Functional interaction between the integrin antagonist neutrophil ...

Vol. 269, No. 42, Issue of October 21, PP. 26419-26423,1994 Printed in U.S.A.

Tm JOURNAL OF BIOLOGICAL CWISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Functional Interaction between the Integrin Antagonist Neutrophil Inhibitory Factor and the I Domain of CDllb/CDl8* (Received for publication, July 25, 1994, and in revised form, August 19, 1994)

Paul J. MuchowskiSSI, Li ZhangQn,Eric R. ChangS, Howard R. SouleS, Edward F. Plow, and Matthew MoyleSll From $Corvas International, Znc., Sun Diego, California 92121 and the llCenter for Thrombosisand Vascular Biology, Department of Molecular Cardiology, the ClevelandClinic Foundation, Cleveland, Ohio44195

Neutrophil inhibitory factor ( N I F ) is a hookwormderived glycoprotein ligand of the integrin CDllbl CD18 that inhibits human neutrophil function (Moyle, M., Foster, D. L., McGrath, D. E.,Brown, S. M., Laroche, Y., De Meutter, J., Stanssens, P., Bogowitz, C. A, Fried, V. A, Ely, J. A, Soule, H. R., and Vlasuk, G. P. (1994)J. Biol. Chem. 269,10008-10015). Here, we present evidence that recombinant MF (rNIF) associates with the -200-amino acid residue I domain of CDllblCD18 and that this interaction is essential for inhibition of neutrophil function by NIF. First, radiolabeled rNIF binds to a recombinant glutathione S-transferase fusion protein that interaccontains the CDllbI domain. This high affinity tion has a partial dependence on divalent cations. The association of rNIF with the CDllbI domain is specific because lZSI-rNIF does not bind either a glutathione Stransferase fusion protein that contains the I domain of the integrin CDlldCDl8 orrecombinant glutathione Stransferase without the I domain. Second, the CDllb I domain fusionprotein effectively competes with CDllbl CD18 on human neutrophils for lzsI-rNIF binding. Third, the CDllbI domain fusionprotein blocks the inhibition of certain neutrophil functions by rNIF, including adhesion of neutrophils to human endothelial cell monolayers andadhesion-dependentrelease of hydrogen peroxide fromneutrophils. Specificity is demonstrated by the inability of the CDllaI domain fusionprotein to block either rNIF binding to neutrophils or rMF activity. Fourth, rMF blocks the interaction between neutrophils and fibrinogen, a CDllblCDlS ligand that is also thought to bind the I domain of CDllb. In contrast, rNIF does not appear to block the binding of factor X to CDllblCD18 on neutrophils. These results suggest that CDllb/CDl8 has multiple distinct binding sites for its cognate ligands, including,but not limited to, the I domain. NIF interferes with the binding of a subset of these CDllblCD18 ligands in a highly selective manner. The leukocyte integrin CDllb/CD18(Mac-1, aM&,CR3) is an adhesive cell-surface receptor that plays a central role in the biological function of human neutrophils, including their migration toward sitesof infection and phagocytosis of opsonized microorganisms (1,2). Several ligands have been identified for

* This work was supported in part by National Institutes of Health Grant HL-38292. The costs of publication of this article were defrayed in part by the payment of page charges. Thisarticle must therefore be hereby marked ‘‘advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact. 8 Contributed equallyto this work. (1 To whom CorresDondence should be addressed Corvas Interna~ ~ . tional, Inc.,3030 Science Park Rd., San Diego, CA92121. $1.: 619-4559800; Fax: 619-455-7895.

CDllbKD18, including ICAM-1’ (3, 41, C3bi (5,6), fibrinogen (7-9), and factor X (10). Recently, we described a novel glycoprotein from the hookworm, NIF, that appears to be an antagonist of CDllb/CD18 basedon the observations that it is a high it inhibits severalfuncaffinity ligand of this integrin and that tions of human neutrophils that are mediated by CDllb/CD18, including adhesion to endothelial cells and releaseof hydrogen peroxide (11).To define better the mechanisms by which this integrin antagonist inhibits leukocyte function at the molecular level, we haveinvestigatedstructuraldeterminants of CDllb/CD18 that are involved in NIF binding. The -200-amino acid residue inserted or “I” domain of the CDllb integrin subunit is a member of a family of related structures whose prototype is the A domain of von Willebrand I domain factor (12). Recent studies have implicated the CDllb as a ligand recognition site. Mutations in the CDllb I domain abolish C3bi binding to intact CDllblCD18 (131, and monoclonal antibodies whose epitopes map to the CDllb I domain block interaction of CDllb/CD18 with several of its cognate ligands, including C3bi, fibrinogen, and ICA“1 (14). Studies involving other integrins have provided additional evidence that I domains have a ligand binding function. For example, monoclonal antibodies that recognize epitopes within theI domains of CDlldCD18 (p150,95, CR4) and c& (very late antigen-2) block the binding of these integrins to C3bi (15) and collagen (161, respectively. Here, we report direct and highaffinity binding of recombinant NIF (rNIF) to a recombinant glutathioneS-transferase fusion protein that containsthe CDllb I domain. This fusion protein blocks the bindingof rNIF to CDllb/CD18on neutrophils and the inhibitory effect of rNIF on neutrophil function, suggesting that the CDllbI domain is a major recognition site for NIF and that contact between NIF is essential for the inhibitoryactivity and this integrin domain observed with NIF on neutrophils. We further show that rNIF blocks the binding of fibrinogen, but not factor X, t o CDllb/ CD18 on human neutrophils. These results demonstrate that NIF is a highly selective ligand of the CDllbI domain. MATERIALS AND METHODS Expression and Purification of rNIF-An EcoRI cDNAfragmentthat contained the coding sequence of Ancylostoma caninurn NIF (11)was modified by insertion into the EcoRI site of pBluescript I1 KS (Strat-

agene) and removalwith the restriction enzymesHind111andNot1 (corresponding to the 5 ‘ - and 3’-endsof the NIF coding region, respectively). This fragmentwas ligated into HindIII-NotI-digestedpRC/CMV The abbreviations used are: ICA”1, intercellular adhesion molecule-1; NIF,neutrophil inhibitoryfactor; rNIF, recombinant NIF; CHO, bovine serum; PBS, phosphate-buffChinese hamster ovary; FBS, fetal ered saline; TBS, Tris-buffered saline; PAGE, polyacrylamide gel electrophoresis;BSA, bovineserum albumin;HSA, human serum albumin; ~ . ~ ~ . ~ fMLP, N-formylmethionylleucylphenylalanine; HUVEC, human umbilical vein endothelial cell;PMA, phorbol 12-myristate 13-acetate; HBSS, HEPES-buffered saline solution.

26419

NIF Binds to the I Domain of CDllbICD18

26420

(Invitrogen) to producethe plasmid pRC/CMV-NIF. The sequence of the NIF coding regionwas confirmed by double-stranded sequencing using the dideoxy chain termination method (17). The plasmid pLTRdhfr26 (18) and a CHO cell strain that harbored a defect in the dihydrofolate reductase gene (dHFR-j were obtained from the American Type Culture Collection. CHO cells were grown in a 1:l mixture of RPMI 1640 medium and Dulbecco's modified Eagle's medium (Irvine Scientific) supplemented with 10%FBS, 10 mM HEPES, essential and nonessential amino acids, 50 pf2-mercaptoethanol, 10 mM sodium pyruvate, and 2 RUI glutamine. Transfection was performed by incubating IO6 cells grown in a 10-cm cell culture dish with 20 pgof pRC/CMV-NIFand 5 pg of pLTRdhfr26 in the presence of calcium phosphate (Life Technologies, 1nc.j for12 h at 37 "C. Transfected cells that grew in the presence of 500 pg/ml G418 (Life Technologies, Inc.) were subjected to two rounds of amplification using methotrexate (Sigma). A single clone that grew in 320 m methotrexate was subjected to three further rounds of single cell isolation. A resulting clone, designated 1G8, secreted recombinant rNIF into the culture supernatant ata level of -50 mg/liter when grownin monolayer culture. rNIF was purified from the IG8-conditioned cellsupernatant by immunoaffinity chromatography using a monoclonal antibody directed against rNIFproduced in Pichia pastoris.2 Anti-rNIF monoclonal antibody (3D2)was coupled to Emphaze biosupport medium (3 M ) by mixing 2.25 g of 3D2 with 19 g of Emphaze (dry weight) in 450 ml of Tris-HC1, pH 4.0, for 10 min at 4 "C with constant agitation. Forty-two grams of sodium sulfate was added to the slurry, and this was stirred for an additional 10 min at 4 "C. The reaction was initiated by raising the pH of the reaction mixture to 9.0 by dropwise addition of 1 M NaOH. The slurry was mixed for 1 h at 4 "C with stirring. After filtration of the slurry, unreacted sites on the resin were blockedby mixing with 500 ml of 1.0 M ethanolamine, pH 9.3, for 2.5 h at 4 "C. The conditioned cell supernatant was filtered through a Sartobran PH 0.07-pm dead-end filter (Sartorius Corp.) and concentrated 50-fold by tangential flow filtration using a 10-kDa Sartocon-Mini polysulfone membrane module (Sartorius Corp.). The concentrate was diafiltered against 5 volumes of 0.01 M sodium phosphate, 0.15 M NaCI, pH7.3. The supernatant containing -150 mg of rNIF was applied to a 400-ml3D2Emphaze column at 20 ml/min. Afterwashing with 400 ml each of 0.1 M sodium phosphate, 0.15 M NaCl, pH 7.3, and then 1 M NaCl, the column waseluted with 800 ml of 0.1 M glycine, pH 2.5.The eluate was brought immediately to neutral pH by addition of 1 M Tris base. rNIF produced in CHO cells wasa glycoprotein witha molecular mass of -44 kDa as determined by laser-desorption time of flight mass spectroscopy (data not shown). This molecule had a specific activity that was indistinguishable from that of NIF purified from hookwormsas measured by its ability to inhibit human neutrophil adhesion to endothelial cell monolayers and hydrogen peroxide release from adherent human neutrophils (IC5o 10 m in each case; data not shown). Construction of I Domain ExpressionVectors-The coding regions for human CDllb and CDlla I domains were isolated using polymerase chain reaction and inserted into the expressionvector pGEX-5X-3 (Pharmacia Biotech Inc.) for expression in bacteria as glutathione Stransferase fusion proteins. The primers usedfor CDllb were 5'CCGGGATCCGGCAGCAGCCCCAGA (forward) and 5"TTGCTCGAGTCAGCTGAAGCCTTCCTG (reverse). This fragment represents a polypeptide that spansand Ser3" of the CDllb chain. The primers for CDlla were 5'-GTGGGATCCCTGGTT"CAG (forward) and 5'-CCGCTCGAGTCAACTGATGCCGCT(reverse), which code for the region between Pro120 and Seg30of the CDlla polypeptide. BamHI and XhoI sites were attached to the 5'-end of both sets of forward and reverse primers, respectively. I domain amplification products were inserted into BamHI- and XhoI-digested pGEX-5X-3. The I domain coding regions of these expression constructs were confirmed by DNA sequence analysis using the dideoxy chain termination method (17). Expression and Purification of I Domain Fusion Proteins-I domain expression plasmids were usedto transform competent Escherichia coli cells (JM109; Stratagene). One liter of L broth containing 50 pg/ml ampicillin was inoculated with 100 ml of an overnight culture of the transformed E. coli cells, and cells were grown at 37 "C with vigorous shaking. After 1 h, expression was induced by addition of 1 m~ isopropyl-p-o-thiogalactopyranoside(Sigma). Three hours after induction, cells were harvested by centrifugation and resuspended in 18 ml of sonication buffer (PBS containing 1%Triton X-100). After addition of 100 p~ 4-(2-aminoethyl)benzenesulfonylfluoride (Calbiochem),cells

-

C. Bogowitz and H. R. Soule, unpublished data.

were disrupted by sonication with four 30-s cycles at 70 watts on a Branson Ultrasonics power sonifier. Insoluble cellular debris was pelleted by centrifugation a t 25.000 x g for 60 min at 4 "C. Fusion protein present in the supernatant was purified by adsorption to a 2-ml glutathione-Sepharose 4B column (Pharmacia Biotech Inc.) for 1 h at 25 "C. After washing with 15 column volumes of PBS, bound fusion protein wasremoved with elution buffer (50 mM Tris-HC1,pH8.0, 150 mM NaCI, 5 IUM glutathione, 2.5 m M CaC1.J. Preparations of fusion protein were >90%pure as assessed by SDS-PAGE. Concentrations of purified fusion protein were determined by quantitative amino acid composition analysis. Radiolabeling of Proteins-Human fibrinogen (1mg; Pharmacia Biotech Inc.) and factor X (50 pg; Enzyme Research Laboratories) were radiolabeled with 0.7-1.0 mCi of NalZ6I(carrier-free;Amersham Corp.) in the presence of 170 and 33 pg of IODO-GEN (Pierce), respectively. Reactions were for 15-20 min at 4 "C. rNIF (100 pg) was labeled by incubation with 1 mCi of Na'=I (carrier-free) in the presence of one IODO-BEAD (Pierce) for 30 min a t 22 "C. Labeled proteins were separated from free iodine by gel filtration through a PDlO-DG column (BioRad) using PBS containing 1%BSA (Calbiochem)as elution buffer. The specific activity of radiolabeled proteins was typically -0.6, -18, and -12 pCi/pg for 1251-fibrinogen, 1251-factor X, and lZ5I-rNIF, respectively. Direct Binding of "'I-rNIF to CDllb I Domain Fusion Protein-""IrNIF (5 pl at 0.1 mg/ml) was mixed with 10 pg ofCDllb I domain fusion protein in TBS (20m~ Tris-HCl,250 mM NaCI, pH 7.4) containing 1 mM Ca2+in a final volume of 50 pl, and thesolution was incubated overnight a t 4 'C. The I d~main.'~~I-rNIF complex wascaptured by adding 50 p1 ofglutathione-Sepharose 4B slurry to the above mixture and incubating for 2 h at 22 "C.The resin was washed three times with TBS, and bound lz5I-rNIFwas eluted from the resin with 20 pl of SDS-PAGE loading buffer by heating at 95 "C for 3 min. Eluted protein was separated by 10% SDS-PAGE, and the gel was dried under vacuum and exposed to x-ray film (Eastman Kodak Co.) overnight. Microtiter Plate Binding Assay-Ninety-six-well microtiter plates (Costar) were coated with 200 pl of CDllb I domain fusion protein in TBS (50 pg/ml) overnight a t 4 "C. The plate was washedonce with TBS and blocked with 3% BSA in TBS for 2 h a t 22 "C. After washing twice with TBS, 100 pl of 1251-rNIF (30 n ~in)TBS containing 0.1% BSA and various divalent cations or EDTA was added. The plate was incubated for 2 h at 22 "C, followed by three washes with TBS. The amount of bound Iz5I-rNIFwas determined by y-spectrometry. For competition experiments, different concentrations of unlabeled rNIF were mixed with 30 nM Iz5I-rNIFin TBS containing 0.1%BSA and 1 m~ Ca2' before addition to the microtiter well. Binding of Radiolabeled Ligands to Neutrophils-Human neutrophils were isolated from heparinized venous blood using a one-step Ficoll-Hypaque gradient (neutrophil isolation medium, Cardinal Associates). Whole blood (6.5 ml) was layered onto 4 ml of neutrophil isolation resolving medium in a 16 x 100 glass test tube. Separation of leukocytes was achieved by centrifugation at 400 x g for 30 min a t 20 "C. The layer of cells containing neutrophils was collected using a Pasteur pipette, and cellswere suspended inPBS containing 5 mM EDTA. Neutrophils were pelleted at 200 x g for 10 min at 4 "C and resuspended in 5 ml of 155 mM NH,Cl, 10 m~ KHCO,, pH 7.4, to lyse contaminating red blood cells. Cells were then washed three times, first with PBS containing 5 RUI EDTA, then with PBS, and finally with RPMI 1640 medium. These preparations were typically >90% neutrophils as determined by automated differential counting. For fibrinogen and factor X binding experiments, neutrophils were resuspended in RPMI 1640 mediumcontaining 2.5 RUI CaC1, at a concentration of 2 X IO7celldml. For lz5I-rNIFbinding experiments, neutrophils were resuspended in HSA buffer (RPMI 1640 mediumwithout sodium phosphate (Life Technologies, Inc.), 1%human serum albumin (Calbiochem), 1.2 m~ CaCI,, 1.0 mM MgCl,, 10 m~ HEPES, pH 7.3) a t a concentration of 1.7 x IO7 cells/ml. The neutrophil suspension (200 pl) was stimulated with fMLP at a final concentration of 10 p~ for '251-fibrinogenand 'Z51-factorX binding experiments and of 1 p~ for '261-rNIF binding experiments. For the radiolabeled fibrinogen binding experiments, hirudin (5 unitdml) was added after 1 min of stimulation. After 5 min at 22 "C, lZ51-rNIF(1 nM final concentration), '251-fibrinogen(20 m), or '261-factorX (15 ml together with competitorligand was added tothe stimulated neutrophils. The concentrations of radiolabeled ligand used in these experiments were selected as being below the Kdfor each ligand (Refs. 10, 8, and 9 for NIF, fibrinogen, and factor X, respectively). For '251-rNIFbinding experiments, radiolabeled rNIF was preincubated with competitor for 30 min at 37 "C before addition to neutrophils. Binding reactions were terminated after 30 min at 20 "C by centrifugation of cell suspensions

NIF Binds to the I Domain of CDllbICD18

6!

44

3( 21.c

EDTA

Ea ca

0 Mn

W ColdrNlF

CDllb

CDlla

GST

26421

taining HUVEC monolayers for 15 min at 37 "C. Fifty microliters of calcein-labeled neutrophils (1.32 x lo7 cells) in HSA buffer was then added to eachwell in thepresence of 200 nM PMA (final concentration). After 30 min at 37 "C, nonadherent cells were removed by centrifugation of inverted sealed platesfor 3 min a t 75 x g, and wells were then washed three times with HEPES-buffered saline solution (HBSS;Clonetics Corp.; 1.3 mM CaCl,, 0.5 mM MgCl,, 0.4 mM MgSO,, 140 mM NaCl, 5 mM KCl, 0.3 mM KH,PO,, 0.3 mM Na,HPO, with 5 mM D-glucose, and 30 mgfliter phenol red). Fluorescence emission from adherent neutrophils was read at 530 nm from 485 nm excitation with a Cytofluor fluorometric plate reader (Millipore Corp.). Each data point was performed in triplicate. In these experiments, 31% of total input neutrophils, or -4 x loficells, bound the HUVEC monolayer in the absence of inhibitor. Lessthan 4 x lo5cells were adherent in the presence of 10 nM rNIF alone. Cell numbers were calculated from an internal standard curve using calcein-labeled neutrophils. Hydrogen Peroxide Release Assay-Release of H,O, from fMLPstimulated human neutrophils was quantitated as described previously (ll),with thefollowing modifications. rNIF (17.5 nM) in 200 pl of HBSS containing 10% heat-inactivated FBS (Irvine Scientific) was preincubated with increasing amounts of I domain fusion protein inFBS-coated 1.5-ml polypropylene tubes for 15 min at 37 "C. To this wasadded 500 p1of neutrophils (3.3 x lo6 cells in HBSS containing 10% heat-inactivated FBS) that had been stimulated with 1 p~ fMLP. After 90 min at 37 "C, cells were pelleteda t 2000 x g for 3 min. Two-hundred microliters of supernatant was transferred to a 96-well microtiter plate, and the reaction was stoppedby addition of 10 p1 of 1N NaOH. Each data point was performed in duplicate. Samples were quantitated at 595 nm with a Thermomax plate reader (Molecular Devices). Hydrogen peroxide concentration was calculated from an internal standard curve using freshly diluted H,O,. Release from stimulated neutrophils in the absence of rNIF and in thepresence of 5 nM rNIF was 0.112 2 0.010 and 0.063 +. 0.001 nmol of H,0J104 neutrophils, respectively (means S.E. of three experiments). RESULTS AND DISCUSSION

To assess direct bindingof rNIF to the CDllb I domain, we used a recombinant fusion protein that contained the I domain region, from Argn5 to Ser340of the CDllb polypeptide (191, fused to glutathione S-transferase. The CDllb I domain fusion 0 10' 10' 103 10' protein obtained from lysates of bacterial cells and captured Unlabeled rNlF (nM) with glutathione-Sepharose precipitated Iz5I-rNIF (Fig. lA 1. FIG.1. NIF' interacts with theI domain of CDllb. A, direct asLabeled rNIF was not precipitated by glutathione S-transfersociation of rNIF with the CDllb I domain. Recombinant glutathione S-transferase (GST)fusion proteins containing the CDllb I domain, ase alone or by a glutathione S-transferasefusion protein that the CDllaI domain, or no I domain were precipitatedby glutathione- contained the Idomain of a related integrin, CDlldCD18 Sepharose in the presenceof 3 x lo5 cpm "'I-rNIF. Radiolabeled rNIF (CDlla I domain) (Fig. lA). Furthermore, an irrelevant prowasvisualized by SDS-PAGE and then autoradiography.Molecular mass standards (Rainbow LMW, Amersham Corp.) are indicated. B , tein, Iz5I-BSA,did not bind the CDllb I domain fusion protein partial divalent cation dependence of the interaction between rNIF and (data not shown). These findings demonstrate that the interthe CDllb I domain. Recombinant glutathione S-transferase fusion action between rNIF and the CDllb I domain is specific and proteins containing the C D l l b I domain, the CDlla I domain, or glu- rule out the possibility that rNIF bound the glutathione Stathione S-transferase alone were immobilized on plastic microtiter transferase portion of the CDllb I domain fusion protein. wells and incubated with5 x lo5 cpm '2sII-rNIF in the presence of Ca2+, The CDllb I domain contains a divalent cation-binding site Mn", or Mg2' (each a t 1mM) or 5 mM EDTA. Specific binding of L2sI-rNIF was determined by co-incubation with a 50-fold molar excess of unla- that is required for the ligand bindingfunction of the holorebeled rNIF. Well-associated radioactivity following washing was quan- ceptor (13).To determine if there is a similar requirement for titated by y-spectrometry. The data are the means 2 S.E. of three indethe interactionof rNIF with theI domainof CDllb, the CDllb pendent experiments. C , competition of I2'II-rNIFbinding to the CDllb I domain with unlabeled rNIF. Increasing concentrations of unlabeled I domain fusion protein was immobilized on plastic microtiter rNIF and 35 nM "'I-rNIF were incubated with the C D l l b I domain wells and tested for binding to solution-phase Iz5I-rNIF in the fusion proteinimmobilized on plastic microtiterwells. The data are the presence of various divalentcation species. While total binding means 2 S.E. of triplicate determinations. of lZ5I-rNIF to the I domain fusion protein was quantitatively similar in thepresence of Ca2+,Mn2+,and Mg2' (each at 1mM), through a mixtureof Dow Coming 550 and 200 silicone oils (5 parts 550 9 - r N I F binding wasdecreased -50% in thepresence of 5 mM oil, 1 part 200 oil) at 12,000 x g for 5 min. Each data point was perassociation of rNIF with EDTA (Fig. U?).This suggests that the formed in duplicate. In each case, the data were expressed as specific the I domain has a partial requirement for divalent cations. radioligand bound, calculatedby subtracting nonspecific cell-associated specific that bindradioactivity (bound radioactivity in the presence of>lOO-fold molar These results are consistent with our finding ing of Iz5I-rNIFto neutrophilsis abolished in thepresence of 10 excess unlabeled ligand) from total bound radioactivity. Neutrophil-HWEC Adhesion Assay-Adhesion of PMA-stimulated, mM EDTA (data not shown). The differentialsensitivityto calcein-loaded human neutrophils to monolayersof HUVECs was per- EDTA observed with thetwo experimental systemsmay be due formed essentially a s described (11).Human neutrophils were isolated to differences in thelocal environment of the CDllbI domain. a s described above, with the following changes. After separation using The capacity of unlabeled rNIF to inhibit the binding of lz5Ineutrophil isolation resolving medium, cells were processed and labeled with the fluorescent dye calcein acetoxymethyl ester as described pre- rNIF is shownin Fig. 1C. Half-maximal inhibition of lz5I-rNIF viously (11).rNIF (20nM) in 50 plof HSA buffer was preincubated with binding occurred in the presence of -30 nM unlabeled rNIF increasing amounts of I domain fusion protein in 96-well plates con- (Fig. E ) . The relatively low concentrations of unlabeled rNIF

26422

NIF Binds to the I Domain of C D l l bf CD18

A

110

Adhesion to Endothelial Cells

110

0

1

10

100

I

1000

Competitor Concentration (nM)

0

FIG.2. CDllb I domain fusion protein competes withCDllb/ CD18 on neutrophils for NIF binding. lZ6I-rNIF(1 nM) was incubated with 1 PM NLP-stimulated neutrophils in the presence of infusion creasing amounts of CDllb I domain).( or CDlla I domain (0) protein. Specific binding of lZ5I-rNIFis demonstrated by competitive inhibition of binding in the presence ofincreasing amounts of unlabeled rNIF (0). Cell-associated radioactivity was quantitated after cells were centrifuged through silicone oils. The number of lZ51-rNIFmolecules bound percell in the absence of competitorwas 58,303 k 4522. The data are the means S.E. of three independent experiments.

.oi

.1

1

10

I Domain Fusion Protein Concentration (pM)

Release of Hydrogen Peroxide

110.

that were required to inhibit 1251-rNIFbinding arecompatible with a high affinity interaction between this ligand and the CDllb I domain fusion protein. This finding extends the observation that rNIF interacts with the CDllb I domain and further suggests that this -200-amino acid integrin domain plays a significant role in the high affinity interaction observed be0 .01 .1 1 10 tween rNIF and CD11b/CD18 on neutrophils (11). I Domain Fusion Protein Concentration (pM) To provide further support for this hypothesis, we tested the FIG.3. CDllb I domain fusion protein blocksN" activity. A , ability of the CDllb I domain fusion protein to compete with the CDllb/CD18 holoreceptor for binding to rNIF. The I do- neutrophil adhesion to HUVEC monolayers. rNIF (10 nM) was preincubated with increasing amounts of CDllb I domain (). or CDlla I main fusion protein at a concentration of 25 nM blocked nearly domain (0) fusion protein in microtiter wells containing monolayers of all specific binding of *251-rNIFto intact human neutrophils HUVEC. PMA-stimulated neutrophils were then added to the wells. (Fig. 2) under conditions where NIF was previously shown to Neutrophils that adhered to HUVEC monolayers were quantitated afbind CDllb/CD18 on these leukocytes (11).Inhibition with the ter 30 min at 37 "C. The data are the means S.E. of three independent experiments. B , adhesion-dependentrelease ofhydrogen peroxide. rNIF CDllb I domain fusion protein was specific as evidenced by the (5 nM) was preincubated withfMLP-stimulatedneutrophils in the presinability of the C D l l a I domain fusion protein at concentra- ence of increasing amounts of CDllb I domain (m) or CDlla I domain tions of up to 500nM to block the binding of lz5I-rNIF to neu- (0) fusion protein. Hydrogen peroxide released by pretreated neutroI domain is a phils over 90 min at 37 "C was quantitated by colorimetry in the prestrophils (Fig. 2). These datashow that the CDllb ence of horseradish peroxidase. The data are the means * S.E. of three major cell-surface recognition site for rNIF. independent experiments. We next investigated the ability of the CDllb I domain fusion protein to inhibit the effect of rNIF on neutrophil functions. Adhesion of PMA-stimulated neutrophils to endothelial in a dose-dependent manner, with >90% inhibition of lZ5I-ficell monolayers and release of hydrogen peroxide from fMLP- brinogen binding a t a rNIF concentrationof 10 J ~ M(Fig. 4A).We effect of rNIF on the bindingof factor X, another stimulated neutrophils were quantitated in the presence of a also tested the constant amountof rNIF together with varying concentrationsligand of CDllb/CD18 (10). In contrast to thecompetition obof I domain fusion protein. The CDllbI domain fusion protein served for fibrinogen binding, rNIF did not affect specific 1251at concentrafactor X binding to fMLP-stimulated neutrophils effectively blocked rNIF inhibition of neutrophil adhesion to endothelial cell monolayers and adhesion-dependent releaseof tions of up to 10J ~ M(Fig. 4B).These results are consistent with hydrogen peroxide at concentrations of -1 and -0.2 PM, re- the notion that one or more sites of contact for rNIF and fispectively (Fig. 3, A and B ) . Similar to our observation in the brinogen on CDllb/CDlS overlap andthat such nonexclusive binding experiments described above, high concentrations of ligand-binding sites maybe present within theI domain of the analogous CDlla I domain fusion protein (i.e. >2 PM) did not CDllb subunit. However, other explanations exist, including affecteitherassay of rNIF activity. Theseresults provide the inhibition of fibrinogen binding, either directly or indiat a distinct site. These results also show strong evidence that molecular contacts between the CDllbI rectly, by rNIF bound domain and NIF are essential for NIF to inhibit these neutro- that rNIF and factorX bind a t nonoverlapping sites within the CDllb/CD18 complex. Since the bindingregion for factor X on phil functions. Previous studies have suggested a role for the CDllb I do- CDllb/CD18 has not yet been identified, it is not possible to main in therecognition of several ligands of CDllWCD18, in- distinguish whether rNIF andfactor X bind functionally sepato interact with rate sites within the CDllb I domain or whether the factor cluding fibrinogen (14). Since NIF also appears the I domain of CDllb, we assessed whether rNIFaffected the X-binding site is outsideof this region. The results presented hereprovide strong evidence that the binding of fibrinogen to CDllb/CD18 on neutrophils. Under conditions where 1251-fibrinogenbound specifically to fMLP- I domain of CDllb is an important recognition site for NIF stimulated neutrophils, rNIF inhibited lZ5I-fibrinogenbinding binding and that NIF must bind to this region of the CDllb

I\

NIF Binds to the I Domain of C D l l b I CD18

A 120

c

T

.!-".,,,, ,......" ,..,...., 0

.01

.1

1

, . . ..,,

. . . .4

10

100

Competitor Concentratlon(pM)

26423

I domain has been implicated in the regulation of I C A " 1 binding to CDllaKD18 (20). As a high aflinity ligand and functional antagonist of the CDllbI domain, NIF should provide new approaches t o investigate the role of the I domain in CDllb/CD18 function. While this work was in progress, Zhou et al. (21) used an approach similar to that described i n ,this report t o demonstrate thebinding of fibrinogen directly to the CDllbI domain. Our data are consistent with this observation. However, relatively high concentrations of NIF were required to inhibit fibrinogen binding to neutrophils (Fig. 4), suggesting that NIF and fibrinogen contact CDllblCD18 at overlapping but nonidentical sites. Furthermore,our finding that NIF did not block factor X binding to neutrophils is consistent with the inability of Zhou et al. (21) to demonstrate factor X binding to the CDllb I domain. Thus, CDllb/CD18 is a multifunctional receptor; the I domain of this integrin contributes to the recognition of certain ligands, including NIF. Acknowledgments-We thank Dm. Julie Ely and George Vlasuk for critical reading of the manuscript. We acknowledge Doug McGrath for the development of a stable rNIF-expressing CHO cell line; Cheri Bogowitz for the development of the anti-rNIF monoclonal antibody; and Kirk Allin, Christine Bieber, Scott Brown, David Foster, and Sven Merten for the production and purification of CHO rNIF.

h 0

.1 1 10 Competitor Concentration(FM)

REFERENCES

100

FIG.4. Selectiveinhibition of specific CDllb/CD18ligand binding byNIF'. A, '261-fibrinogenbinding to neutrophils. '=I-Fibrinogen (20 nM) was incubated with fMLP-stimulated neutrophils in the presence of increasing concentrations of rNIF (W) or unlabeled fibrinoB , '251-factorX binding to neutrophils. lZ5I-FactorX (15 nM) was gen (0). incubated with fMLP-stimulated neutrophils in the presence of increasing concentrations of rNIF (a) or unlabeled factor X (0). Cell-associated radioactivity was quantitated after cells were centrifuged through silicone oils. The number of '251-fibrinogenand '25J-factorX molecules bound per cell in the absence of competitorwas 386,507 -c 1880 and 6372 * 1535, respectively. The data are the means = S.E. of four and three independent experiments for '251-fibrinogen and lZ5I-factorX binding, respectively.

1. Arnaout, M. A. (1993)C u m Opin. Hematol. 1, 113-122 2. Albelda, S.M., Smith, C. W., and Ward, P. A. (1994)FASEB J . 8, 504-512 3. Smith, C. W., Marlin, S. D., Rothlein, R., Toman, C.,andhderson, D. C. (1989) J . Clin. Inuest. 83, 2008-2017 Staunton, D. E., de Fougerolles,A. R., Stacker, S.A., Garcia4. Diamond, M. S., Aguilar, 3.. Hibbs, M. L., and Springer, T. A. (1990)J. Cell B i d . 111,3129-

3139 5. Arnaout, M. A,, Todd, R. F., 111, Dana, N., Melamed, J., Schlossman, S.F., and Colten, H. R. (1983)J. Clin. Invest. 72, 171-179 6. Wright, S.D., b o , P. E., Van Voorhis, W. C., Craigmyle, L. S.,Iida, K., Talle, M. A., Westberg, E. F., Goldstein, G., and Silverstein, S.C. (1983)Proc. Natl. Acad. Sci. U. S. A. SO, 569S5703 7. Altieri, D. C., Bader, R., Mannucci. P. M., and Edgington, T. S.(1988)J . Cell Biol. 107,1893-1900 8. Altieri, D. C., Agbanyo,F. R., Plescia, J., Ginsberg, M. H., Edgington, T.S., and Plow, E. F. (1990)J. Biol. Chem. 265, 12119-12122 9. Wright, S.D., Weitz, J. I., Huang, A. J., Levin, S.M., Silverstein, S.C., and Loike, J. D. (1988)Proc. Natl. Acad. Sci. U. S. A. 86, 7734-7738 10. Altieri, D.C., and Edgington, T. S.(1988)J. Biol. Chem. 263,7007-7015 11. Moyle, M., Foster, D. L., McGrath, D. E., Brown, S. M., Laroche,Y., De Meutter, J., Stanssens, P., Bogowitz, C. A., Fried, V. A., Ely, J. A., Soule, H. R., and Vlasuk, G. P. (1994)J. Biol. Chem. 269, 10008-10015 12. Colombatti, A,, and Bonaldo, P. (1991)Blood 77, 2305-2315 subunit tohave an effect onneutrophil function. Furthermore, 13. Michishita, M., Videm, V., and Amaout, M. A. (1993)Celt 72,857-867 rNIF appears to be highly selective in its ability t o block the 14. Diamond, M. S.,Garcia-Aguilar,J., Bickford, J. K., Corbi, A. L., and Springer, T. A. (1993)J . Cell B i d . 120, 1031-1043 binding of various ligands to CDllb/CD18 on neutrophils. The 15. Bilsland, C. A. G., Diamond, M. S.,and Springer, T.A. (1994)J . Immunol. 152, 45824589 mechanisms by which NIF affects neutrophil function by bind16. Kamata, T.,Puzon, W., and Takada, Y. (1994)J . Biol. Chem. 269, 9659-9663 ing t o the CDllb I domain are not known. It is possible that 17. Sanger, F., Nicklen, S., and Coulsen, A. (1977)Proc. Natl. Acad. Sci. U. S. A. NIF may directly block interactions between CDllb/CD18 and 74,5463-5467 one or more of its ligands that arerequired for cellular function. 18. Murray, M. J., Kaufman, R. J., Latt, S.A,, and Weinberg, R.A. (1983)Mol. Cell. B i d . 3, 32-43 Alternatively, NIF, by binding to the CDllb I domain, may 19. Corbi, A. L., Kishimoto, T.IC, Miller, L. J., and Springer, T.A. (1988)J. Biol. Chem. 263,12403-12411 antagonize conformational changes in CDllb/CD18 that are 20. Landis, R. C . , Bennett, R. I., and Hogg, N. (1993)J. Cell Biol. 120,1519-1527 required for the binding of cognate ligands and thus cellular 21. Zhou, L., Lee, D. H. S., Plescia, J., Lau, C. Y., and Altieri, D. C. (1994)J.B i d . function. In thiscontext, it is interestingto note that the CDlla Chem. 269,17075-17079