Genetics Reversible histone acetylation and deacetylation mediate

0 downloads 26 Views 967KB Size Report
Sep 15, 2004 - found to be statistically significant (α = 0.05 with multiple comparison .... expressed in the flower buds and 360 “flower-specific” genes were ...

Genetics: Published Articles Ahead of Print, published on September 15, 2004 as 10.1534/genetics.104.033142

Genetics Reversible histone acetylation and deacetylation mediate genome-wide, promoterdependent, and locus-specific changes in gene expression during plant development

Lu Tian†, M. Paulus Fong†, Jiyuan J. Wang†, Ning E. Wei‡, Hongmei Jiang§, R. W. Doerge§, and Z. Jeffrey Chen*†

Intercollegiate Programs in Genetics and Departments of Soil and Crop Sciences† and Computer Science‡, Texas A&M University, College Station, TX 77843-2474, USA

§Department of Statistics, Purdue University, West Lafayette, IN 47906, USA

*Z. Jeffrey Chen, corresponding author E-mail: [email protected] Phone: 979-845-3773

Abbreviations: AtHD or AtHDA, Arabidopsis thaliana histone deacetylase; ChIP: chromatin immunoprecipitation Key Words: Histone deacetylase, Epigenetic regulation, Chromatin, Plant development, Environment Running Title: Reversible histone deacetylation and plant development

Histone acetylation and deacetylation activate or repress transcription, yet the physiological relevance of reversible changes in chromatin structure and gene expression is poorly understood. We have shown that disrupting the expression of AtHD1 that encodes a putative Arabidopsis thaliana histone deacetylase induces a variety of developmental abnormalities. However, causal effects of the AtHD1 disruption on chromatin structure and gene expression are unknown. Using Arabidopsis spotted oligo-gene microarray analysis, here we report that >7% of the transcriptome was up- or down-regulated in A. thaliana plants containing a T-DNA insertion in AtHD1 (athd1-t1), indicating that AtHD1 provides positive and negative control of transcriptional regulation. Remarkably, genes involved in ionic homeostasis and protein synthesis, were ectopically expressed, whereas genes in ionic homoeostasis, protein transport, and plant hormonal regulation were repressed in athd1-t1 leaves or flowers, suggesting a role of AtHD1 in developmental and environmental regulation of gene expression. Moreover, defective AtHD1 induced site-specific and reversible acetylation changes in H3-Lys9, H4-Lys12, and H4 tetra-lysines (residues 5, 8, 12 and 16) in homozygous recessive and heterozygous plants. Transcriptional activation was locus-specific and often associated with specific acetylation sites in the vicinity of promoters, whereas gene repression did not correlate with changes in histone acetylation or correlated directly with H3-Lys9 methylation but not with DNA methylation. The data suggest that histone acetylation and deacetylation are promoter-dependent, locus-specific and genetically reversible, which provides a general mechanism for reversible gene regulation responsive to developmental and environmental changes.

2

Introduction

Acetylation and deacetylation of lysine residues in the N-termini of core histones are catalyzed by intrinsic histone acetyltransferases (HATs) and histone deacetylases (HDs, HDAs, HDACs), providing a mechanism for reversibly modulating chromatin structure and transcriptional regulation (BROWNELL and ALLIS 1996; JENUWEIN and ALLIS 2001). Hyperacetylation relaxes chromatin structure and activates gene expression, whereas hypoacetylation induces chromatin compaction and gene repression. In contrast to “cemented” chromatin modifications such as DNA and histone methylation (JENUWEIN and ALLIS 2001; RABINOWICZ et al. 2003; RICHARDS and ELGIN 2002), histone acetylation and deacetylation are reversible and therefore play a unique role in transcriptional regulation associated with developmental programs and environmental conditions, including day-length (TIAN et al. 2003), flowering (AUSIN et al. 2004; HE et al. 2003; KIM et al. 2004), osmotic and oxidative stress (BRUNET et al. 2004; DE NADAL et al. 2004), and cell aging (IMAI et al. 2000) Arabidopsis has 17 members of a putative histone deacetylase family (PANDEY et al. 2002). AtHD1, a RPD3 homolog in yeast, has four closely related members, namely, AtHD1 (or AtHDA19), AtHDA6, 7, and 9 (TIAN et al. 2003). Other members of the gene family include seven RPD3/HDA1-like genes, two SIR2 homologs, and four plant-specific HD2 genes (WU et al. 2003). Different members within a group might have evolved specific functions. Indeed, AtHDA6 is responsible for silencing transgenes, repetitive DNA, and rDNA loci (AUFSATZ et al. 2002; LIPPMAN et al. 2003; MURFETT et al. 2001; PROBST et al. 2004), whereas AtHD1 is a putative global transcriptional regulator throughout Arabidopsis development (TIAN and CHEN 2001; TIAN et al. 2003). Disrupting AtHD1 by anti-sense AtHD1 expression (TIAN and CHEN

3

2001) or T-DNA insertion (athd1-t1) (TIAN et al. 2003) induces various developmental abnormalities and ectopic expression of tissue-specific genes such as SUPERMAN (TIAN and CHEN 2001). It is unclear whether and how AtHD1 directly affects chromatin structure of the target genes and plant development. Using spotted oligo-gene microarrays (LEE et al. 2004), we analyzed genome-wide changes in gene expression in athd1-t1 lines during vegetative growth and flower development. Moreover, we examined histone acetylation and gene expression changes in the wild-type, heterozygous, and homozygous athd1-t1 plants using immuno-blot and chromatin immunoprecipitation (ChIP) assays. The data indicate that 1) AtHD1 both negatively and positively regulates the expression of different sets of genes during leaf and flower development; 2) disrupting AtHD1 induces site-specific and reversible changes in histone acetylation and irreversible changes in histone methylation; 3) gene activation is associated with increased levels of site-specific histone acetylation, whereas gene repression does not correlate with changes in histone acetylation or correlate with histone methylation; and 4) changes in gene expression and histone acetylation are locus-specific, occur in vicinity of the promoter, and are independent of DNA methylation. The data obtained in AtHD1 defective lines together with previous findings of the involvement of histone deacetylases in stress response (BRUNET et al. 2004; DE NADAL et al. 2004), flower development (AUSIN et al. 2004; HE et al. 2003; KIM et al. 2004; TIAN et al. 2003), and cell aging (HEKIMI and GUARENTE 2003; IMAI et al. 2000) suggest that reversible modifications of histone acetylation and deacetylation provide an active and dynamic mechanism for gene regulation responsive to changes in developmental programs and environmental cues.

4

Materials and Methods

Plant materials. Arabidopsis thaliana ecotype Ws (AtHD1/AtHD1, +/+), AtHD1/athd1-t1 (+/-), and athd1-t1/athd1-t1 (-/-) plants were produced as previously described (TIAN et al. 2003). The heterozygous plants (+/-) were generated by backcrossing the homozygous plants (-/-) to Ws (+/+) for inheritance studies on changes in histone acetylation and methylation. The plants were grown in a growth chamber with growth conditions of 22ºC/18ºC (day/night) and 14 hour of illumination per day. DNA and RNA were isolated from tissues collected from a pool of 32 plants in each line. Rosette leaves were collected at pre-bolting stage (~3 weeks) for DNA and RNA preparation and chromatin immunoprecipitation (ChIP), while flower buds were harvested after the first flower bloomed.

DNA and RNA analyses. Total RNA was extracted using the Trizol reagent (Invitrogen). DNA isolation and DNA or RNA blot analysis were performed as previously described (TIAN et al. 2003). For microarray and RT-PCR analyses, the mRNA was isolated from 500 µg of total RNA with FastTrack 2.0 mRNA isolation kit (Invitrogen). RT-PCR analysis was performed using ~500 ng of mRNA mixed with 1 µl of oligo-dT (Amersham) and 2 µg of random nonamer (Gene Link) in a total volume of 17 µl for denaturation and primer annealing using SuperScript II reverse transcriptase. The synthesized cDNA was purified by QIAquick kit (Qiagen) and adjusted to a final concentration of 15 ng/µl. An aliquot of 0.5 µl was used for PCR reaction in the volume of 25 µl using the primers designed according to the 3’ end sequences (tables S3-4). The PCR reaction included 1 cycle of 94ºC for 2 min, 30 cycles of 94ºC for 30 sec, 52ºC for 30

5

sec, and 72ºC for 1 min. The ACTIN2/7 gene was amplified and served as a control (TIAN et al. 2003). An aliquot of 5 µl RT-PCR products was used for agarose gel electrophoresis.

Microarray analysis. Spotted oligo-gene microarrays were developed as previously described (LEE et al. 2004). Gene names and accession numbers of the 26,090 70-mer oligos can be found at http://oligos.qiagen.com/arrays/oligosets_arabidopsis.php. Each slide was printed with 27,648 features, including 26,090 70-mer oligos and controls (CHEN et al. 2004). Slide hybridization, washing, and scanning were modified from a published protocol (LEE et al. 2004). Four repeated dye-swap experiments were performed in each comparison (e.g. Ws vs. athd1/athd1 in leaves) (fig. S1). The data were normalized using a robust local-linear regression (lowess) (CLEVELAND 1979) and analyzed statistically using a linear model (LEE et al. 2004). We selected the genes found to be statistically significant (α = 0.05 with multiple comparison correction) using the pergene variance assumption (table S1). Functional categories of up- and down-regulated genes in leaves and flower buds of the athd1-t1 line were classified using PENDANT (http://mips.gsf.de/proj/thal/db/index.html) and compared using Venn diagrams.

ChIP assays. ChIP was modified from a published protocol (LAWRENCE et al. 2004). Approximately 1 g of leaves or 0.5 g of flower buds was used for each ChIP assay. The fresh tissues were subjected to vacuum infiltration in a formaldehyde (1%) solution for cross-linking the chromatin proteins to DNA. Chromatin was extracted and sonicated (Fisher, Model 60 sonicator) at half maximal power for 5x10 sec pulses with chilling on ice for 3 min after each pulse. The average size of the resulted DNA fragments produced was ~0.3-1.0-kb. An aliquot of chromatin solution (1/10 of total volume) was used to determine the DNA fragment sizes and

6

serve as input DNA. The remaining chromatin solution was diluted 10-fold and divided into two aliquots. One aliquot was incubated by adding 10 µl of antibodies (anti-tetra-acetyl-histone H4, anti-acetyl-histone H4-K12, anti-dimethyl-histone H3-K9, or anti-acetyl-histone H3-K9, Upstate Biotechnology, NY). The other aliquot was incubated without antibodies (as a control). After incubation at 4ºC with rotation for overnight, the solution was added to 40 µl of DNA/protein A agarose and incubated for another 2 hours. The immunocomplexes were eluted and crosslinks were reversed by incubation at 65ºC for 6 hours. Residual protein was degraded by proteinase K and DNA was extracted and dissolved in 50 µl of ddH2O.

ChIP and chop PCR. An aliquot (1 µl) of ChIP DNA was used for semi-quantitative PCR analysis to determine the amount of genomic DNA immunoprecipitated in the ChIP assays (LAWRENCE et al. 2004) using the primer pairs designed from promoter and/or coding regions of the genes (tables S4-6), which amplified ~350-bp DNA fragments. The concentration of each ChIP DNA sample was adjusted empirically such that an equal amount of Act2/7 was amplified (TIAN et al. 2003). All PCR reactions were performed in 25 µl using 1.0 µl of immunoprecipitated DNA for 25-35 cycles of PCR amplification. For chop PCR, 1 µg of DNA was digested to completion using McrBC. PCR was performed using an aliquot of 50 ng of the digested DNA and the same primer pairs used in the ChIP assays in a 25-µl PCR reaction for 25 cycles of amplification.

7

Results and Discussion

Genome-wide analysis of gene expression changes in athd1-t1 lines. We analyzed transcriptome changes in the athd1-t1 line in leaves and flower buds, two important developmental stages. In each comparison, we performed four dye-swap experiments using two biological replicates (fig. S1, table S1). The data were analyzed using a linear model and the results were adjusted for multiple comparisons (LEE et al. 2004) in order to test the null hypothesis of no differential gene expression between the wild type (Ws) and athd1-t1. The data were analyzed using two versions of the same statistical test (i.e., t-test). The first analysis was based on a t-test using a common variance assumption for all genes, while the second analysis acknowledged the per-gene variances for individual genes via the biological replicates. The genes found to be statistically significant (α = 0.05) under per-gene variances included those that had relatively small fold-changes but may be biologically relevant (LEE et al. 2004). We detected 2,789 (or 10.7%) and 2,010 (or 7.8%) genes that were significantly different between Ws and athd1-t1 in leaves and flower buds, respectively (table S1). For further analyses using chromosomal display and semi-quantitative RT-PCR analysis, we selected the genes that were statistically significant, and more than ±1.25-fold changes between the two lines in the leaves (1,753 or 6.7%) or flowers (1,263 or 4.8%). The arbitral fold-cut (±1.25) was used because it is probably the fold-change limit that can be detected by other assays such as RT-PCR (LEE et al. 2004). Yeast RPD3 is a transcriptional regulator (BERNSTEIN et al. 2000; VOGELAUER et al. 2000) that affects many genes located near telomeres. To determine whether AtHD1 has specific chromosomal targets, we mapped the differentially expressed genes in five Arabidopsis

8

chromosomes (Fig. 1a), generating transcription maps in leaves and flowers in the athd1-t1 lines. The differentially expressed genes were randomly distributed relative to the oligo-gene density across five chromosomes. There was no obvious cluster of up- or down-regulated genes in a specific region. Moreover, relatively equal numbers of genes were up- or down-regulated in the athd1-t1 line, suggesting that AtHD1 is a negative and positive regulator of gene expression. A subset of the genes encoding transcription factors and homeotic proteins important to plant development detected in microarray analysis was verified by semi-quantitative RT-PCR or RNA blot analysis (Fig. 1b and tables S3-4). Notably, NO APICAL MERISTEM (NAM) gene was repressed in the athd1-t1 leaves, which may correlate with defective shoot apical meristems as previously observed in Arabidopsis (TIAN et al. 2003). A gene encoding ABC transporter (ABCT) that displayed a flower-specific expression pattern was ectopically expressed in the athd1-t1 leaves, whereas a glutathione transferase (GST) gene was repressed in the athd1-t1 leaves. Furthermore, of the differentially expressed genes detected, 871 (49.7%) were upregulated and 882 (50.3%) were down-regulated in the leaves; whereas 560 (44.3%) genes were up-regulated and 703 (55.7%) genes were repressed in the flowers (Figs. 1c and 1e). There is a little overlap between the up- (χ2 = 1,006, p ≈ 0) or down-regulated (χ2 = 1,056, p ≈ 0) genes in leaves and flowers, indicating that athd1-t1 induces silencing or ectopic expression of different sets of genes in two developmental stages. When the data were compared with the genes exhibiting tissue-specific expression patterns, 85 “leaf-specific” genes were ectopically expressed in the flower buds and 360 “flower-specific” genes were reactivated in the leaves of the athd1-t1 line. The data suggest that AtHD1 plays a role in developmentally regulated gene expression.

9

The differentially expressed genes detected in the athd1-t1 leaves and flowers were classified into 15 functional and one unclassified categories (ARABIDOPSIS GENOME INITIATIVE 2000) (Figs. 1d and f). Remarkably, the number of genes involved in ionic homeostasis and transport facilitation affected by athd1-t1 in both leaves and flowers was 40-85% higher than a genome-wide average, indicating a general role of AtHD1 in response to various growth conditions such as osmotic and oxidative stress and cell aging as observed in yeast and mammalian cells (BRUNET et al. 2004; DE NADAL et al. 2004; IMAI et al. 2000). The number of differentially expressed genes in plant hormonal regulation and protein synthesis was 40-150% higher in the leaves than in the flowers, suggesting an important role of AtHD1 in phytohormone-dependent gene regulation during vegetative growth. The genes in metabolism and cellular biogenesis were affected by athd1-t1 more in the flowers than in the leaves, suggesting a role of AtHD1 in rapid cell divisions and cellular growth during flower development (MEYEROWITZ 1996). Notably, transposons were underrepresented in the athd1-t1 lines, suggesting that in contrast to AtHDA6 (AUFSATZ et al. 2002; LIPPMAN et al. 2003; MURFETT et al. 2001; PROBST et al. 2004), AtHD1 generally does not affect repetitive DNA.

Changes in histone acetylation, methylation, and gene expression in the wild-type, heterozygous, and homozygous athd1-t1 plants. In order to study inheritance of changes in histone acetylation and methylation, the heterozygous plants (+/-) were generated by backcrossing the homozygous athd1-t1 plants (-/-) to wild-type plants (+/+). The overall levels of H4 tetra-lysine, H4-K12, and H3-K9 acetylation were increased 1.5-4 fold in the leaves of athd1-t1 homozygous (-/-) plants (Fig. 2), whereas H4 K5 acetylation levels were not affected (data not shown). Both wild-type (Ws, +/+) and heterozygous (+/-) plants had similarly low

10

levels of acetylated histones, suggesting that histone acetylation and deacetylation are reversible. However, H3-K9 methylation was decreased in both homozygous recessive and heterozygous plants, suggesting that histone methylation is irreversible and that some residual methylation remains in the heterozygous plants. In the athd1-t1 line the decreased levels of H3-K9-dimethyl correlated with the increased levels of H3-K9 acetylation, indicating a mutually exclusive competition between acetylation and methylation for the specific lysine residue (JENUWEIN and ALLIS 2001). Moreover, histone methylation appears to be suppressed in the homozygous plants to the same extent as in the heterozygous plants, even though the phenotypic effects are only observed when homozygous for the knockout mutation. Chromatin immunoprecipitation (ChIP) assay (LAWRENCE et al. 2004) was used to investigate the role of a specific histone modification in the expression of target gene in Ws, heterozygous, and homozygous athd1-t1 plants (Fig. 2b, Table 2, and table S5). Gene activation was related to hyper-acetylation of specific lysine residues with a few exeptions. H4-tetra and H3-K9 acetylation levels correlated with up-regulation of LHY and APRN and the H4-K12 acetylation level with activation of PGP1 and CSD2. Up-regulation of bzip11 was associated with H3-K9 acetylation but not H4-tetra acetylation, suggesting specificity for gene activation. Furthermore, bzip11 activation also correlated with lower levels of H3-K9-dimethyl, providing evidence that histone H3-Lys9 is the site for acetylation and methylation competition, leading to gene activation or repression. It is notable that the acetylation level of a few genes was increased in the heterozygous plants, suggesting that potential epigenetic lesions may be induced by athd1t1 via changes in “cemented” modifications such as histone methylation. Eight out of eleven genes tested (Figs. 2 and 3a, Table 2) were associated with acetylation and/or methylation changes in at least one specific lysine residue. SUP was up-

11

regulated in athd1-t1 plants and in plants over-expressing anti-sense AtHD1 (TIAN and CHEN 2001); however, no changes in acetylation were detected. Two genes were repressed but their acetylation levels remained unchanged in the sites examined. The data suggest that disrupting AtHD1 expression also indirectly affects a set of downstream genes by activating transcriptional activators or repressors, as observed in yeast rpd3 deletion mutants (BERNSTEIN et al. 2000; ROBYR et al. 2002). Alternatively, other specific untested lysine residues (JENUWEIN and ALLIS 2001) may be responsible.

Changes in histone acetylation and gene expression are locus-specific. Although histone acetylation directly affects the expression of target genes, it is unclear whether the altered acetylation status is localized or diffusible. To address this, we randomly selected two regions (~30 kb each) containing up-regulated and unaffected genes in chromosomes 2 and 4. ChIP analysis was performed for the selected loci and their neighboring genes (Table 2 and tables S35). Up-regulation of At2g36910 in the leaves and At4g34590 and At4g34620 in the flowers was associated with increased levels of H4-K12Ac and H3-K9Ac, respectively (Fig. 3a, b). Their neighboring genes located within the vicinity did not exhibit changes in acetylation levels. The data are reminiscent of results obtained from ChIP analysis of 88 genes in tobacco (CHUA et al. 2004). Histone H4 acetylation occurs in the 300-600-bp sequences of the promoters or coding regions for 1/3 of the genes. Together, the data suggest that unlike histone methylation, which may spread into neighboring heterochromatin regions (NOMA et al. 2001), histone acetylation targets specific loci and does not affect the adjacent chromosomal domains examined.

12

Changes in histone acetylation are detected within the vicinity of promoters. If histone acetylation is localized in a specific locus, it may affect promoters exclusively or other coding and non-coding sequences. To distinguish these scenarios, we mapped acetylation profiles in two loci, LHY (At1g01060) and ARPN (At2g02850), using primers designed to amplify individual DNA fragments spanning the promoters and coding sequences (Figs. 3c and 3d). As expected, both H4-tetra and H3-K9 acetylation levels were dramatically increased within the promoter region (~500-bp) of the genes. No acetylation changes were detected beyond 500-bp upstream of the start codon or downstream after the first exon. Thus, acetylation is localized to a relative small region from ~500-bp of the promoter to the first exon, suggesting that AtHD1 modifies the chromatin structure within the promoter to prevent transcriptional initiation.

No DNA methylation changes were detected in a subset of genes that display expression changes in athd1-t1 lines. Histone deacetylases are in the MeCP2 (NAN et al. 1998) and Dnmt1 (FUKS et al. 2000) complexes, suggesting that disrupting histone deacetylation may reduce DNA methylation levels, although changes in DNA methylation profiles in the centromeres and rDNA loci were not detected (TIAN and CHEN 2001). A “chop” assay without ChIP (LAWRENCE et al. 2004) using McrBC-digested DNA was used to determine whether the genes activated by histone acetylation are correlated with reduced levels of DNA methylation in the same loci (Fig. 2b and Fig 4a). None of the nine loci tested showed changes in DNA methylation between the Ws and athd1-t1 lines, although they displayed increased acetylation levels in at least one site (Table 1). As a control, the centromeres were de-methylated in ddm1 but not in athd1-t1 plants.

13

The data suggest a mechanistic role of reversible histone acetylation and deacetylation in the transcriptional control of gene expression responsive to developmental programs and environmental cues (Fig. 4b). Consistent with this model, AtHD1 acts primarily on euchromatic regions but not transposons and repetitive DNA, providing new evidence that AtHD1 and AtHDA6 may have diverged functions. It is believed that core histones are acetylated in cytoplasm before they are transported into cell nuclei and further incorporated into chromatin during assembly (BROWNELL and ALLIS 1996; KUO and ALLIS 1998). Histone deacetylases are recruited by transcriptional repressors, such as pRB (BREHM et al. 1998; LUO et al. 1998), YY1 (YANG et al. 1996), NcoR (ALLAND et al. 1997), and Ume6 (KADOSH and STRUHL 1997), to fine-tune the acetylated sites so that the genes are turned “off”. The genes remain active if hypoacetylated histones are acetylated by HATs or if the repressors are absent. The reversible acetylation and deacetylation process may provide a means to turn “on” or “off” gene expression during development. Indeed, hyper-acetylation of FLC that encodes a flowering repressor is controlled by FLD (HE et al. 2003), a homologue of a mammalian protein found in histone deacetylase complexes. FVE, a gene involved in autonomous pathway of flowering time, encodes a homolog of retinoblastoma-associated protein (AUSIN et al. 2004). FVE has dual roles in regulating FLC and cold-responses (KIM et al. 2004). Surprisingly, FLC expression and acetylation levels were not affected in the athd1-t1 lines that delayed flowering for three days (TIAN et al. 2003). It is likely that disrupting AtHD1 activates some other genes in the flowering pathways that normally repress flower transition. Alternatively, other histone deacetylase associated proteins may be involved (HE et al. 2003). There is evidence that gene expression on stress is induced by the interaction of MAPK Hog1 with the osmotic responsive promoters through recruitment of Rpd3-Sin3 histone

14

deacetylase (DE NADAL et al. 2004). Mammalian cells lacking the histone deacetylase complex are sensitive to osmotic stress. The data indicate that MAPK Hog1 recruits Rpd3-Sin3 and targets to the promoter of osmotic responsive genes leading to histone deacetylation, which activates gene expression. Although the actual link between histone deacetylation and gene activation is unknown, the responses to osmotic stress responsive genes are dependent on Rpd3Sin3 not other histone deacetylases. In plants, the mutation in FVE induces cold tolerance and late flowering (KIM et al. 2004). Moreover, Arabidopsis homologues of Gcn5 and Ada transcription factors interact with CBF1, a transcriptional activator involved in cold responsive gene expression (STOCKINGER et al. 2001). Transgenic plants over-expressing anti-sense AtHD1 display pleiotropic developmental abnormalities including early senescence (TIAN and CHEN 2001). SIR2, an NAD-dependent histone deacetylase, is associated with yeast cell aging (HEKIMI and GUARENTE 2003; IMAI et al. 2000; SMITH et al. 2000). SIRT1, a mammalian Sir2 homolog, appears to control the cellular response to oxidative stress by regulating the FOXO family of Forkhead transcription factors (BRUNET et al. 2004). It is plausible that reversible reactions of histone acetylation and deacetylation are responsible for perceiving environmental and developmental signals (Fig. 4b). These environmental signals are exerted by interacting with transcriptional activators (e.g., FOXO) (BRUNET et al. 2004), repressors (e.g., FVE) (AUSIN et al. 2004), and/or molecules involved in signal transduction (e.g., MAPK) (DE NADAL et al. 2004). These molecules recruit histone deacetylases to the promoters of the environmental or developmental responsive genes, which in turn remodels the chromatin and activates or represses transcription. The process is reversible so that the elevated levels of transcription may return to a “normal” state when the signals are removed or absent. However, if chromatin modifications involve histone or DNA methylation, the process is cemented and irreversible (JENUWEIN and

15

ALLIS 2001; RICHARDS and ELGIN 2002) and some residual effects may remain (STOKES et al. 2002; STOKES and RICHARDS 2002). To avoid this, a specific set of histone deacetylases such as AtHD1, Rpd3 (DE NADAL et al. 2004), and Gcn5 (STOCKINGER et al. 2001) may be involved in the modification of some specific lysine residues (e.g. H3-K9) to induce dynamic and reversible changes in gene regulation (Fig. 4b). The available data collectively suggest that histone acetylation and deacetylation play an active and reversible role in the modulation of gene expression in response to changes in developmental programs and environmental cues.

Acknowledgements

We thank Gary E. Hart for critical reading of the manuscript. The work was supported in part by grants from NIH (GM067015) to Z. J. C. and NSF (DBI0077774) to R. D. W. and Z. J. C.

16

References ALLAND, L., R. MUHLE, H. HOU, JR., J. POTES, L. CHIN et al., 1997 Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature 387: 49-55. ARABIDOPSIS GENOME INITIATIVE, 2000 Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815. AUFSATZ, W., M. F. METTE, J. VAN DER WINDEN, M. MATZKE and A. J. MATZKE, 2002 HDA6, a putative histone deacetylase needed to enhance DNA methylation induced by doublestranded RNA. EMBO J 2002: 6832-6841. AUSIN, I., C. ALONSO-BLANCO, J. A. JARILLO, L. RUIZ-GARCIA and J. M. MARTINEZ-ZAPATER, 2004 Regulation of flowering time by FVE, a retinoblastoma-associated protein. Nat Genet 36: 162-166. BERNSTEIN, B. E., J. K. TONG and S. L. SCHREIBER, 2000 Genome-wide studies of histone deacetylase function in yeast. Proc Natl Acad Sci U S A 97: 13708-13713. BREHM, A., E. A. MISKA, D. J. MCCANCE, J. L. REID, A. J. BANNISTER et al., 1998 Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391: 597-601. BROWNELL, J. E., and C. D. ALLIS, 1996 Special HATs for special occasions: linking histone acetylation to chromatin assembly and gene activation. Curr Opin Genet Dev 6: 176-184. BRUNET, A., L. B. SWEENEY, J. F. STURGILL, K. F. CHUA, P. L. GREER et al., 2004 Stressdependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303: 2011-2015. CHEN, Z. J., J. WANG, L. TIAN, H.-S. LEE, J. J. WANG et al., 2004 The development of an Arabidopsis model system for genome-wide analysis of polyploidy effects. Biol J Linn Soci 82: 689-700. CHUA, Y. L., E. MOTT, A. P. BROWN, D. MACLEAN and J. C. GRAY, 2004 Microarray analysis of chromatin-immunoprecipitated DNA identifies specific regions of tobacco genes associated with acetylated histones. Plant J 37: 789-800. CLEVELAND, W. S., 1979 Robust locally weighted regression and smoothing scatterplots. J Amer Stat Assoc 74: 829-836. DE NADAL, E., M. ZAPATER, P. M. ALEPUZ, L. SUMOY, G. MAS et al., 2004 The MAPK Hog1 recruits Rpd3 histone deacetylase to activate osmoresponsive genes. Nature 427: 370374. FUKS, F., W. A. BURGERS, A. BREHM, L. HUGHES-DAVIES and T. KOUZARIDES, 2000 DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet 24: 8891. HE, Y., S. D. MICHAELS and R. M. AMASINO, 2003 Regulation of flowering time by histone acetylation in Arabidopsis. Science 302: 1751-1754. HEKIMI, S., and L. GUARENTE, 2003 Genetics and the specificity of the aging process. Science 299: 1351-1354. IMAI, S., C. M. ARMSTRONG, M. KAEBERLEIN and L. GUARENTE, 2000 Transcriptional silencing and longevity protein Sir2 is an NAD- dependent histone deacetylase. Nature 403: 795800. JENUWEIN, T., and C. D. ALLIS, 2001 Translating the histone code. Science 293: 1074-1080.

17

KADOSH, D., and K. STRUHL, 1997 Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89: 365-371. KIM, H. J., Y. HYUN, J. Y. PARK, M. J. PARK, M. K. PARK et al., 2004 A genetic link between cold responses and flowering time through FVE in Arabidopsis thaliana. Nat Genet 36: 167-171. KUO, M. H., and C. D. ALLIS, 1998 Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20: 615-626. LAWRENCE, R. J., K. EARLEY, O. PONTES, M. SILVA, Z. J. CHEN et al., 2004 A concerted DNA methylation/histone methylation switch regulates rRNA gene dosage control and nucleolar dominance. Mol Cell 13: 599-609. LEE, H. S., J. WANG, L. TIAN, H. JIANG, M. A. BLACK et al., 2004 Sensitivity of 70-mer oligonucleotides and cDNAs for microarray analysis of gene expression in Arabidopsis and Brasssica. Plant Biotechnol J 2: 45-57. LIPPMAN, Z., B. MAY, C. YORDAN, T. SINGER and R. MARTIENSSEN, 2003 Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification. PLoS Biol 1: E67. LUO, R. X., A. A. POSTIGO and D. C. DEAN, 1998 Rb interacts with histone deacetylase to repress transcription. Cell 92: 463-473. MEYEROWITZ, E. M., 1996 Plant development: local control, global patterning. Curr Opin Genet Dev 6: 475-479. MURFETT, J., X. J. WANG, G. HAGEN and T. J. GUILFOYLE, 2001 Identification of Arabidopsis histone deacetylase hda6 mutants that affect transgene expression. Plant Cell 13: 10471061. NAN, X., H. H. NG, C. A. JOHNSON, C. D. LAHERTY, B. M. TURNER et al., 1998 Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 393: 386-389. NOMA, K., C. D. ALLIS and S. I. GREWAL, 2001 Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science 293: 1150-1155. PANDEY, R., A. MULLER, C. A. NAPOLI, D. A. SELINGER, C. S. PIKAARD et al., 2002 Analysis of histone acetyltransferase and histone deacetylase families of Arabidopsis thaliana suggests functional diversification of chromatin modification among multicellular eukaryotes. Nucleic Acids Res 30: 5036-5055. PROBST, A. V., M. FAGARD, F. PROUX, P. MOURRAIN, S. BOUTET et al., 2004 Arabidopsis histone deacetylase HDA6 is required for maintenance of transcriptional gene silencing and determines nuclear organization of rDNA repeats. Plant Cell 16: 1021-1034. RABINOWICZ, P. D., W. R. MCCOMBIE and R. A. MARTIENSSEN, 2003 Gene enrichment in plant genomic shotgun libraries. Curr Opin Plant Biol 6: 150-156. RICHARDS, E. J., and S. C. ELGIN, 2002 Epigenetic codes for heterochromatin formation and silencing: rounding up the usual suspects. Cell 108: 489-500. ROBYR, D., Y. SUKA, I. XENARIOS, S. K. KURDISTANI, A. WANG et al., 2002 Microarray deacetylation maps determine genome-wide functions for yeast histone deacetylases. Cell 109: 437-446. SMITH, J. S., C. B. BRACHMANN, I. CELIC, M. A. KENNA, S. MUHAMMAD et al., 2000 A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc Natl Acad Sci U S A 97: 6658-6663.

18

STOCKINGER, E. J., Y. MAO, M. K. REGIER, S. J. TRIEZENBERG and M. F. THOMASHOW, 2001 Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interactions with CBF1, a transcriptional activator involved in cold-regulated gene expression. Nucleic Acids Res 29: 1524-1533. STOKES, T. L., B. N. KUNKEL and E. J. RICHARDS, 2002 Epigenetic variation in Arabidopsis disease resistance. Genes Dev 16: 171-182. STOKES, T. L., and E. J. RICHARDS, 2002 Induced instability of two Arabidopsis constitutive pathogen-response alleles. Proc Natl Acad Sci U S A 99: 7792-7796. TIAN, L., and Z. J. CHEN, 2001 Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development. Proc Natl Acad Sci U S A 98: 200-205. TIAN, L., J. WANG, M. P. FONG, M. CHEN, H. CAO et al., 2003 Genetic control of developmental changes induced by disruption of Arabidopsis histone deacetylase 1 (AtHD1) expression. Genetics 165: 399-409. VOGELAUER, M., J. WU, N. SUKA and M. GRUNSTEIN, 2000 Global histone acetylation and deacetylation in yeast. Nature 408: 495-498. WU, K., L. TIAN, C. ZHOU, D. BROWN and B. MIKI, 2003 Repression of gene expression by Arabidopsis HD2 histone deacetylases. Plant J 34: 241-247. YANG, W. M., C. INOUYE, Y. ZENG, D. BEARSS and E. SETO, 1996 Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci U S A 93: 12845-12850.

19

Figure Legends Fig. 1. a. Chromosomal distribution of differentially expressed genes in the athd1-t1 leaves (L) and flowers (F). The 70-mer oligos were mapped in five chromosomes using the annotated gene sequences correspondent to genomic coordinates, as shown in color gradients from high (red) to low (blue) gene-density. The up- and down-regulated genes in the athd1-t1 lines are indicated by the vertical lines above or below the horizontal line, respectively, which are proportional to natural logarithm fold-changes of gene expression between the athd1-t1 and Ws and lines. b. RTPCR and Northern blot analyses of differentially expressed genes (tables S3-4) in leaves (L) and flowers (F) of Ws and athd1-t1 lines. c. Only 4.6% of the up-regulated genes detected in the leaves and flowers overlapped. d. The relative ratio in Y-axis was calculated using the percentage of up-regulated genes of each functional category detected in the athd1-t1 lines divided by the percentage of ~26,000 annotated genes in the same category in the genome (ARABIDOPSIS GENOME INITIATIVE 2000). Dashed line (100) indicates the percentage of all annotated genes in this functional category is equal to the percentage of the genes that are upregulated in the athd1-1 lines. e. Only 5.7% of the down-regulated genes detected in the leaves and flowers overlapped. f. The percentages of down-regulated genes detected were analyzed using the same method as in d.

Fig. 2. Effects of athd1-t1 on histone acetylation, methylation and gene expression. a. H3-K9Ac, H4-tetraAc and K12Ac were hyper-acetylated and H3-K9 was hypo-methylated in athd1-t1 lines. The ratios indicate relative abundance of proteins in the athd-t1 homozygous (-/-) and heterozygous (+/-) plants compared to Ws (+/+). C.H.: purified core histones. b. ChIP assays show a correlation of histone acetylation and methylation with gene activation and silencing,

20

respectively. Semi-quantitative PCR was used to estimate relative enrichment of DNA fragments in the chromatin immunoprecipitates by specific antibodies as shown. Act2 was amplified as a control for DNA quantification. “Input” (I) and “Mock” (M) indicate PCR products amplified using the DNA recovered from the chromatin complexes before ChIP analysis and without antibodies, respectively. Fold-changes in the heterozygous and homozygous plants relative to the wild type are shown under each lane, except for no changes in Act2 or a missing sample in bzip11 (H3-K9Me). Act2 was also hyper-acetylated in the athd1-t1 lines.

Fig. 3. The effects of athd1-t1 on histone acetylation in chromosomal domains and within a locus. a. A ~30-kb segment of chromosome 2 contains the At2g36910 locus that was upregulated in the leaves. The arrows and boxes indicate the directions and levels of gene expression. ChIP assays showed that locus At2g36910 was hyper-acetylated whereas two neighboring loci, At2g36890 and At2g36920, were not affected in the athd1-t1 line. b. ChIP analysis on a ~28-kb segment of chromosome 4. The two loci (At4g34590 and 34620) were hyper-acetylated and up-regulated in the flowers. Acetylated levels of the loci flanking or between the two up-regulated genes remained unaffected. Input (I) and mock (M) controls are shown for At4g34620. Fold-changes in (+/- and -/-) lines relative to the wild type are shown below each lane. c. Histone acetylation in the promoter region is associated with gene activation. A diagram showed the genomic sequence of LHY (At1g016060) including the start codon (ATG, +1), exons (boxes), and introns (lines). ChIP was performed using antibodies against H4-tetraAc and H3-K9Ac. The location of amplified PCR fragments was shown as double arrows. The amount of PCR products relative to the Act2 control was quantified and shown a histogram. d. The same ChIP analysis in c was performed for ARPN (At2g02850).

21

Figure 4. DNA methylation in athd1-t1 lines and a model for the role of histone acetylation and deacetylation in plant development. a. DNA methylation was not affected in genes that were upor down-regulated by histone acetylation or methylation. As a control, centromeric repeats were demethylated in the ddm1 mutant but not in the athd1-t1 line. b. A simple model indicates that reversible modifications of histone acetylation and deacetylation provide a flexible regulatory system for changes in gene expression in response to developmental programs and environmental cues. The developmental and environmental signals are perceived by signal molecules, transcriptional activators, and repressors that recruit HATs and HDs, respectively, resulting in changes in histone acetylation or deacetylation (e.g., H3-K9), which leads to transcriptional activation or repression. These changes are reversible when the signals are absent, except that changes in histone acetylation/deacetylation are coupled with other cemented changes in histone or DNA methylation as previously reviewed (JENUWEIN and ALLIS 2001; RICHARDS and ELGIN 2002), which may induce other epigenetic lesions. Thick, dashed, and thin arrows/lines indicate the interactions that are supported by the results from this report, this and other studies, and previous work, respectively (see text).

22

Table 1. The number of differentially expressed genes detected between Ws and athd1-t1 lines using microarray data that are analyzed using a linear model and a false discovery rate (FDR) multiple comparison correction. False Discovery Rate (FDR) (α = 0.05) Microarray experiment

Common

Per-gene

Shared

Per-gene variance with a

variance

variance

Leaves (Ws vs. athd1-t1)

477

2,789

260

1,753

Flower buds (Ws vs. athd1-t1)

359

2,010

87

1,263

fold-cut (±1.25)

Shared: shared sets of genes that whose expression level differences were found to be statistically significant using both common variance and per-gene variance; The last column indicates the number of differentially expressed genes using an arbitrarily cut for fold-change (±1.25) from the genes selected based on per-gene variance.

23

Table 2. ChIP analysis using a subset of differentially expressed genes detected between Ws and the athd1-t1 lines Acetylation or methylation profile Locus ID At1g14970

Description Putative auxin-independent

H4-

H4-

H3-

H3-

Tissue

Expression

tetraAc

K12Ac

K9Ac

K9Me

0

0

++

0

Leaf

++

0

++

0

n.d.

Leaf

++

0

++

0

0

Leaf

++

promoter (axi) At2g3691

Arabidopsis thaliana P glycoprotein (AtPGP1)

At2g2819

Putative copper/zinc superoxide dismutase (CSD2)

At3g23130

Superman

0

0

0

n.d.

Leaf

++

At1g02920

Glutathione S-transferase

0

0

0

0

Leaf

--

(GST11) At4g34590

BZip transcription factor

0

n.d.

++

--

Flower

++

At1g01060

Late elongated hypocotyls

++

n.d.

++

n.d.

Flower

++

protein (LHY) At2g02850

Plantacyanin (ARPN)

++

n.d.

++

n.d.

Flower

++

At2g22980

Putative serine carboxypeptide

0

n.d.

0

0

Flower

--

I (SCP)

Notes: “0”: small or no difference between Ws and athd1-t1; “++”: increased level of histone acetylation or gene expression; “--”: decreased level of histone acetylation, methylation or gene expression; and “n.d.”: not determined.

24

Supporting Online Materials 1. Microarray data are available at the website http://microarrayabc.tamu.edu/tian2004.htm (also see table S2) 2. fig. S1 3. tables S1-5

Figure Legends

fig. S1. Dye-swap microarray experimental design. A. RNA samples prepared from leaves of two treatments (Ws and athd1-t1) were reverse-transcribed and labeled using Cy3-dCTP and Cy5-dCTP. The samples were divided equally and mixed reciprocally to hybridize to two microarray slides containing 70-mer oligos designed from ~26,090 annotated genes. The experiment was repeated to generate four dye-swaps using 8 microarray slides. b. The same dyeswap experiment was performed for RNA prepared from flower buds.

25

table S1a. Microarray experimental design (Ws vs. athd1-t1 in leaves) Slide No. 1 2 3 4 5 6 7 8

Leaf RNA RNA1 RNA1 RNA1 RNA1 RNA2 RNA2 RNA2 RNA2

Cy3 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1

Cy5 athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws

Printing Pattern 1 1 2 2 1 1 2 2

Dye-swap 1 1 2 2 3 3 4 4

table S1b. Microarray experimental design (Ws vs. athd1-t1 in flower buds) Slide No. 9 10 11 12 13 14 15 16

Flower bud RNA RNA1 RNA1 RNA1 RNA1 RNA2 RNA2 RNA2 RNA2

Cy3 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1

Cy5 athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws athd1-t1 Ws

26

Printing Pattern 1 1 2 2 1 1 2 2

Dye-swap 1 1 2 2 3 3 4 4

table S2. Microarray data analysis using a liner model (CHEN et al. 2004; LEE et al. 2004). Each experiment consisted of four dye-swaps and eight slides as described in the Methods and shown below. The analyzed data can be viewed in a “scatter plot” or “text” or at the following website http://microarrayabc.tamu.edu/tian2004.htm. Experiment 1 Experiment 2

Ws vs. athd1-t1 (leaves) Ws vs. athd1-t1 (flower buds)

Common Variance (Plot, Text) Common Variance (Plot, Text)

Per-gene Variance (Plot, Text) Per-gene Variance (Plot, Text)

Notes. 1. In each experiment, a text-delineated table of the significant genes detected is displayed. For example, in experiment 1 for the comparison of gene expression between Ws and athd1-t1 in leaves, the list included 477 and 2,789 genes whose expression levels varied significantly using common and per-gene variance, respectively. The list was tabulated using locus ID and logarithm-fold changes. 2. The microarray data were generated using procedures provided by MIAME (http://www.mged.org/Workgroups/MIAME/miame.html). The data were obtained from five experiments as shown below. The detailed procedures for microarray and experimental design, slide printing, hybridization, targets (cDNA probes), data collection, and analysis were described in a previous paper (LEE et al. 2004). The data can be down-loaded for re-analysis or verification of data analysis using other statistical packages or commercial software in addition to the linear model used in this study. 3. Raw data (spot quantitation matrix) were generated using a GenePix 4000B scanner and GenePix Pro4.1 software (Axon Instruments). The data obtained from each slide will be displayed after clicking the slide number. 4. The raw data (hybridization intensities obtained in Cy3 and Cy5 channels) were converted using the logarithm function and subjected to analysis of variance (ANOVA) as described in the Methods section. No additional step of data processing was used.

27

table S3. RT-PCR and Northern blot analyses for a subset of genes in the leaves detected by microarray analysis No.

Locus

Description

Fold Change

1

*At1g02920

glutathione transferase

0.33

2

At4g06746

AP2 domain containing protein

0.35

3

At2g21650

myb family transcription factor

0.43

4

At5g56870

0.43

5

At3g29035

6

At4g19170

glycosyl hydrolase family 35 no apical meristem protein (NAM) neoxanthin cleavage enzyme (NC1)

7

At5g62920

0.45

8

At5g10760

9

At1g15125

response regulator 6 (ARR6) nucleoid DNA-binding protein cnd41-like protein similar to methyltransferaserelated

10

At1g55860

ubiquitin-protein ligase 1 (UPL1)

2.29

11

At3g24270

2.38

12

At3g22120

13

At5g07860

hypothetical protein cell wall-plasma membrane linker protein homolog hydroxycinnamoyl benzoyltransferase-related

14

At2g15090

2.80

15

*At2g36910

putative fatty acid elongase ABC transporter; multidrug resistance P-glycoprotein (pgp1)

16

At1g24020

3.13

17

*At2g28190

Bet v I allergen family copper/zinc superoxide dismutase (CSD2)

18

*At3g23130

Superman

n.s.

0.43 0.43

0.46 0.48

2.55 2.75

2.96

6.31

Primer sequences F: AGTTCCAGCCTTTGAAGATGGAGA R: AGAACCTTCTTAGCAGAAGGCCTA F: AAGAAGGAATGGTCATGACCGAGA R: TTACAATCCATATGCCTCCGGCAA F: GGCTCAATGTCTTCTTATGGCTCT R: CACTGCAGCTTCATGCTTCTCATC F: ATAAAGGAGTTCTTGGTCCGGTCA R: GAGATTCCGTTAGGATCACCACCT F: CGAATCGTGCTACTAAAGCCGGTT R: ACGCAATCAAGATTCACTGGACCA F: TGAAGATGATGGAAACAGCGTCGT R: TAACCCATGGAATCCGTACGGAAC F: TGGCTGAAGTTATGCTACCGAGGA R: ACGAGGCAAAATGTTCTCGGAGGA F: CTCTCACTACCGGCGCAAACAAC R: AACCATTGGGAGCAAAACCGACTC F: TTTGCATGCTAGGTCACAGGAGCT R: CATGACAGCGACTGAGAAGGGCAA F: ACGAAAGTCTCGCTTTTACCACCT R: TTCTGATGTTGTTTGCAGCCACAG F: GTTCCTGATTCAAGTTGGTGCAAC R: TCAAGCTAGACGAGTGGATCTGTC F: CACACCTAAACCTCCCACGACCA R: AGCGGGACATTTGAAGTCAGATGG F: TATCTTCTTTGCAGTCGCTGACTG R: TCCAAAGCTTCCATACACTCTGGA F: ATGGCAGGATTAGCCATGAAAGGA R: TTGTTCACAATCATGGAGGCGAGT F: TCGGTTATTGTGCAGAACACAGCA R: CTTCGGTCGCACATTCATGTCCA F: CCCAAAGCTTTCCCTAACGACTAC R: CAGCAAAGTCCTTGATGACATGTG F: CTGGTCTCACTCCAGGGCCTCA R: TAGAGCGGCGTCAAGCCAATCAC F: ACAGCATAGAGTTGAGGAACAGCT R: AACCCAAACGGAGTTCTAGATCCA

* The genes were also used for ChIP analysis; “n.s.” not significant or detectable.

28

Product (bp) 465 260 296 484 658 526 368 607 479 485 374 592 517 539 925 332 358 594

table S4. RT-PCR and Northern blot analyses for a subset of genes in the flower buds detected by microarray analysis

No.

Locus

1

*At2g22980

2

At4g27440

3

At3g45640

4

At1g68050

5

At5g45890

6

At3g26740

7

At2g38470

8

At5g66070

9

At1g62360

10

At5g32484

11

*At2g02850

12

At1g74020

13

At1g12560

14

*At4g34590

15

At3g62460

16

*At1g01060

Description putative serine carboxypeptidase I protochlorophyllide reductase precursor mitogen-activated protein kinase, putative (MAPK3)

Fold Change 0.30 0.36

Primer sequences F: ACGATATCAAGAGCAGCGTCGCAT R: TTACAAAGGCTGGGCACTGATCCA F: TTGGCGGGTAATGTACCACCGAAG R: CGAGCTTCTCACTGATCTCCCACA F: AGAGCACCTGAGCTTCTGTTGAAC R: TGTTGGATTGAGTGCTATGGCTTC

0.37

F-box protein senescence-specific cysteine protease SAG12 Light-regulated protein - related WRKY family transcription factor C3HC4-type zinc finger protein family homeobox protein –related similar to transposon related protein putative basic blue protein (plantacyanin) strictosidine synthase family

0.44

putative expansin bZIP family transcription factor

1.85

putative protein putative DNA binding protein

2.25

0.50 0.50 1.44 1.63

2.15

2.40

487

518 550

F: CAGGGAGCTCTGTTTATCAAACCA R: TCAGGTTCACAGAATTCTCCTCCA F: GAAACAAATGGTGGGAATGGTGGT R: AAATGAGGTCTCCTCGTTTGGTTC F: GAATCTTCCCTCCTCCTTTGGCAA R: AAGATGTCTTCTGCACAAGGGACA F: ATGCATATCAGTCACACCACCAAC R: GGGATTTGAATTGACACTCGACAC F: ACTGAAACAAAGTGGGCGCATGTG R: TGCCTTGGTGAATAGATCGGCTGA F: CAAGGGAAGAGGCAGTGCATCATG R: GCGGTGACTGCGATTTTCATATCG

1.75 1.83

311

492 F: CCGACATGGAAAGAGATCCCGACA R: TACAGATCCGAGTCTTGCCGGCTA F: GGTTGCGGCTATTGAAGGAGCAA R: AGAAGCTTTCATGGCAAGACCACA

0.45 0.47

Product (bp)

401 543 417 495 1066 378

F: ACAGGTGATCTTTACGTCGCCGAT R: GAATTCCAGCAAATGGTCCGGTGA F: CGGCGCTAAGCACGACATTGTTC R: CTTGTAAGTCTTACCGCCGCTCCA F: GTCGTCGGGAACAACTTCGTCGA R: AGAAGACGCCATGAGAGGCTGGT F: CACGGCTAGTAGCGAATACGGTAG R: AGAGTATCTTCTGGTCTGGGCGAT F: TGCAGTTCCAACTCCAGCAATGAC R: GCTTCTCCTTCCAATCGAAGCCTT

* The genes were also used in ChIP analysis.

29

652 551 451 548 786

table S5. Primer pairs used in ChIP analysis Locus

Amplification

1

At1g14970

c

2

At2g36910

c

3

At2g28190

c

4

At2g28190

p

5

At3g23130

c

6

At1g02920

c

7

At4g34590

c

8

At1g01060

c

9

At1g01060

p

10

At2g02850

c

11

At2g22980

c

Primer pairs F: CGGGTGGTCGATACAGTTCCTGA R: TCGCAAGGCTACATTATTCGCCAA F: CTCTGTTGGTGCTTTTGTCCATGG R: CGTTGTTTGTCTCTCTCCACTCCA F: CAACACAATCCTCGCATTCTCATC R: ACGAAGCAGATTGAACACTGAGAG F: AGCTTTGGTCACACATAAGATAGG R: GTAGGCACAAATACTTGTGTGAGA F: ATCAAATCATGGAAAAGCTCGCTT R: GAACTCACTTTTTTCCCCTGGGAA F: AGGAAACCAACTTGTCTCCCTTGG R: AGCAGAAGGCCTAGAAGTGATGTC F: GTCGTCGGGAACAACTTCGTCGA R: AGAAGACGCCATGAGAGGCTGGT F: GGAACAACGGTACATCTTCCTCTC R: CGCCACTTACCTGCTAAAAATCAG F: GCTGAGATTGCTTCTGGCTTCTCT R: AGTTTCTCAGCAGCCAAACAGAGA F: CCAAGGGAAGAGGCAGTGCATC R: TTGCCCATACTTAGAAGCAGCCAT F: TGGTGCCTTTCCTTGCAACTCAAG R: CTCTGCTGTGTGTCCACTTCCCTT

“c”: coding region; “p”: promoter region; “F”: forward; and “R”: reverse

30

Product size (bp) 369 374 359 349 264 370 451 390 344 328 372

c

e 5

40 oligos

Oligo density

Up-regulation

808

Leaf

796

Leaf Flower

Down-regulation

86

617

Flower

d

63 497

f

et ab C el T r ol l & g r an is s m D ow c C N A th r i p e s , t ce l l re yn d i v i o n C l l s c th i s el d e u es i o l & u at e, i s n l si ar h de gn c & fe al o m ag n tr m i n se anP u g , r n In sdoute ica tr c i n ti ac tiod on el nes l C u l a ti n a el r l u tr a ti o la ns n Tr r an p b sp i o g o rt en or tf es ac is ili ta ti o Pr ot En n Tr ei er n an I on sy g y sp n ic os h o th e on s m Pl eo i s an s & st vi th as ra or l is m pr on ot ei al n re gu s Ulat ncio lan ss i fi ed

a Mb

M

Fig. 1

10 15

1 oligo/100 Kb

300

250

180

160 140 120

20 25

1 log-fold change

200

150

100

50

0 Leaf Flower

Leaf Flower

30

1

F

b -/-

100 80 60 40

20 0

+/+

L CSD2

F CWML

2 PAP

L AP2

F MRP

3 Myb

L NAM

-/- +/+

4 L

F

5 L F Flower (F) Leaf (L)

Act2

ABCT

GST

Fig. 2

a

-/-

b

+/- +/+ C.H.

H4-tetra Ac

I M +/+ +/- -/1.0 1.3 1.2

LHY

H3 1.0 5.0 5.0

H2A H2B H4 H4-tetraAc 1.5

0.9

1.0

ARPN 1.0 1.1 2.5

Act2 1.0 1.2 1.2

H4-K12 Ac

1.0

1.2

Act2

1.0

H3-K9 Ac

0.5

bzip11 1.0 2.0 2.5

LHY H3-K9Me

0.6

1.0 1.0 10 1.0 2.0 5.0

1.0 H3-K9Ac

2.5

CSD2 PGP1

H4-K12Ac 4.0

bzip11

1.0 3.0 3.0

ARPN

1.0

1.0 2.0 3.0

Act2 H3-K9 Me

1.0 1.5 -

bzip11 Act2

Fig. 3

a

b

Chromosome 2 (~30 kb, Leaf)

Chromosome 4 (~28 kb, Flower)

At2g36890 At2g36900 At2g36910 At2g36920

At4g34580 At4g34590 At4g34600 At4g34620

H4-K12Ac +/+ +/- -/-

c

H3-K9Ac

+/+ +/- -/- +/+ +/- -/-

+/+ +/- -/- +/+ +/- -/LHY (At1g 01060)

Relative Ac ratio (athd-t1/Ws)

+/+ +/- -/- I M +/+ +/- -/H4-K12Ac H4-tetraAc H3-K9Ac

10 8 6 4 2

+/+: Ws (AtHD1/AtHD1) +/- : AtHD1/athd1-t1 -/- : athd1-t1/athd1-t1

- 1000

- 500

+1

+500

+1000

+1500

+2000

+2500

+3000

H4-tetraAc H3-K9Ac

d

+/+ -/-

+/+ -/-

+/+ -/-

Relative Ac ratio (athd-t1/Ws)

+/+ -/-

+/+ -/-

+/+ -/-

ARPN (At2g 02850)

10 8 6 4 2 - 1000

+/+ -/-

H4-tetraAc H3-K9Ac +/+: Ws (AtHD1/AtHD1) -/- : athd1-t1/athd1-t1

- 500

+1

+ 500

+ 1000

H4-tetraAc H3-K9Ac +/+ -/- +/+ -/-

+/+ -/-

+/+ -/-

+ 1500

+ 2000

Fig. 4 a

McrBC +/+ -/-

McrBC +/+ -/axi

bzip11

PGP1

LHY

CSD2

ARPN

SUP

SCP

GST11

GPDH

GPDH Centromere +/+ -/- +/+ -/-

McrBC -

-

+ +

b

Centromere DM1dm1 DM1dm1

-

-

+ +

Developmental programs and environmental cues

Signal molecules, Transcription activators or repressors

HDs & HATs

H3-K9

Cm Cemented H3-K9m

H3-K9Ac

Reversible

H3-K9

Ectopic expression

fig. S1

Suggest Documents