Gas1 Inhibits Metastatic and Metabolic Phenotypes in ...

3 downloads 2 Views 11MB Size Report
Department: 1Department of Colorectal Surgery, Fudan University Shanghai Cancer ... 2Department of Oncology, Shanghai Medical College, Fudan University, ...

Gas1 Inhibits Metastatic and Metabolic Phenotypes in Colorectal Carcinoma Qingguo Li1,2*, Yi Qin2,3*, Ping Wei2,4, Peng Lian1,2, Yaqi Li1,2, Ye Xu1,2, Xinxiang Li1,2, Dawei Li1,2, and Sanjun Cai1,2 Department: 1Department of Colorectal Surgery, Fudan University Shanghai Cancer Center, Shanghai 200032, China; 2

Department of Oncology, Shanghai Medical College, Fudan University, Shanghai

200032, China 3

Department of Pancreatic Surgery, Fudan University Shanghai Cancer Center,

Shanghai 200032, PR China 4

Department of Pathology, Fudan University Shanghai Cancer Center, Shanghai

200032, China; Running title: Gas1 expression in colorectal cancer *Qingguo Li and Yi Qin contributed equally to this work. Corresponding author: Sanjun Cai, MD, Ph D. Department of Colorectal Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University.No.270

Dong’an

Road,

Xuhui

District,Shanghai,

20032

China;

Tel.86-021-64175590; Fax:86-021-64175590; E-mail:[email protected] Dawei Li, MD, Ph D. Department of Colorectal Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University.No.270

Dong’an

Road,

Xuhui

District,Shanghai,

20032

Tel.86-021-64175590; Fax:86-021-64175590;E-mail: [email protected] Disclosure of Potential Conflicts of Interest The authors disclose no potential conflicts of interest.

China;

Abstract Growth arrest-specific 1 (Gas1) plays a critical role in growth suppression. Previous study indicated that Gas1 was closely associated with survival in patients with colorectal cancer; however, the underlying molecular mechanism remains unclear. In the present study, we sought to determine the role of Gas1 in tumorigenesis and metastasis, and elucidate the possible mechanism. Firstly, Gas1 was determined as a negative regulator of oncogenesis and metastasis in colorectal cancer. Mechanistically, Gas1 negatively regulated the aerobic glycolysis, a process that contributed to tumor progression and metastasis by providing energy source and building blocks for macromolecule synthesis. To further consolidate the role of Gas1 in glycolysis, the impact of Gas1 in the transcription of key glycolytic enzymes for glucose utilization was examined. As expected, GLUT4, HK2 and LDHB exhibited a decreased expression pattern. Consistent with this observation, an in vivo subcutaneous xenograft mouse model also confirmed the hypothesis that Gas1 is a negative regulator of glycolysis as reflected by the decreased 18FDG uptake in PET/CT system. Moreover, Gas1 negatively regulated the AMPK/mTOR/p70S6K signaling axis, a well-established cascade that regulates malignant cancer cell behaviors including proliferation, metastasis and aberrant cancer metabolism. In the end, it was determined that Gas1 is a transcriptional target of FOXM1, whose role in colorectal cancer has been widely studied. Taken together, these studies establish Gas1 as a negative regulator in colorectal cancer. Keywords: Colorectal cancer, Gas1, epithelial-mesenchymal transition, Warburg effect Implications: Gas1 suppresses cell proliferation, invasion, and aerobic glycolysis of colorectal cancer both in vitro and in vivo. Mechanistically, Gas1 inhibited EMT and the Warburg effect via AMPK/mTOR/p70S6K signaling, and Gas1 itself was directly regulated by the transcription factor FOXM1.

Introduction Colorectal cancer is one of the leading malignancies worldwide and is the third cause of death in cancer patients(1). Although significant progress has been made in diagnosis and treatment of colorectal cancer, invasion, metastasis and recurrence of the disease are still challenging (2). Hence, there is an urgent need to better understand the genetic and biological characteristic of colorectal cancer, which will improve the efficacy of the treatment of this disease, including surgical techniques, chemotherapy methods, and follow-up strategies. Tumor invasion and metastasis are parts of a complicated process in which the tumor grows, then detaches from the primary site and metastasizes to a distant organ. Previous research has demonstrated that epithelial-mesenchymal transition (EMT) plays a key role in the early process of the metastasis of cancer cells. This process involves the acquisition of the expression of mesenchymal molecules, such as vimentin and N-cadherin, together with the loss of epithelial cell adhesion molecules such as E-cadherin (3,4). Recent study indicated that metabolic reprogramming plays critical roles during the EMT process, and provides metabolic advantage for EMT cells (5,6). Normally differentiated cells rely primarily on the oxidation of pyruvate in the mitochondria to generate energy for cellular physiology; however, even with sufficient oxygen, rapidly growing cancer cells rely on aerobic glycolysis to generate energy. This phenomenon is termed as the Warburg effect. The Warburg effect not only provides cancer cells with ATP and nutrients, but also creates an acidic environment that leads to destruction of extracellular matrix and facilitates metastasis. Therefore, identifying key players synergistically regulates the metastasis and glycolysis will provide powerful strategies in the diagnosis and treatment for colorectal cancer.(7). Aberrations of protein-coding genes, including both oncogenes and tumor suppressive genes have been widely accepted to play critical roles in process of colorectal cancer. Previously, our studies showed that Gas1 (Growth Arrest-Specific Protein 1) could contribute to predicting metastasis or recurrence in stage II and III CRC(8). However, the underlying mechanisms that Gas1 contributed to colorectal cancer oncogenesis and metastasis remain elusive. Hence, in the present study we performed a series of in vitro and in vivo studies and demonstrated Gas1 as a tumor suppressor in colorectal cancer. Mechanistically, Gas1 negatively regulated the EMT process, and was

indicated as a negative regulator of glycolysis. Further clinical and pathological analyses demonstrated that Gas1 expression level was negatively associated with SUVmax value reflected by PET/CT imaging, supporting the notion of Gas1 as a negative regulator in vivo. In the end, we determined that Gas1 negatively regulated the AMPK/mTOR/p70S6K signaling axis, and Gas1 itself was a downstream target of FOXM1, a well-established player in colorectal cancer.

Material and methods Patient information and tissue specimens For PET/CT and Warburg study, the first study cohort included 71 colorectal cancer patients who underwent radical surgery between January 2008 and December 2012 at Fudan University Shanghai Cancer Center (FUSCC). Preoperative 18F-FDG PET/CT examination and histopathology confirmation of the presence of colorectal adenocarcinoma were conducted in all patients. The demographic and clinical characteristics of the patients are summarized in Table S1. For tissue microarray (TMA) based immunohistochemistry (IHC) study, colon cancer tissues were obtained from 185 patients who underwent initial radical surgery, including 24 cases at stage I, 81 at stage II, and 80 at stage III. All the patients had a histological diagnosis of colon cancer. Detailed clinical characteristics of the patients are summarized in Table S2. None of these patients included in the study had received neoadjuvant therapy. All the subjects involved in this study provided written informed consent. This project was approved by the Ethics Committee of FUSCC. Construction of the TMA and IHC staining Construction of the TMA and IHC staining were performed as previously described (9,10). Gas1 and FOXM1 anti-human rabbit polyclonal antibodies were used at a dilution of 1:100 (AP11869a, Abgent, San Diego, CA, USA) and 1:50 (sr-500, Santa Cruz, Texas, USA), respectively; PBS was used alternately as negative control. All immunostainings were independently evaluated by two pathologists and a consensus justification based on discussion was recorded. For clinicopathologic correlation analysis, we used a 4-tiered scoring system (negative to 3+), which took into account the percentage of positive cells and staining intensity (8,11). Gas1 was positively stained at cytoplasm and membrane while FOXM1 was nucleolus stained. We separately interpreted 0 and 1+ as “low expression”, while 2+ and 3+ as “strong expression”. Cell culture The human colon cancer cell lines HT-29, HCT116, SW480, SW620, RKO, Colo205, Ls174T and LoVo were originally obtained from the American Type Culture

Collection (ATCC) (Manassas, VA, USA). The cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum in a humidified 37 ℃ incubator supplemented with 5% CO2. Plasmids and the establishment of stable transfection cell lines. Gas1 full-length cDNA was cloned from HCT116 cDNA using primers: 5’ATGGTGGCCGCGCTGCTGGGC

-3’

(forward

primer)

and

5’-

CTAAAAGAGCGGCCCAAGCAG -3’ (reverse primer). PCR product was cloned into PCMV-N-flag vector, and then FLAG tagged Gas1was cloned into pCDH-CMV-MCS-EF1-Puro vector to generate pCDH-Gas1 construct. pLKO.1 TRC cloning vector (Plasmid10878, Addgene, Cambridge, MA,USA) was employed to generate constructs expressing shRNAs against Gas1. The 21bp shRNA target against Gas1

were

5’-GGGCTGTCTATTAGCATATTT-3’

(1#)

and

5’-GCCATGTATGAAAGTCTC-3’ (2#), respectively. pLKO.1-scramble shRNA (Plasmid1864, Addgene) with limited homology with any known sequences in the human was used as a negative control. For establishment of stable cells that expressed Flag-Gas1, HCT116 and SW480 were transfected with the pCDH-Gas1 expression vector and the control vector. For establishment of knockdown stable cells, RKO and HT29

were

transfected

with

the

pLKO.1-shGas1

expression

vector

and

pLKO.1-scramble.Transfected cells were selected using puromycin after the cells were transfected with expression/knockdown vector or control plasmids. These stable cells were all used for functional studies as below in the text. Cell proliferation and clonogenic assay Cell proliferation was assessed by CCK8 assay as previously described(10). To determine clonogenic ability, 200 cells were transplanted in each well of a 6-well dish and allowed to grow for 14 days to form colonies. Cells were fixed with methanol and stained with 0.1% crystal violet. All the visible colonies were calculated manually. In vitro migration and invasion assays Migration and invasion assay were performed using a Transwell system (Costar, Cambridge, MA) according to manuals. Chambers were incubated at 37℃ for 24 h, and three duplicates were prepared for each group. Successfully translocated cells were fixed and then stained with 0.2 % crystal violet. The total cell numbers of five random visual fields were counted, and the average was calculated. E-cadherin and vimentin immunofluorescence

Cells were grown on coverslips, fixed in 4 % paraformaldehyde for 20 min, incubated in a blocking buffer (1 % BSA and 0.25 % Triton X-100 in PBS; pH 7.4), and probed with an E-cadherin antibody or vimentin antibody, then cells were incubated with alexa flours 594 TgG donkey anti-rabbit (1:500, Invitrogen, USA) for an hour at room temperature. To detect nuclei, cells were co-stained with DAPI. Fluorescence images were photographed with a confocal microscopy. Glycolysis analysis Glucose Uptake Colorimetric Assay Kit (Biovision, Milpitas, CA, USA) and Lactate Colorimetric Assay Kit (Biovision, Milpitas, CA, USA ) were purchased to examine the glycolysis process in colon cancer cells according to the manufacturer’s protocol. Real-time PCR was performed to test expression of glycolytic enzymes. All reactions were run in triplicate. Cell Apoptosis Rate Analysis Cells stably transfected with PCDH-Gas1 and Gas1-shRNA were used for this analysis. For apoptosis rate analysis, cells were incubated with Annexin V-FITC (BD Bioscience, CA, USA) and propidium iodide for 10 minutes at room temperature in the dark. After staining, the cells were analyzed using a flow cytometer (CYTOMICS FC 500, Beckman Coulter, Miami, FL, USA). Western blot Western blotting assay was done as previously described(10). Briefly, total proteins were isolated by lysing cells in ice-cold radio immunoprecipitation (RIPA) buffer containing protease and phosphatase inhibitors (Roche). Total proteins were separated by SDS-PAGE gel and blotted onto PVDF membranes (Bio-rad). After blocked with 5% non-fat milk, the membranes were probed with primary antibodies, anti-Gas1 rabbit polyclonal antibody (1: 1000 dilution; Abcam, USA), anti-FOXM1 rabbit polyclonal antibody (1:1000 dilution; Santa Cruz, USA), anti-E-cadherin, N-cadherin, Snail rabbit polyclonal antibody (1: 1000 dilution; Abcam, USA), and anti-Flag monoclonal antibody (1:10 000 dilution; Clone M2, Sigma). After being thoroughly washed, membranes were further incubated with corresponding secondary antibodies. Finally, the bands were visualized using enhanced chemoluminescence (Pierce, Thermo Scientific, USA) RNA isolation and quantitative real-time PCR analysis Total RNA from the tissues and cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, California, USA). RNA quality and concentration were determined using

the Nanodrop 2000 system (Thermo Fisher Scientific,Wilmington, USA). The expression status of target genes and β-actin were determined by quantitative real-time PCR using an ABI 7900HT Real-Time PCR system (Applied Biosystems, Foster City, California, USA) using a Power SYBR® Green PCR Master Mix (Invitrogen, USA). All reactions were run in triplicate. All RT-PCR primers were displayed in Supplementary material, Table S3. Luciferase assays For the luciferase assays, the Gas1 promoter was cloned into the pGL3 basic vector (Promega, Madison, WI, USA). Then, HCT116 and RKO cells (8 × 105 cells/well) were cultured in 94-well plates and co-transfected with the pGL3-Gas1, pGL3-control, or pGL3-Gas1(mutated), pcDNA3.1-FOXM1/pcDNA-control, and renilla plasmid using Lipofectamine 3000 (Invitrogen, USA). Forty-eight hours after transfection, cells were lysed using 20μl of passive lysis buffer. Next, a dual-luciferase assay was carried out as directed by the manufacturer (Promega, Madison, WI, USA). The ratio of firefly to Renilla luciferase activity was used to express luciferase activities. All experiments were performed in triplicate. Data is represented as mean ± standard deviation (SD). Chromatin immunoprecipitation assay HCT116 and RKO cells were prepared for a chromatin immunoprecipitation (ChIP) assay using

ChIP Assay Kit (Millipore, Darmstadt, Germany) according to the

manufacturer’s protocol. The resulting precipitated DNA samples were analyzed using PCR to amplify two potential binding region of the Gas1 promoter with the primers 1# 5’-GTGGTGATCAAGACCCAAAGACAG-3’(forward primer) and 5’-TAAGGAGGCTCGGATATGCAGCCC-3’ 5’-GGAGAAAGGAGAAAGCGGGCAGGC-3’

(reverse (forward

primer)

and

primer)

2# and

5’-TGGCTTCACTCGGCGGCAGCTTC-3’ (reverse primer). The PCR products were resolved electrophoretically on a 1.5% agarose gel and visualized using Goodview staining. Xenografted nude mice model To evaluate in vivo tumorigenesis, five nude mice (male, 4-8 weeks old Balb/C athymic nude mouse) were prepared for HCT116 cells implantation transfected with pCDH-Gas1 or pCDH-vector and RKO cells transfected with PLKO.1-ShGas1 or PLKO.1-scramble.Cells were injected subcutaneously into the right/left forelimbs of

nude mice. After 4 weeks, all the injected mice were euthanatized. Tumor xenografts were harvested and weighted. Tumor volume (TV) was calculated weekly for 4 weeks according to the formula, TV (mm3) =length×width2×0.5. All animal experiments were performed according to guidelines for the care and use of laboratory animals and were approved by IACUC of Fudan University. Statistical analysis Data was analyzed using SPSS 21.0 statistical package (SPSS, Chicago, IL). Based on requirements, either the χ2 or Fisher exacts test was applied to assess the correlations between gene expression and various histopathological features. The Transwell and CCK8 results were analyzed by one-way analysis of variance or independent sample t test. A P value < 0.05 was considered statistically significant.

Results Gas1 inhibited the viability of colon cancer cells in vitro To assess the role of Gas1 in colon cancer viability and tumorigenic potential, we first examined the endogenous expression level of Gas1 in six colon cancer cells (Supplementary Fig.S1), and then used lentivirus-mediated overexpression of Gas1 in HCT116 and SW480 cells (which exhibited the lowest endogenous Gas1 expression) and silencing of Gas1 in HT29 and RKO cells (which exhibited the highest endogenous Gas1 expression). Overexpression and knockdown efficiency were verified by RT-PCR and western blotting (Fig.1A, 1B). The effect of Gas1 on tumor cell growth was measured by CCK-8 assay and the results demonstrated that knockdown of Gas1 significantly enhanced cells proliferation, while overexpression of Gas1 decreased the cell viability with statistical significance (P

Suggest Documents