al 2004. CTLA-4 (CD152) gene polymorphism at position 49 in exon 1 in Graves' disease in a Polish population of the Lower Silesian region. Arch Immunol Ther Exp (Warsz), 52: 369-374. 10. Gonzalez-Escribano, M. F., R. Rodriguez, A. Valenzuela, A. Garcia,J. R. Garcia-Lozano, and A. Nunez-Roldan. 1999. CTLA-4 polymorphisms in Spanish patients with rheumatoid arthritis. Tissue Antigens, 53: 296. 11. Jung, M.H., Yu, J., Shin, C.H., Suh, B.K., Yang, S.W. and l Lee, B.C. 2009. Association of Cytotoxic T Lymphocyte Antigen-4 Gene Polymorphisms and HLA Class II Alleles with the Development of Type 1 Diabetes in Korean Children and Adolescents. J Korean Med Sci, 24: 1004-1009. 12. Kacem, H.; Bellassoued, M.; Bougacha-Elleuch, N.; Abid, M. and Ayadi, H. 2001. CTLA-4 gene polymorphisms in Tunisian patients with Graves' disease. Clin. Immunol, 101: 361-365. 13. Kimkong, I.; Nakkuntod, J.; Sae-Ngow, S.; Snabboon, T.; Avihingsanon, Y. and Hirankarn, N. 2011. Association between CTLA-4 polymorphisms and the susceptibility

www.wjpr.net

Vol 4, Issue 3, 2015.

153

Abdul-Hassan et al.


to systemic lupus erythematosus and Graves' disease in Thai population. Asian Pac. J. Allergy Immunol, 29: 229-235. 14. Kouki ,T., Sawai, Y., Gardine, C.A., Fisfalen, M.E., Alegre, M.L. and DeGroot, L.J. 2000. CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves’ disease. Journal of Immunology, 165: 6606–6611. 15. Kouki, T., Gardine, C.A., Yanagawa, T., Degroot, L.J. 2002. Relation ofLee, S., Scherberg, N., DeGroot, L.J. 1998. Induction of oral tolerance in human autoimmune thyroid disease. Thyroid, 8(3): 229-234. 16. Marron, M.P.; Raffel, L.J.; Garchon, H.J.; et al. 1997. Insulin-dependent diabetes mellitus (IDDM) is associated with CTLA4 polymorphisms in multiple ethnic groups. Hum. Mol. Genet, 6: 1275-1282. 17. Nakkash-Chmaisse, H.; Makki, R.F.; Abdelhamid, E.; Fakhoury, H.; Salti, N.N. and Salti, I. 2004. CTLA-4 gene polymorphism and its association with Graves' disease in the Lebanese population. Eur. J. Immunogenet, 31: 141-143. 18. Park, Y.J.; Chung, H.K.; Park, D.J.; Kim, W.B.; Kim, S.W.; Koh, J.J. and Cho, B.Y. 2000. Polymorphism in the promoter and exon 1 of the cytotoxic T lymphocyte antigen-4 gene associated with autoimmune thyroid disease in Koreans. Thyroid, 10: 453-459. 19. Pastuszak-Lewandoska, D., Domańska, D., Rudzińska, M., Bossowski, A. et al., 2013. CTLA-4 polymorphisms (+49 A/G and -318 C/T) are important genetic determinants of AITD susceptibility and predisposition to high levels of thyroid autoantibodies in Polish children —preliminary study. Acta Biochimica Polonica, 60(4): 641-646. 20. Petrone, A.; Giorgi, G.; Galgani, A. et al. 2005. CT60 single nucleotide polymorphisms of the cytotoxic T-lymphocyte-associated antigen-4 gene region is associated with Graves' disease in an Italian population. Thyroid, 15: 232-238. 21. Sahin, M.; Erdogan, M.F. and Erdogan, G. 2005. Cytotoxic T lymphocyte-associated molecule-4 polymorphisms in Turkish Graves' disease patients and association with probability of remission after antithyroid therapy. Eur. J. Intern. Med, 16: 352-355. 22. Sambrook, J. and Russel, D. (2001). Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. 23. SAS. (2012). Statistical Analysis System, User's Guide. Statistical. Version 9.1th ed. SAS. Inst. Inc. Cary. N.C. USA. 24. three polymorphisms of the CTLA-4 gene in patients with Graves’disease. J Endocrinol Invest, 25: 208–213.

www.wjpr.net

Vol 4, Issue 3, 2015.

154

Abdul-Hassan et al.


25. Vaidya, B., Oakes, E.J., Imrie, H., Dickinson, A.J., Perros, P., Kendall-Taylor,P., Pearce, S.H. 2003. CTLA4 gene and Graves’ disease: association of Graves’ disease with the CTLA4 exon 1 and intron 1 polymorphisms, but not with the promoter polymorphism. Clin Endocrinol (Oxf), 58: 732–735. 26. Veeramuthumari, P.; Isabel ,W. and Kannan, K. 2010. A Study on the Level of T3, T4, TSH and the Association of A/G Polymorphism with CTLA-4 Gene in Graves’ Hyperthyroidism among South Indian Population. J Clin Biochem, 26(1): 66–69. 27. Veeramuthumari, P.; Isabel, W. and Kannan, K. 2011. A Study on the level of T(3), T(4), TSH and the association of A/G polymorphism with CTLA-4 gene in Graves' hyperthyroidism among South Indian population. Ind. J. Clin. Biochem, 26: 66-69. 28. Weng, Y.C.; Wu, M.J. and Lin, W.S. 2005. CT60 single nucleotide polymorphism of the CTLA-4 gene is associated with susceptibility to Graves' disease in the Taiwanese population. Ann. Clin. Lab. Sci, 35: 259-264. 29. Wen-Ling, L.; Rong-Hsing, C.; Hui-Ju, L.; Yu-Huei, L.; Wen-Chi, C.; Yuhsin, T.; Lei, W. and Fuu-Jen, T. 2010. Toll-like receptor gene polymorphisms are associated with susceptibility to graves’ ophthalmopathy in Taiwan males. BMC Med Genet, 11: 154. 30. Yanagawa, T., Ito, K., Kaplan, E.L., Ishikawa, N., DeGroot, L.J. 1995. Absence of association between human spumaretrovirus and Graves’ disease. Thyroid , 5 :379-382. 31. Yanagawa, T.; Taniyama, M.; Enomoto, S.; Gomi, K.; Maruyama, H.; Ban, Y. and Saruta, T. 1997. CTLA4 gene polymorphism confers susceptibility to Graves' disease in Japanese. Thyroid, 7: 843-846. 32. Yanagawa, T.; Taniyama, M.; Enomoto, S.; Gomi, K.; Maruyama, H.; Ban, Y. and Saruta, T. 1997. CTLA4 gene polymorphism confers susceptibility to Graves' disease in Japanese. Thyroid, 7: 843-846. 33. Zaletel, K., Krhin, B., Gaberscek, S., Hojker, S. 2006. Thyroid autoantibody production is influenced by exon 1 and promoter CTLA-4 polymorphisms in patients with Hashimoto’s thyroiditis. Int J Immunogenet, 33: 87–91. 34. Zhang, Q., Yang, Y., Lv, X. 2006. Association of Graves’ disease and Graves’ophthalmopathy with the polymorphisms in promoter and exon 1 of cytotoxic T lymphocyte associated antigen-4 gene. J Zhejiang University-Sci B, 7(11): 887–891. 35. Zhao, S.X.; Pan, C.M.; Cao, H.M. et al. 2010. Association of the CTLA4 gene with Graves' disease in the Chinese Han population. PloS One, 5: e9821.

www.wjpr.net

Vol 4, Issue 3, 2015.

155