Genetic diversity of Rhizoctonia solani associated with potato tubers in

2 downloads 0 Views 2MB Size Report
Morbihan. Spunta p8 p23. 43. 3. 0656-006 2 N A WA MIAE00259 France. Morbihan. Charlotte ..... 2010) it seems that the severity of the disease depends mainly.

Mycologia, 103(6), 2011, pp. 1230–1244. DOI: 10.3852/10-231 # 2011 by The Mycological Society of America, Lawrence, KS 66044-8897

Genetic diversity of Rhizoctonia solani associated with potato tubers in France Marie Fiers Ve´ronique Edel-Hermann1 Ce´cile He´raud Nadine Gautheron

sequences contained polymorphic sites, suggesting that the cells of R. solani strains contain several copies of ITS and the tef-1a gene within the same nucleus or between different nuclei. Phylogenetic trees showed a greater genetic diversity within AGs in tef-1a sequences than in ITS sequences. The AFLP analyses showed an even greater diversity among the strains demonstrating that the French strains of R. solani isolated from potatoes were not a clonal population. Moreover there was no relationship between the geographical origins of the strains or the variety from which they were isolated and their genetic diversity. Key words: amplified fragment length polymorphism, anastomosis group, elongation factor, internal transcribed spacer, polymorphic site, potato, Rhizoctonia solani

INRA, Universite´ de Bourgogne UMR 1229 Microbiologie du Sol et de l’Environnement, CMSE, 17 rue Sully, BP 86510, Dijon cedex 21065, France

Catherine Chatot Germicopa R&D, Kerguivarch, Chaˆteauneuf du Faou 29520, France

Yves Le Hingrat FNPPPT, Bretagne-Plants Roudouhir, Hanvec 29460, France

Karima Bouchek-Mechiche INRA, UMR BiO3P, Domaine de la Motte, BP 35327, Le Rheu 35653, France

Christian Steinberg

INTRODUCTION

INRA, Universite´ de Bourgogne UMR 1229 Microbiologie du Sol et de l’Environnement, CMSE, 17 rue Sully, BP 86510, Dijon cedex 21065, France

The fungus Rhizoctonia solani (teleomorph Thanatephorus cucumeris, Ku ¨ hn, 1858) is a widespread plant pathogen that causes severe damage on numerous species. R. solani includes many related but genetically different subspecific groups. The hyphae of the closely related strains can fuse and hence form an anastomosis group (AG), whereas the distantly related strains are unable to anastomose (Carling et al. 2002, Kuninaga and Yokosawa 1984, Parmeter 1970). The known strains of R. solani can be classified into at least 13 AGs, but the classification is not strictly fixed because some bridging strains are able to anastomose with strains of at least two AGs (Carling et al. 2002, Parmeter 1970, Sharon et al. 2008). Each AG is either host specific or with a wide host range (Carling et al. 2002, Ogoshi 1987). For example AG 2 is associated with diverse host plants but AG 8 is more specifically associated with cereals. AG 3 is divided into two genetically different subgroups, AG 3 PT associated with potatoes and AG 3 TB associated with tobacco (Kuninaga et al. 2000, Woodhall et al. 2008). R. solani AG 3 PT reduces tuber quality by producing sclerotia (black scurf) on progeny potato tubers. The pathogen also can infect underground organs (stems, stolons and roots), which affects crop yield (tuber size and number) (El Bakali and Martin 2006). In addition to those typical symptoms R. solani is associated with several types of blemishes on potato tubers (Fiers et al. 2010). Other AGs of R. solani sometimes are considered potential pathogens of potato in France and in the United Kingdom, although Koch’s postulates have not been assessed (Campion et al. 2003, Woodhall et al. 2008).

Abstract: The soilborne fungus Rhizoctonia solani is a pathogen of many plants and causes severe damage in crops around the world. Strains of R. solani from the anastomosis group (AG) 3 attack potatoes, leading to great yield losses and to the downgrading of production. The study of the genetic diversity of the strains of R. solani in France allows the structure of the populations to be determined and adapted control strategies against this pathogen to be established. The diversity of 73 French strains isolated from tubers grown in the main potato seed production areas and 31 strains isolated in nine other countries was assessed by phylogenetic analyses of (i) the internal transcribed spacer sequences (ITS1 and ITS2) of ribosomal RNA (rRNA), (ii) a part of the gene tef-1a and (iii) the total DNA fingerprints of each strain established by amplified fragment length polymorphism (AFLP). The determination of the AGs of R. solani based on the sequencing of the ITS region showed three different AGs among our collection (60 AG 3 PT, 8 AG 2-1 and 5 AG 5). Grouping of the strains belonging to the same AG was confirmed by sequencing of the gene tef-1a used for the first time to study the genetic diversity of R. solani. About 42% of ITS sequences and 72% of tef-1a Submitted 23 Jul 2010; accepted for publication 5 Apr 2011. 1 Corresponding author. E-mail: [email protected]

1230

FIERS ET AL.: RHIZOCTONIA SOLANI The AG differentiation is traditionally carried out by pairing unknown isolates with reference strains and by identifying the hyphal anastomosis reaction (Carling 1996, Guillemaut et al. 2003). However this method is time consuming, needs experienced eyes and does not reflect the diversity among AGs. Sequencing of the internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) is now a more convenient and rapid method to differentiate R. solani AGs (Kuninaga et al. 2000, Lehtonen et al. 2008, Woodhall et al. 2007). However this region is less variable for detection of differences between isolates of the same AG. The tef-1a gene, encoding the translation elongation factor 1a, is more variable than the ITS region and already has proved useful in revealing genetic variability within fungal genera, including Fusarium (Geiser et al. 2004) and Trichoderma (Anees et al. 2010). This genetic marker could be useful to reflect polymorphism both between and within AGs of R. solani. In addition to targeted DNA markers, strategies based on amplified fragment length polymorphism (AFLP) allow a large number of DNA fragments to be screened to assess intraspecific variability to differentiate closely related isolates and reveal clonal lineages (McDonald 1997). The aim of this study was to characterize the genetic diversity of isolates of R. solani collected from the different potato-growing areas in France. The genetic variability between and within AG was evaluated with ITS and tef-1a sequencing, together with AFLP analysis. The relevance of these tools to detect genetic differences between and within isolates also was assessed. MATERIALS AND METHODS

Fungal isolates.—73 isolates of R. solani were collected from potato tubers of several varieties and from nine French departments producing potatoes in 2006 and 2007 (TABLE I). The tubers were affected by various superficial blemishes (Fiers et al. 2010). In addition 31 isolates of R. solani from other countries were analyzed: six from Finland, one from Germany, one from Japan, four from Morocco, one from the Netherlands, two from Poland, one from Spain, 12 from Switzerland and three from the United Kingdom (TABLE I). DNA extraction, PCR amplification, DNA sequencing and phylogenetic analyses.—DNA of all the fungal isolates was extracted from freeze-dried powder of mycelium with the DNeasy plant mini kit according to the protocol of Fiers et al. (2010). For each fungal isolate the ITS region of the rDNA and part of the tef-1a gene were amplified by PCR. ITS PCR was performed with the primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) (Gardes and Bruns 1993, White et al. 1990) in a

DIVERSITY

1231

final volume of 50 mL by mixing 2 mL DNA with 0.5 mM of each primer, 150 mM dNTP, 6 U Taq DNA polymerase (QBiogen, Evry, France) and PCR reaction buffer. PCR amplifications of tef-1a were performed with primers EF1– 645F (TCGTCGTYATCGGMCACGTCGA) and EF1–1190R (TACCAGTGATCATGTTCTTGATGA) (Andersen et al. 2009) in a final volume of 25 mL by mixing 1 mL DNA with 0.068 mM of each primer, 1.5 mM MgCl2, 150 mM dNTP, 1 U Taq DNA polymerase (Q-Biogen, Evry, France) and PCR reaction buffer. Amplifications were conducted in a mastercycler (Eppendorf, Hambourg, Germany). ITS amplification consisted of an initial denaturation of 3 min at 94 C, followed by 35 cycles of 1 min at 94 C, 1 min at 50 C, 1 min at 72 C, and a final extension of 10 min at 72 C. Amplification of tef-1a was carried out with an initial denaturation of 5 min at 94 C, followed by 40 cycles of 30 s at 94 C, 30 s at 52 C, and 80 s at 72 C and a final extension of 7 min at 72 C. Aliquots of PCR products were checked by electrophoresis on a 1% agarose gel, revealed with ethydium bromide and visualized by UV transillumination. ITS and tef-1a PCR products were sequenced by Beckman Coulters Genomics (Takeley, UK) with primers ITS1-F and ITS4 and EF1-645F and EF1-1190R respectively. For each PCR product sequences from both strands were assembled to produce a consensus sequence with the software SeqMan (DNASTAR Lasergene, GATC Biotech SARL, Marseille, France). The identities of the sequences were determined with BLAST analyses from the National Center for Biotechnology Information (NCBI) available online. For each DNA region sequences were aligned with Clustal X (Thompson et al. 1997). The multiple sequence alignments were carried out with PHYLO-WIN (Galtier et al. 1996) using the Kimura’s two-parameters distance model (Kimura 1980) and neighbor joining (Saitou and Nei 1987). The topology of the resulting tree was tested by bootstrapping with 1000 resamplings of the data. Phylogenetic trees were drawn with the NJPLOT program (Perrie`re and Gouy 1996). AFLP analyses.—The digestion and ligation of 125 ng extracted DNA were carried out according to the manufacturer’s specifications of the AFLP Core Reagent kit (Invitrogen) (Vos et al. 1995). The ligation products were pre-amplified by PCR. PCR amplifications were performed in a final volume of 25.5 mL by mixing 2.5 mL DNA with 0.3 mM each primer E-0 (GACTGCGTACCAATTC) and M-0 (GATGAGTCCTGAGTAA), 212 mM dNTP, 2.5 U Taq DNA polymerase (Q-Biogen, Evry, France) and PCR reaction buffer. Amplification was conducted in a thermal-cycler GeneAmp PCR system 9600 (Perkin Elmer Applied Biosystems, Foster City, California) with 20 cycles of 30 s at 94 C, 1 min at 56 C, and 1 min at 72 C. A 1 : 50 dilution was performed with 1.5 mL pre-amplified product diluted in 73.5 mL TE buffer. Selective amplification was performed in a final volume of 20 mL by mixing 5 mL DNA with 0.4 mM EAA 59-IRD800 fluorescent primer (GACTGCGTACCAATTCAA) (MWG), 0.30 mM M-C primer (GATGAGTCCTGAGTAAC), 202.5 mM dNTP, 0.5 U Taq DNA polymerase (QBiogen) and PCR reaction buffer. PCR was conducted in a

1232 TABLE I.

MYCOLOGIA Isolates of Rhizoctonia solani analyzed in this study

Anastomosis group

Strains

MIAE accession number a

2-1

0722-092 2 B PDA

MIAE00269

France

2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1

0629-011 0680-006 0680-006 0680-006 0680-006 0680-006 0680-006 173-4 R114 R25 0799-001 Y25

MIAE00231 MIAE00208 MIAE00262 MIAE00263 MIAE00264 MIAE00265 MIAE00266 MIAE00348 MIAE00349 MIAE00357 MIAE00189 MIAE00350

3 3

0602-001 1 B PDA 0722-001 1 B PDA

MIAE00072 MIAE00267

France France France France France France France Finland Finland Finland Morocco United Kingdom France France

3

0722-001 2 A PDA

MIAE00268

France

3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3

0628-006 0628-006 0628-006 0728-012 0728-091 0629-049 0629-033 0629-036 0629-038 0629-039 0629-040 0629-040 0629-004 0629-014 0629-023 0629-030 0629-055 0629-059 0629-004 0629-004 0629-004 0629-005 0629-005 0629-005 0629-005 0629-014 0629-014 0629-017 0629-021 0629-023 0629-023 0629-030 0629-038

MIAE00150 MIAE00152 MIAE00219 MIAE00270 MIAE00271 MIAE00006 MIAE00082 MIAE00083 MIAE00087 MIAE00090 MIAE00092 MIAE00093 MIAE00164 MIAE00165 MIAE00170 MIAE00176 MIAE00179 MIAE00185 MIAE00222 MIAE00224 MIAE00225 MIAE00226 MIAE00227 MIAE00228 MIAE00229 MIAE00232 MIAE00233 MIAE00235 MIAE00236 MIAE00237 MIAE00238 MIAE00239 MIAE00240

France France France France France France France France France France France France France France France France France France France France France France France France France France France France France France France France France

1 2 1 1 2 2 2

WA Ab WA PDA WA A PDA Aa WA Bb WA

2 N WA

1 A WA 3 A WA 3 A PDA PDA A PDA 2 WA 2 B WA 1 A WA 3 A WA 2 A WA 2 A WA 2 A PDA 1A WA 3 WA 1 A PDA 2 PDA 3 WA 3 PDA 1 B WA 3 WA 4 WA 1 A PDA 1 WA 3 B PDA 3 WA 1 WA 2 WA 4 WA 1 A WA 1 B WA 2 B WA 2 A WA 1 A PDA

Geographical origin Coˆtes d’Armor Finiste`re Somme Somme Somme Somme Somme Somme

Aisne Coˆtes d’Armor Coˆtes d’Armor Eure-et-Loir Eure-et-Loir Eure-et-Loir Eure-et-Loir Eure-et-Loir Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re

Host of origin (potato cultivar)

ITS tef-1a sequence sequence Two-locus type b type b type

Juliette

m1

m1

1

Rosanna Hybride Hybride Hybride Hybride Hybride Hybride Unknown Unknown Unknown Unknown Unknown

p1 m2 m2 m2 m2 m2 m2 Nd Nd m1 p2 m2

m2 p1 p1 p1 p1 p1 p1 m1 p2 m1 p3 m3

2 3 3 3 3 3 3

Unknown Charlotte

p3 m3

p4 m4

6 7

Charlotte

m4

p5

8

Amandine Amandine Amandine Amandine Ditta Juliette Juliette Juliette Samba Amandine Samba Samba Spunta Che´rie Charlotte Samba Pamela Hybride Spunta Spunta Spunta Spunta Spunta Spunta Spunta Che´rie Che´rie Charlotte Atlas Charlotte Charlotte Samba Samba

m5 p4 p4 p5 p3 p6 m6 m4 m7 p7 p8 p8 m8 p9 m6 m5 p10 m7 p4 p9 p10 m5 m5 p11 p12 m5 p5 p8 m4 m6 m6 m5 p4

p6 Nd Nd p7 Nd p8 m4 p9 p8 Nd p8 p8 p10 p8 p11 Nd p10 p12 m5 m5 p13 m4 m4 p14 p14 p9 p9 p15 m4 m4 m4 p9 m5

9

1 4 5

10 11 12 13 14 15 15 16 17 18 19 20 21 22 23 24 24 25 26 27 28 29 30 12 12 27 21

FIERS ET AL.: RHIZOCTONIA SOLANI TABLE I.

1233

DIVERSITY

Continued

Anastomosis group

Strains 1 WA 3 A PDA 3 B WA 1 A PDA 1 Ba PDA 1 A WA 2 PDA 2 WA 2 B PDA PDA C PDA 1 PDA 2 PDA 1 B PDA 2 A PDA 2 WA 1 A WA 2 B WA 2 PDA 2 N A WA 2 O PDA 2 O WA A PDA 3 PDA

MIAE accession number a

3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3

0629-038 0629-038 0629-038 0629-049 0629-049 0629-051 0629-055 0629-055 0629-059 0729-015 0729-032 0729-093 0729-093 0745-001 0745-001 0656-003 0656-004 0656-004 0656-004 0656-006 0656-006 0656-006 0756-091 0762-002

MIAE00241 MIAE00242 MIAE00243 MIAE00248 MIAE00249 MIAE00250 MIAE00251 MIAE00252 MIAE00253 MIAE00272 MIAE00273 MIAE00274 MIAE00275 MIAE00276 MIAE00277 MIAE00255 MIAE00256 MIAE00257 MIAE00258 MIAE00259 MIAE00260 MIAE00261 MIAE00280 MIAE00281

3 3 3 3 3 3 3 3

R11 MIAE00356 R98 MIAE00359 CBS 363.82 MIAE00352 i1 MIAE00351 0799-001 2 N PDA MIAE00217 0799-001 3 N A MIAE00283 PDA 0799-001 3 N WA MIAE00284 CBS 163.83 MIAE00374

3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3

P1 P2 S1 1 S1 2 S1 3 S2 1 S2 2 S3 2 S3 3 S4 1 S5 1 S5 2 S6 2 S7 2 CBS 117241 HA

MIAE00354 MIAE00355 MIAE00361 MIAE00362 MIAE00363 MIAE00364 MIAE00365 MIAE00366 MIAE00367 MIAE00368 MIAE00369 MIAE00370 MIAE00371 MIAE00372 MIAE00373 MIAE00353

Geographical origin France France France France France France France France France France France France France France France France France France France France France France France France

Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Finiste`re Loiret Loiret Morbihan Morbihan Morbihan Morbihan Morbihan Morbihan Morbihan Morbihan Pas-deCalais

Host of origin (potato cultivar)

ITS tef-1a sequence sequence Two-locus type b type b type

Samba Samba Samba Juliette Juliette Marine Pamela Pamela Hybride Urgenta Bintje Nicola Nicola Bintje Bintje Kennebec Spunta Spunta Spunta Charlotte Charlotte Charlotte Nicola Hermes

p4 m7 m7 p13 m5 p8 m5 m5 m5 m9 m8 p13 p14 p15 p16 p17 p8 m5 p8 m4 m4 m4 p18 m5

m5 p16 p9 p17 p18 p19 p13 p13 p20 m4 Nd p8 p8 Nd m4 p21 p22 Nd p23 p9 p9 p24 Nd p25

21 31 14 32 33 34 35 35 36 37

Finland Finland Germany Japan Morocco Morocco

Unknown Unknown Unknown Unknown Unknown Unknown

p19 p20 p7 p21 p7 Nd

m5 Nd p8 m6 p8 p8

Morocco The Netherlands Poland Poland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Switzerland Spain United Kingdom

Unknown Unknown

p22 p9

p24 p8

50 51

Unknown Unknown Bellini Bellini Bellini Magnum Magnum Charlotte Charlotte Gourmandine Hybride Hybride Ludmilla Naviga Unknown Unknown

m9 m9 m4 m4 m4 p23 Nd p24 p25 m4 p26 p3 p27 p28 p12 m4

m7 m7 Nd Nd m5 Nd p8 Nd p26 p8 p27 Nd Nd m5 p8 p8

52 52

38 39 40 41 42 43 44 44 45 46 47 48 49 48

53

54 44 55

56 38 44

1234 TABLE I.

MYCOLOGIA Continued

Anastomosis group

Strains

MIAE accession number a MIAE00360

Geographical origin

3

Rs08

5 5 5 5

0628-023 0628-023 0628-023 0747-001

1 B PDA 1 B WA 1A PDA 1 A PDA

MIAE00159 MIAE00213 MIAE00221 MIAE00278

United Kingdom France France France France

5

0747-002 2 A PDA

MIAE00279

France

5

R96

MIAE00375

Finland

Eure-et-Loir Eure-et-Loir Eure-et-Loir Lot-etGaronne Lot-etGaronne

Host of origin (potato cultivar)

ITS tef-1a sequence sequence Two-locus type b type b type

Unknown

m6

Nd

Che´rie Che´rie Che´rie Hybride

m10 m10 m10 p29

p28 p28 p28 Nd

57 57 57

Samba

m10

p29

58

Unknown

m10

p28

57

a Collection MIAE, Microorganisms of Interest for Agriculture and Environment (INRA Dijon, France; http://www2.dijon. inra.fr/umrmse/). b m and p followed by a number designate the different monomorphic and polymorphic sequence types, respectively. Nd indicates not determined.

thermal-cycler GeneAmp PCR system 9600 with a first cycle of 30 s at 94 C, 30 s at 65 C, and 1 min at 72 C. The 12 following cycles were performed by reducing the annealing temperature by 0.7 C at each cycle. Then 23 cycles were performed (30 s at 94 C, 30 s at 56 C and 1 min at 72 C). Aliquots of PCR products were checked by electrophoresis on a 1% agarose gel, revealed with ethydium bromide and visualized by UV transillumination. Separation of the amplified fragments was performed on a 41 cm polyacrylamide gel (Li-Cor, Germany) with 6.5% acrylamide KB (LiCor), for 10 h 30 min at 1500 V for resolution of fragments 50–700 bp. A size standard (50–700 bp sizing standard, LiCor) and a reference strain for which the profile is known were added to each gel in at least five wells. Each gel was photographed. For each strain the analysis was performed in duplicate from independent DNA extracts. Li-Cor gel pictures were analyzed with ONE-Dscan software (Scanalytics BD Biosciences-Bioimaging 2.05), measuring the 115 most intense bands, 100–500 bp, for each profile. Categories grouping fragments, whose lengths differed by less than 1.5 bp, were created with LisAFLP program (Mougel et al. 2002). The LecPCR application (ADE-4 2001, Thioulouse et al. 1997) was applied to the data to transform the fragment weights matrix into a binary matrix. The binary matrix indicated the absence (0) or presence (1) of each fragment for each profile. Finally only fragments present in the two repeats performed for each strain were included in the analysis. Genetic relationships between each profile were estimated with the Nei and Li similarity index (Nei and Li 1979), and bootstrap values corresponding to the appearance frequency of branches in 1000 data permutations were calculated with Treecon software (Vandepeer and Dewachter 1994 1.3b). The similarity matrix was represented by a dendrogram with the UPGMA (unweighted pair grouping method with arithmetic mean) algorithm (Sneath and Sokal 1973).

RESULTS

ITS and tef-1a sequences analysis.—PCR amplification of the ITS region with primers ITS1-F and ITS4 gave a single product of approximately 700 bp for each isolate. The ITS1, 5.8S and the ITS2 regions were sequenced for 100 isolates (TABLE I, GenBank accession numbers HQ898669–HQ898768). For all isolates BLAST queries allowed the determination of the corresponding AG on the basis of 99–100% similarity with corresponding sequences. Among the 73 French isolates 60 were identified as R. solani AG 3 PT, the remaining were AG 2-1 (eight isolates) and AG 5 (five isolates). A total of 64 variable sites were identified in ITS1 but only 24 variable sites in ITS2. Variable sites refer to those where several different nucleotides were observed among the 73 sequences of collected isolates. Among the large number of AG 3 PT isolates analyzed, 10 and three polymorphic sites were observed respectively in ITS1 and ITS2 (FIG. 1). Heterogeneity within individual isolates was observed in 48 out of the 100 ITS sequences analyzed in this study. This heterogeneity corresponded to two overlapping peaks at some positions in the electrophoregram, indicating that multiple ITS types might exist within individual isolates. Among the AG 3 PT sequences this heterogeneity within individual isolates was observed at all the 13 polymorphic sites identified within the AG. Conversely only two polymorphic sites were within AG 2-1 sequences and four polymorphic sites within AG 5 sequences. However the number of sequences also was lower with 11 and six isolates from AG 2-1 and AG 5 respectively.

FIERS ET AL.: RHIZOCTONIA SOLANI

DIVERSITY

1235

FIG. 1. Sequence alignment of part of the ITS1 (a) and ITS2 (b) regions among isolates of Rhizoctonia solani collected from potatoes. Y indicates C and T, W indicates A and T, M indicates A and C and R indicates A and G. Polymorphic bases indicated in gray are common to those found by Justesen et al. (2003) in the ITS1 region.

1236

MYCOLOGIA

FIG. 1.

Continued.

FIERS ET AL.: RHIZOCTONIA SOLANI

DIVERSITY

1237

FIG. 2. Neighbor joining tree (Kimura two-parameter distance) of 52 monomorphic ITS sequences of Rhizoctonia solani isolated from potato tubers. Bootstrap values ($ 60%) are near the equivalent branches.

Each sequence was assigned to a type number, m1– m10, for the 10 monomorphic sequences observed and p1–p29 for the 29 sequences with polymorphic sites, coded as m and p followed by a number designating the different monomorphic and polymorphic sequence types respectively (FIG. 1). Comparisons of all sequences allowed identifying 39 ITS types. Four types were identified within AG 2-1 (m1, m2, p1, p2), 33 within AG 3 PT (m3–m9 and p3–p28) and two within AG 5 (m10, p29) (TABLE I). The 52 sequences without any polymorphic sites were compared in a phylogenetic tree (FIG. 2). The three AGs were genetically different because they appeared on three distinct branches of the tree with significant bootstrap values above 99%. Isolates belonging to AG 5 were more similar to isolates from AG 2-1 than to isolates from AG 3 PT (FIG. 2). The tree of ITS sequences showed seven ITS types among AG 3 PT. Type m3 comprised one isolate (MIAE00267) from France (Coˆtes d’Armor) and isolated from cultivar Charlotte. Type m5 included 12 isolates from France (Finiste`re, Eure-et-Loir, Pas-

de-Calais) isolated from cultivars Spunta, Samba, Pamela, Che´rie, Amandine, Hermes and Juliette. ITS type m4 comprised 11 isolates from France (Finiste`re, Morbihan, Coˆtes d’Armor), Switzerland and the United Kingdom, isolated from cultivars Charlotte, Juliette, Atlas, Gourmandine; Bellini. Type m7 included four isolates, all from France (Finiste`re), isolated from cultivar Samba or a hybrid. ITS types m6, m8 and m9 were grouped in the same branch, distantly related to the other types in AG 3 PT. Type m6 comprised five isolates from France (Finiste`re) and the United Kingdom, isolated from cultivars Charlotte and Juliette. Type m8 comprised two isolates from France (Finiste`re), isolated from cultivars Spunta and Bintje. Type m9 comprised three isolates from Poland and France (Finiste`re), isolated from Urgenta and unknown cultivars. Two ITS types were observed among AG 2-1. Type m2 included seven isolates from France (Somme) and the United Kingdom. They were isolated from a hybrid cultivar and an unknown cultivar. Type m1 included two isolates from Finland and France (Coˆtes

1238

MYCOLOGIA

d’Armor) and were isolated from an unknown cultivar and cultivar Juliette. Finally, monomorphic isolates from AG 5 were grouped in only one ITS type (m10). They were five isolates from France (Eure-etLoir, Lot-et-Garonne) and Finland, isolated from cultivars Che´rie, Samba, a hybrid and an unknown cultivar. The PCR amplification of the tef-1a gene with the primers EF1-645F and EF1-1190R gave a single product of approximately 400 bp. The tef-1a gene was sequenced for 86 isolates (TABLE I, GenBank accession numbers HQ898769–HQ898854). In BLAST queries identification of R. solani AG through tef-1a sequence confirmed the identification of AG made through ITS sequence, with a similarity of 93–100%. Among the 86 sequenced isolates 13 belonged to AG 2-1, 68 to AG 3 PT and five to AG 5. A total of 60 variable sites were identified among tef1a sequences (FIG. 3). Among the 68 sequences of AG 3 PT 20 variable sites were identified. Among AG 2-1 and AG 5 isolates 42 and eight variable sites were observed respectively. As in the ITS sequences some heterogeneity within individual isolates was observed for 62 isolates out of the 86, such as polymorphic sites that revealed polymorphism within the tef-1a gene in the same individual. This heterogeneity was observed at 17, seven and five variable sites observed respectively within AG 3 PT, AG 2-1 and AG 5 sequences (FIG. 3). According to the variations in the tef-1a sequences, 36 different elongation factor types were identified: six within AG 2-1 (m1–m3 and p1–p3), 28 within AG 3 PT (m4–m7 and p4–p27) and two within AG 5 (p28, p29) (TABLE I). A phylogenetic tree was inferred on the basis of the 24 tef-1a sequences without any polymorphic sites, together with one sequence of AG 5 (MIAE00279) including only one polymorphic site. Indeed all the sequences of R. solani AG 5 analyzed had at least one polymorphic site (FIG. 3). The phylogenetic tree showed four different elongation factor types within AG 3 PT (FIG. 4). Type m6 comprised one isolate (MIAE00351) from Japan; type m5 comprised seven isolates from France (Finiste`re), Switzerland and Finland, isolated from cultivar Spunta, Samba, Naviga and Bellini. Type m4 comprised nine isolates from three departments of France (Coˆtes d’Armor, Finiste`re and Loiret), isolated from cultivars Atlas, Bintje, Charlotte, Juliette, Spunta and Urgenta. Finally, m7 included two isolates from Poland, isolated from unknown cultivars. All the strains belonging to m7 in tef-1a analysis corresponded to m9 in ITS analysis; both being distantly related to other AG 3 PT sequences (FIGS. 2, 4). Among AG 2-1 sequences three elongation factor types, m1, m2 and m3, were identified.

Combined data from ITS sequences and tef-1a sequences revealed a total of 58 two-locus sequence types among the 82 isolates for which both loci were analyzed (TABLE I). Among the 58 types, only nine two-locus sequence types were monomorphic for both loci. AFLP analysis.—Eighty-nine isolates were analyzed. The number of bands analyzed (100–500 bp) was 60– 102 per profile, with an average of 78 bands, for a total of 254 useful markers. The phylogenetic tree of AFLP profiles showed three groups supported by significant bootstrap values above 96%, corresponding to the three AGs (FIG. 5). Regarding AFLP profiles, the AG 5 isolates were more closely related to the AG 3 PT isolates than to the AG 2-1 isolates, as it was shown on the tree of tef-1a sequences. A significant diversity was observed within each AG with so many AFLP profiles as isolates, but no particular clusters could be identified within AGs. Among AG 3 PT isolates, the French isolates were spread across the tree. At a smaller scale isolates originating from the same French department (Finiste`re) also were found all along the tree, showing no direct relation of the diversity observed with the geographic origin. DISCUSSION

In this study 104 isolates of R. solani, all sampled from blemished potato tubers, were characterized by sequencing of the ITS region and part of the tef-1a gene and by AFLP fingerprinting. The 73 French isolates were representative of all areas producing potatoes in France; they were compared with 31 isolates from other countries. AG 3 PT was found to be predominant, including 82% of the French isolates. The remaining isolates belonged to AG 2-1 and AG 5. R. solani isolates belonging to AG 3 are isolated frequently from potato tubers and are known to be pathogens for this crop (Kuninaga et al. 2000), but AG 2-1 and AG 5 are more rarely isolated from blemished tubers and their pathogenicity still has not been demonstrated (Campion et al. 2003, Fiers et al. 2010, Woodhall et al. 2008). Several distinct sequence types of the ITS region and of the tef-1a gene were identified among the R. solani isolates and surprisingly in the majority of individual isolates the coexistence of multiple types was observed. Polymorphism in the ITS region and tef1a gene within individual isolates can be due to the existence of different ribosomal DNA units within the same nucleus or different sequences in different nuclei. The coexistence of multiple sequence types within individual isolates was confirmed by cloning and sequencing of several clones (Justesen et al.

FIERS ET AL.: RHIZOCTONIA SOLANI

DIVERSITY

1239

FIG. 3. Sequence alignment of part of the tef-1a gene among isolates of Rhizoctonia solani collected from potatoes. Y indicates C and T, W indicates A and T, M indicates A and C and R indicates A and G.

2003). This heterogeneity results from mutations that would be maintained from generation to generation and become fixed. Several ITS sequence types within the same individual also were identified for other fungi, such as Sclerotium rolfsii (Almeida et al. 2001),

Ascochyta spp. (Fatehi and Bridge 1998) and Botrytis spp. (Yohalem et al. 2003). Among R. solani populations ITS polymorphism was studied within AG 2-1 and AG 3 (Justesen et al. 2003, Pannecoucque and Hofte 2009). The same 10 within-isolate poly-

1240

MYCOLOGIA

FIG. 3. Continued.

morphic sites identified by Justesen et al. (2003) among ITS1 sequences of R. solani AG 3 also were detected in our study in addition to others sites. The finding of two different ITS types or elongation factor types within the same isolate and the possible association with two nuclear types is consistent with the heterokaryotic nature of R. solani, which has been confirmed by other DNA marker methods that revealed heterozygosity in individual isolates of R. solani AG 3 (Ceresini et al. 2007). Both loci, the ITS region and tef-1a gene, showed a considerable amount of sequence variability among R. solani sequences. Concerning the ITS region, we found that ITS1 sequences were much more variable than ITS2 sequences, with 24% and 11% of variable sites in the whole ITS1 and ITS2 regions respectively. Our results agree with the ITS variability described by Nilsson et al. (2008) among R. solani. The second locus used, tef-1a gene, was found to be even more polymorphic, with 26% of variable sites among all three detected AGs of R. solani, and 9% of variable sites among AG 3 PT isolates. However this variability could not be illustrated in trees because dimorphic sites were excluded from the phylogenetic analysis. The groupings of isolates varied according to the locus that was sequenced (FIGS. 2, 4); however in both ITS and tef-1a trees the AG 3 PT branch that diverged from other AG 3 PT sequences corresponded to the same isolates MIAE00354 and MIAE00355. Isolates

MIAE00269 and MIAE00357 also were grouped in the same branch in both ITS and tef-1a trees. The analysis of ITS sequences is a widely used method for specific identification of fungal species (Anees et al. 2010, Geiser et al. 2004). Our results indicated that the gene tef-1a showed a greater diversity among AGs of R. solani than the ITS region. This shows the complementarity of sequences from two or more loci in multilocus sequence typing (MLST) approaches. Such MLST strategy is becoming widely used to analyze phylogenetic relationships among fungi such as Fusarium (Nitschke et al. 2009, O’Donnell et al. 2009) or Trichoderma (Anees et al. 2010, Kullnig-Gradinger et al. 2002). These have shown the interest of including tef-1a gene in such studies; however the use of this gene to analyze genetic diversity within R. solani has not been published and only 33 sequences of tef-1a gene of R. solani were available in GenBank before this study. We used primers EF1-645F and EF1-1190R originally described for Alternaria spp. (Andersen et al. 2009). We adapted PCR conditions to amplify part of the tef1a gene from R. solani. Multigene approaches may be useful for more precise molecular identifications of species or AGs, when a unique locus such as ITS does not always provide clear information (Anees et al. 2010). ITS and tef-1a types did not show any relationship with the geographical origin of the isolates or the cultivar of origin. Moreover AFLP data did not show particular structure among the isolates belonging to the same AG. R. solani populations are consistent with predominantly asexual reproduction, short distance dispersal of vegetative propagules (mycelium or sclerotia) and long distance dispersal, possibly via contaminated seed. Our findings suggest the hypothesis that R. solani populations are constantly evolving after different genetic events. The absence of sporulation of R. solani may limit the dissemination of clonal isolates and may prevent the genetic organization of the populations. On the other hand, the diversity of the R. solani populations could be enriched by the spread of the fungal genes taking place within the field and at larger scale, among French departments and among countries separated by several hundred kilometers. As tubers are exchanged on the international market, seedborne inoculum could be the predominant cause of the long distance dispersal of the fungus. Indeed, potato tubers are vegetatively multiplied, which increases the risk of fungal transmission through infected seed tubers. Therefore these newly introduced genomes increase the diversity of the population by bringing in and exchanging genes with the endemic isolates.

FIERS ET AL.: RHIZOCTONIA SOLANI

DIVERSITY

1241

FIG. 4. Neighbor joining tree (Kimura two-parameter distance) of 23 tef-1a sequences of Rhizoctonia solani isolated from potato tubers from France and other countries. Strain MIAE00279 belonging to AG 5 includes one polymorphic site. Bootstrap values ($ 60%) are near the equivalent branches.

Despite the large diversity at intraspecific rank within R. solani, no evident relationship between cultivars and associated populations of R. solani was shown. Because there is no difference of pathogenicity among isolates of R. solani (Fiers et al. 2010) it seems that the severity of the disease depends mainly on environmental conditions and perhaps on the behavior of the cultivar. This aspect of the plantpathogen interaction was not studied in depth. Our study reveals the first evidence of genetic variability among R. solani associated with blemished potato tubers in France. However the genetic diversity of R. solani populations isolated from blemished tubers is not dependent on the geographical origin of the isolates or on the host cultivar. The lack of population structure suggests a constant evolution within R. solani. Such evolution should be promoted

by frequent genetic events, genetic mixing and anthropogenic activities. Further research is needed to determine the phenotypical characteristics of the isolates to set up adapted control strategies against R. solani. ACKNOWLEDGMENTS

The authors thank Jo´zefa Kapsa, Brice Dupuis, Jean-Marie Torche, James Woodhall, Jari Valkonen, and Shiro Kuninaga for providing R. solani isolates. We also thank Amanda Bennett for comments on the manuscript. Marie Fiers was financially supported by a doctoral grant from the National Association of Technical Research (ANRT) (CIFRE nu1085/ 2006). This work was part of a Program of Collaborative Research (PRC) between Bretagne Plants and Germicopa, subsidized by the Regional Council of Brittany.

1242

MYCOLOGIA

FIG. 5. Phylogenetic relationships among 89 isolates of Rhizoctonia solani inferred from AFLP data with a UPGMA analysis of Nei-Li distances. Bootstrap values ($ 50%) are above the equivalent branches.

FIERS ET AL.: RHIZOCTONIA SOLANI LITERATURE CITED

Almeida AMR, Abdelnoor RV, Calvo ES, Tessnman D, Yorinori JT. 2001. Genotypic diversity among Brazilian isolates of Sclerotium rolfsii. J Phytopathol Z 149:493– 502, doi:10.1046/j.1439-0434.2001.00651.x Andersen B, Sorensen JL, Nielsen KF, van den Ende BG, de Hoog S. 2009. A polyphasic approach to the taxonomy of the Alternaria infectoria species group. Fungal Genet Biol 46:642–656, doi:10.1016/j.fgb.2009.05.005 Anees M, Tronsmo A, Edel-Hermann V, Gordon Hjeljord L, He´raud C, Steinberg C. 2010. Characterization of field isolates of Trichoderma antagonistic against Rhizoctonia solani. Fungal Biol 114:691–701, doi:10.1016/j.funbio. 2010.05.007 Campion C, Chatot C, Perraton B, Andrivon D. 2003. Anastomosis groups, pathogenicity and sensitivity to fungicides of Rhizoctonia solani isolates collected on potato crops in France. Eur J Plant Pathol 109:983–992, doi:10.1023/B:EJPP.0000003829.83671.8f Carling DE. 1996. Grouping in Rhizoctonia solani by hyphal anastomosis reaction. In: Sneh B, Jabaji-Hare S, Neate S, Dijst G, eds. Rhizoctonia species: taxonomy, molecular biology, ecology, pathology and disease control. Dordrecht, the Netherlands: Kluwer Academic Publishers. p 37–47. ———, Baird RE, Gitaitis RD, Brainard KA, Kuninaga S. 2002. Characterization of AG-13, a newly reported anastomosis group of Rhizoctonia solani. Phytopathology 92:893–899, doi:10.1094/PHYTO.2002.92.8.893 Ceresini PC, Shew HD, James TY, Vilgalys RJ, Cubeta MA. 2007. Phylogeography of the Solanaceae-infecting Basidiomycota fungus Rhizoctonia solani AG-3 based on sequence analysis of two nuclear DNA loci. Bmc Evol Biol 7:163, doi:10.1186/1471-2148-7-163 El Bakali AM, Martin MP. 2006. Black scurf of potato. Mycologist 20:130–132, doi:10.1016/j.mycol.2006.03.006 Fatehi J, Bridge P. 1998. Detection of multiple rRNA-ITS regions in isolates of Ascochyta. Mycol Res 102:762– 766, doi:10.1017/S0953756297005704 Fiers M, Chatot C, Edel-Hermann V, Le Hingrat Y, Yanougo AK, Gautheron N, Guillery E, Alabouvette C, Steinberg C. 2010. Diversity of microorganisms associated with atypical superficial blemishes of potato tubers and pathogenicity assessment. Eur J Plant Pathol 128:353– 371, doi:10.1007/s10658-010-9657-2 Galtier N, Gouy M, Gautier C. 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci 12:543–548. Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes—application to the identification of mycorrhizae and rusts. Mol Ecol 2:113–118, doi:10.1111/j.1365-294X.1993.tb00005.x Geiser DM, Jimenez-Gasco MD, Kang SC, Makalowska I, Veeraraghavan N, Ward TJ, Zhang N, Kuldau GA, O’Donnell K. 2004. FUSARIUM-ID v. 1.0: a DNA sequence database for identifying Fusarium. Eur J Plant Pathol 110: 473– 479, doi:10.1023/B:EJPP. 0000032386.75915.a0

DIVERSITY

1243

Guillemaut C, Edel-Hermann V, Camporota P, Alabouvette C, Richard-Molard M, Steinberg C. 2003. Typing of anastomosis groups of Rhizoctonia solani by restriction analysis of ribosomal DNA. Can J Microbiol 49:556–568, doi:10.1139/w03-066 Justesen AF, Yohalem D, Bay A, Nicolaisen M. 2003. Genetic diversity in potato field populations of Thanatephorus cucumeris AG-3, revealed by ITS polymorphism and RAPD markers. Mycol Res 107:1323–1331, doi:10.1017/ S0953756203008517 Kimura M. 1980. A simple model for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120, doi:10.1007/BF01731581 Kullnig-Gradinger CM, Szakacs G, Kubicek CP. 2002. Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycol Res 106:757–767, doi:10.1017/ S0953756202006172 Kuninaga S, Carling DE, Takeuchi T, Yokosawa R. 2000. Comparison of rDNA-ITS sequences between potato and tobacco strains in Rhizoctonia solani AG-3. J Gen Plant Pathol 66:2–11, doi:10.1007/PL00012917 ———, Yokosawa R. 1984. DNA base sequence homology in Rhizoctonia solani Kuhn IV. Genet Ann Phytopathol Soc Japan 50:322–330. Lehtonen MJ, Ahvenniemi P, Wilson PS, German-Kinnari M, Valkonen JPT. 2008. Biological diversity of Rhizoctonia solani (AG-3) in a northern potato-cultivation environment in Finland. Plant Pathol 57:141–151. McDonald BA. 1997. The population genetics of fungi: tools and techniques. Phytopathology 87:448–453, doi:10.1094/ PHYTO.1997.87.4.448 Mougel C, Thioulouse J, Perriere G, Nesme X. 2002. A mathematical method for determining genome divergence and species delineation using AFLP. Int J Syst Evol Microbiol 52:573–586. Nei M, Li WH. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA 76:5269–5273, doi:10.1073/ pnas.76.10.5269 Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson KH. 2008. Intraspecific ITS variability in the kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evol Bioinform 4:193–201. Nitschke E, Nihlgard M, Varrelmann M. 2009. Differentiation of Eleven Fusarium spp. isolated from sugar beet, using restriction fragment analysis of a polymerase chain reaction-amplified translation elongation factor 1 alpha gene fragment. Phytopathology 99:921–929, doi:10.1094/PHYTO-99-8-0921 O’Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, Glenn A, Riley R, Zitomer NC, Colyer P, Waalwijk C, van der Lee T, Moretti A, Kang S, Kim HS, Geiser DM, Juba JH, Baayen RP, Cromey MG, Bithell S, Sutton DA, Skovgaard K, Ploetz R, Kistler HC, Elliott M, Davis M, Sarver BAJ. 2009. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Genet Biol 46:936–948, doi:10.1016/j.fgb.2009.08.006

1244

MYCOLOGIA

Ogoshi A. 1987. Ecology and pathogenicity of anastomosis and intraspecific groups of Rhizoctonia-Solani Kuhn. Annu Rev Phytopathol 25:125–143, doi:10.1146/annurev. py.25.090187.001013 Pannecoucque J, Hofte M. 2009. Detection of rDNA ITS polymorphism in Rhizoctonia solani AG 2-1 isolates. Mycologia 101:26–33, doi:10.3852/08-084 Parmeter JRJ. 1970. Rhizoctonia solani: biology and pathology. Berkeley: Univ California Press. 255 p. Perrie`re G, Gouy M. 1996. www-Query: an online retrieval system for biological sequence banks. Biochimie 78: 364–369, doi:10.1016/0300-9084(96)84768-7 Saitou N, Nei M. 1987. The neighbor joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. Sharon M, Kuninaga S, Hyakumachi M, Naito S, Sneh B. 2008. Classification of Rhizoctonia spp. using rDNA-ITS sequence analysis supports the genetic basis of the classical anastomosis grouping. Mycoscience 49:93–114, doi:10.1007/s10267-007-0394-0 Sneath PHA, Sokal RR. 1973. Numerical taxonomy. The principles and practice of numerical classification (A series of books in biology). San Francisco: W.H. Freeman & Co. xv + 573 p. Thioulouse J, Chessel D, Doledec S, Olivier JM. 1997. ADE4: amultivariate analysis and graphical display software. Stat Comput 7:75–83, doi:10.1023/A:1018513530268 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F,

Higgins DG. 1997. The Clustal_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876–4882, doi:10.1093/nar/25.24.4876 Vandepeer Y, Dewachter R. 1994. Treecon for Windows —a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10:569–570. Vos P, Hogers R, Bleeker M, Reijans M, Vandelee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M. 1995. AFLP—a new technique for DNA-fingerprinting. Nucleic Acids Res 23:4407–4414, doi:10.1093/nar/ 23.21.4407 White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press. p 315–322. Woodhall JW. 2008. Infection of potato by Rhizoctonia solani: effect of anastomosis group. Plant Pathol 57: 897–905, doi:10.1111/j.1365-3059.2008.01889.x ———, Lees AK, Edwards SG, Jenkinson P. 2007. Characterization of Rhizoctonia solani from potato in Great Britain. Plant Pathol 56:286–295, doi:10.1111/j.13653059.2006.01545.x Yohalem DS, Nielsen K, Nicolaisen M. 2003. Taxonomic and nomenclatural clarification of the onion neckrotting Botrytis species. Mycotaxon 85:175–182.

Suggest Documents