HACE1 reduces oxidative stress and mutant

HACE1 reduces oxidative stress and mutant Huntingtin toxicity by promoting the NRF2 response Barak Rotblata,b, Amber L. Southwellc, Dagmar E. Ehrnhoeferc, Niels H. Skottec, Martina Metzlerc, Sonia Franciosic, Gabriel Lepriviera, Syam Prakash Somasekharana, Adi Barokasa, Yu Dengc, Tiffany Tanga, Joan Mathersa, Naniye Cetinbasa, Mads Daugaarda, Brian Kwoka, Liheng Lia, Christopher J. Carniea, Dieter Finka, Roberto Nitschd, Jason D. Galpine, Christopher A. Aherne, Gerry Melinob,f, Josef M. Penningerd, Michael R. Haydenc, and Poul H. Sorensena,1 a Department of Molecular Oncology, British Columbia Cancer Research Centre, Vancouver, BC, Canada V5Z 1L3; bMedical Research Council, Toxicology Unit, Leicester University, Leicester LE1 9HN, United Kingdom; cCentre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, BC, Canada V5Z 4H4; dInstitute of Molecular Biotechnology of the Austrian Academy of Sciences, 1030 Vienna, Austria; eDepartment of Molecular Physiology and Biophysics, Carver College of Medicine, University of Iowa, Iowa City, IA 52242; fBiochemistry Laboratory, Istituto Dermopatico dell’Immacolata/Istituto di Ricovero e Cura a Carattere Scientifico, University of Rome “Tor Vergata,” 00133 Rome, Italy

Edited by Dennis A. Carson, University of California, San Diego, La Jolla, CA, and approved January 21, 2014 (received for review July 31, 2013)

Oxidative stress plays a key role in late onset diseases including cancer and neurodegenerative diseases such as Huntington disease. Therefore, uncovering regulators of the antioxidant stress responses is important for understanding the course of these diseases. Indeed, the nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the cellular antioxidative stress response, is deregulated in both cancer and neurodegeneration. Similar to NRF2, the tumor suppressor Homologous to the E6-AP Carboxyl Terminus (HECT) domain and Ankyrin repeat containing E3 ubiquitin–protein ligase 1 (HACE1) plays a protective role against stress-induced tumorigenesis in mice, but its roles in the antioxidative stress response or its involvement in neurodegeneration have not been investigated. To this end we examined Hace1 WT and KO mice and found that Hace1 KO animals exhibited increased oxidative stress in brain and that the antioxidative stress response was impaired. Moreover, HACE1 was found to be essential for optimal NRF2 activation in cells challenged with oxidative stress, as HACE1 depletion resulted in reduced NRF2 activity, stability, and protein synthesis, leading to lower tolerance against oxidative stress triggers. Strikingly, we found a reduction of HACE1 levels in the striatum of Huntington disease patients, implicating HACE1 in the pathology of Huntington disease. Moreover, ectopic expression of HACE1 in striatal neuronal progenitor cells provided protection against mutant Huntingtin-induced redox imbalance and hypersensitivity to oxidative stress, by augmenting NRF2 functions. These findings reveal that the tumor suppressor HACE1 plays a role in the NRF2 antioxidative stress response pathway and in neurodegeneration. ROS

NRF2 is critical for maintaining redox homeostasis, as Nrf2 knockout (KO) mice are prone to urethane-induced tumors (8) and NRF2 hyperactivity or deficiency is observed in cancer and neurodegeneration, respectively (9). Although KEAP1 oxidation is the most well-established mechanism of NRF2 regulation, other factors also promote NRF2 accumulation. These include p21 and p62 that interfere with KEAP1 binding to NRF2 (10, 11), protein kinase C that phosphorylates NRF2 to promote its accumulation (12), Ras pathway activation that enhances NRF2 mRNA expression (13), and H2O2 that increases NRF2 mRNA translation (14). Homologous to the E6-AP Carboxyl Terminus (HECT) domain and Ankyrin repeat containing E3 ubiquitin–protein ligase 1 (HACE1) is a tumor suppressor that is inactivated in human Wilms’ tumor and other cancers (15, 16). HACE1 is a HECT family E3 ligase (15–17) that binds to and ubiquitylates the GTPbound active form of Rac1, a Rho family GTPase (17, 18). HACE1 is ubiquitously expressed with relatively higher expression in heart, placenta, kidney, and brain (15). We recently found that HACE1 specifically targets activated Rac1 when the latter is Significance Oxidative stress is an important contributor to aging-associated diseases including cancer and neurodegeneration, and antioxidant stress responses are critical to limit manifestations of these diseases. We report that the tumor suppressor Homologous to the E6-AP Carboxyl Terminus domain and Ankyrin repeat containing E3 ubiquitin–protein ligase 1 (HACE1) promotes activity of the transcription factor, nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidative stress response. In Huntington disease patients, HACE1 is lost in the brain region most affected by the disease, namely the striatum, and restoring HACE1 functions in striatal cells expressing mutant Huntingtin protein provides protection against oxidative stress. Therefore, the tumor suppressor HACE1 is a new regulator of NRF2 and an emerging player in neurodegeneration.

| glutathione | aging | transcription factor

O

xidative stress contributes to the development of numerous late onset human diseases such as neurodegeneration and cancer (1, 2). Molecular mechanisms that sense and respond to increased reactive oxygen species (ROS) levels have evolved and are highly conserved. One such master regulator of the antioxidative stress response is the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2) (3). In response to increased ROS, NRF2 induces expression of antioxidant proteins such as Heme Oxygenase (HO1) and NAD(P)H dehydrogenase (quinine; NQO1) and key enzymes in the glutathione (GSH) biosynthesis pathway such as GSH synthetase (GSS) (4), collectively known as phase II detoxifying enzymes (5). NRF2 activity is tightly regulated by cellular redox balance. Under normal conditions, NRF2 is bound to the oxidative stress sensor KEAP1 to promotes NRF2 ubiquitylation and proteosomal degradation (6), resulting in low basal NRF2 activity. Under oxidative stress, KEAP1 becomes oxidized, disrupting its interaction with NRF2 (7), thus leading to stabilization and nuclear translocation of NRF2, where it transcribes its specific target genes. 3032–3037 | PNAS | February 25, 2014 | vol. 111 | no. 8

Author contributions: B.R., D.E.E., G.L., N.C., M.R.H., and P.H.S. designed research; B.R., A.L.S., N.H.S., M.M., S.P.S., A.B., T.T., J.M., M.D., B.K., L.L., C.J.C., and R.N. performed research; S.F., Y.D., D.F., J.D.G., C.A.A., G.M., and J.M.P. contributed new reagents/analytic tools; B.R. and R.N. analyzed data; and B.R., A.L.S., D.E.E., G.L., M.R.H., and P.H.S. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. Freely available online through the PNAS open access option. 1

To whom correspondence should be addressed. E-mail: [email protected].

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1314421111/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1314421111

B

WT

relative DCFDA

count DCFDA

*

2.0 1.5 1.0

* control +GSH

*

0.5 0

C

NS

2.5 WT control WT GSH KO control KO GSH

KO

WT

KO

1

*

0.5

0

WT KO

Fig. 1. HACE1 loss reduces antioxidative stress responses. (A) Hace1 WT or KO MEFs were treated with H2O2 (400 μM) or AR (10 μM) for 8 h, and cell death was determined by annexin V and propidium iodide (PI) staining. (Left) Typical FACS plots. (Right) Cell death relative to control. n = 3; *P < 0.05. (B) ROS levels in Hace1 WT and KO MEFs treated with GSH (1 μM; 16 h) or untreated controls were determined using 2′,7′–dichlorofluorescein diacetate (DCFDA) and FACS. (Left) Typical histograms. (Right) Relative fluorescence levels. n = 3; *P < 0.05; NS, nonsignificant. (C) GSH levels were measured in lysates obtained from Hace1 WT or KO MEFs. Values are relative to Hace1 WT. n = 3; *P < 0.05.

A

C

Results HACE1 Mediates Resistance to Oxidative Stress. To determine if

HACE1 is involved in cellular detoxification of oxidant load, we challenged Hace1 WT and KO mouse embryonic fibroblasts (MEFs) with H2O2 or arsenite (AR) and measured their ability to survive acute oxidative stress. Hace1 KO MEFs were significantly more sensitive to both forms of oxidative stress compared with WT MEFs (Fig. 1A). Moreover, HACE1 knockdown (kd) using specific siRNAs in HEK293T cells markedly increases cell death following AR treatment (Fig. S1 A and B). Under homeostatic conditions, HACE1 deficiency in MEFs and HEK293T cells results in redox imbalance reflected by increased ROS (Fig. 1B and Fig. S1 C and D) and decreased GSH levels (Fig. 1C and Fig. S1E). Supplementing Hace1 WT and KO MEFs with GSH eliminated the ROS difference between these cells (Fig. 1B) and reduced sensitivity of Hace1 KO MEFs to H2O2 (Fig. S1F). Together these results suggest that HACE1 mitigates oxidative stress, at least in part by maintaining oxidant detoxification capacity. Rotblat et al.

3

B

** control H2O2

2 1 0

WT

KO

H2O2 WT KO (h): 0 0.5 3 0 0.5 3 NRF2 HSC70 *

NRF/HSC70

bound to Rac1-dependent NADPH oxidase complexes, and therefore reduces ROS generation by these complexes (19). Of note, there are several reported similarities between Hace1 KO and Nrf2 KO mice. As in Nrf2 null mice (8), tumor incidence is dramatically enhanced in Hace1 KO mice when they age or are subjected to urethane treatment and ionizing radiation (16). Because these stresses are linked to enhanced oxidative stress, we hypothesized that HACE1 may play a role in the oxidative stress response. Here we report that HACE1 is an important component of the cellular ROS detoxification and antioxidative stress responses by facilitating optimal activation of NRF2. This has potential consequences for neurodegenerative diseases such as Huntington disease (HD), as HACE1 protects neuronal progenitor cells from mutant Huntingtin (mHTT) toxicity by augmenting the NRF2 response. Moreover, its expression is markedly reduced in HD striatum, implicating HACE1 inactivation in the pathogenesis of HD.

*

8 4

D

4

WT

*

*

H2O2 AR

2

0

0.5

*

4

8

WT KO *

1.0

0.5

F

*

0

KO

3

*

*

1.5

8

*

WT KO

3.0

0

0

E

*

25 WT 20 KO 15 10 5 0 H2O2 (h): 0 4

0

0 0.5 3 0 0.5 3 H2O2 (h)

AR: - - + + siCont: + - + siHACE1: - + - + HACE1 GAPDH

total cell lysate

AHA-NRF2

0 WT KO KO vector NRF2

AHA-eEF2

pull down

AHA-GAPDH

Fig. 2. HACE1 promotes NRF2 activity, stability, and synthesis. (A) Hace1 WT or KO MEFs cotransfected with antioxidative stress response elementluciferase (ARE-LUC) and pRenilla vectors were treated with H2O2 (200 μM; 6 h), as indicated. NRF2 activity was determined by measuring luciferase activity. n = 3; *P < 0.01; **P < 0.005. (B) Hace1 WT or KO MEFs were treated with H2O2 (200 μM) for the indicated times. Hmox1 and Nqo1 mRNA levels were determined using qRT-PCR. n = 3; *P < 0.01. (C) Hace1 WT or KO MEFs were treated with H2O2 (200 μM) for the indicated times. NRF2 protein levels were determined using Western blot. NRF2 levels were normalized to HSC70. n = 3; *P < 0.05. (D) Hace1 WT or KO MEFs were treated with H2O2 (200 μM) for the indicated time points. NRF2 localization was determined using immunofluorescence. Typical images are shown on the left. Cells exhibiting nuclear or cytosolic localization were scored. n = 200 from three independent experiments; *P < 0.01. (E) Hace1 WT or KO MEFs transfected with NRF2-expressing or control vector were treated with H2O2 (600 μM) or AR (10 μM) for 8 h. Cell death was measured by annexin V and PI staining and presented relative to WT cells. n = 3; *P < 0.01. (F) HEK293T cells were transfected as in E. Cells were pulsed with AHA (250 μM; 1 h) and MG132 to block protein degradation with or without AR (1 μM) as indicated. HACE1 kd in total cell lysates was confirmed using Western blot. Cell lysates were subjected to a Click-it reaction with biotin alkyne followed by streptavidin pulldown, and newly synthetized proteins were detected by Western blot.

PNAS | February 25, 2014 | vol. 111 | no. 8 | 3033

CELL BIOLOGY

0

Nqo1 mRNA

0.75

annexin V

fraction of cells with nuclear NRF2

43.68

35

Hmox1 mRNA

9.10

H2O2 AR

H2O2 (h)

70.13

*

HACE1 Is Essential for Optimal NRF2 Activation. To better characterize how HACE1 impacts cellular antioxidant levels, we investigated whether HACE1 might regulate NRF2 directly. We first measured NRF2 transcriptional activity using a vector encoding luciferase driven by the NQO1 promoter (20). NRF2 activity was significantly reduced in Hace1 KO compared with WT MEFs under resting and oxidative stress conditions (Fig. 2A). In addition, expression levels of the NRF2 target genes Hmox1 and Nqo1 were significantly reduced in Hace1 KO MEFs compared with WT MEFs under oxidative stress (Fig. 2B), suggesting that HACE1 is required for optimal NRF2 activation in response to oxidative stress. To determine how HACE1 affects NRF2 activity, we first assessed NRF2 protein accumulation in Hace1 WT and KO MEFs treated with H2O2, as NRF2 protein stability is a major homeostatic mechanism (21). Although NRF2 levels were induced by H2O2 in both cell lines at the early time point (0.5 h),

ARE-LUC/Renilla

20.08

*

relative cell death

KO 12.11 35.49

PI

WT 0.59

70

relative GSH

AR treated MEFs % cell death

A

3034 | www.pnas.org/cgi/doi/10.1073/pnas.1314421111

HACE1 Is Involved in Regulation of Redox Balance in Brain Tissues. To determine the physiological relevance of these findings, we asked if HACE1 plays a role in regulating redox and the antioxidative stress response in vivo. Given the known role of oxidative stress in neurodegeneration and expression of HACE1 in brain (15), we measured ROS, antioxidant levels, and oxidative stress markers in brains of Hace1 KO mice. In line with our findings in other tissues (19), Hace1 KO brain tissue exhibited increased ROS levels (Fig. 3A). We also observed reduced GSH levels in Hace1 KO compared with WT control brains (Fig. 3B). By immunohistochemistry (Fig. 3A), there was a significant reduction in levels of NQO1 in Hace1 KO brain tissue, which was accompanied by decreased Nqo1 mRNA levels (Fig. 3C). NQO1 is a well-established marker of the antioxidative stress response and NRF2 activity (5, 13), supporting a role for HACE1 in this pathway in vivo. Moreover, there was increased oxidative damage in Hace1 KO mouse brains as they exhibit higher levels of protein carbonylation (Fig. 3D) and DNA oxidation (Fig. 3E) compared with Hace1 WT brains. Together, these data provide strong evidence for increased oxidative stress accompanied by reduced antioxidant GSH and NQO1 levels in brain tissues of Hace1 KO mice, further supporting a role for HACE1 in promoting ROS detoxification in vivo. HACE1 Is an Oxidative Stress Response Gene. Next we asked whether the HACE1 gene itself responds to oxidative stress, as predicted if HACE1 is linked to antioxidative stress responses. Because HACE1 expression is high in both neural tissue and kidney, we

B

Hace1 KO

WT KO

relative NQO1

1.5

E Hace1 WT

relative GSH

*

*

1

0.5 0

WT KO

Hace1 KO 8-oxo-dGuo positive cells / field

250

*

200 150 100 50 0

WT

KO

* 1 0.5 0

C

Nqo1 mRNA

relative DHE

NQO1

2.5 2 1.5 1 0.5 0

1.5

WT KO

*

1.0 0.5 0

D protein carbonylation (nM/mg)

Hace1 WT

DHE

A

H&E

HACE1 Promotes NRF2 Protein Stabilization and Synthesis. We next asked how HACE1 promotes NRF2 accumulation. We first assessed NRF2 degradation rates under oxidative stress in control siRNA versus HACE1 kd HEK293T cells subjected to cycloheximide challenge to block translation. We found that the degradation rate of NRF2, but not of c-Jun and c-Myc, which also have short half-lives, was markedly increased in HACE1 kd compared with control cells (Fig. S2 F and G). Proteasome inhibition with MG132 only partially rescued NRF2 accumulation in HACE1 kd cells under AR treatment (Fig. S2H). This suggests that HACE1 promotes NRF2 induction through NRF2 stabilization and a degradation-independent mechanism. Nrf2 mRNA levels were not reduced in Hace1 KO compared with WT MEFs (Fig. S2I), excluding a transcriptional mechanism for the latter. We therefore tested whether HACE1 promotes NRF2 protein synthesis, as NRF2 nuclear localization under oxidative stress is dependent on de novo NRF2 synthesis (22). To compare NRF2 synthesis rates between HACE1 kd and control cells, we used the methionine analog azidohomoalanine (AHA) to monitor newly synthesized proteins as described (23). Nontreated and AR-treated cells were pulsed with AHA for 1 h, and then lysates were isolated and assessed for levels of AHA-labeled NRF2 and the control proteins, eukaryotic Elongation Factor 2 (eEF2) and GAPDH (Fig. 2F). The protein synthesis rate of NRF2 but not of eEF2 or GAPDH was greatly reduced in HACE1 kd cells compared with control cells, under both resting and oxidative stress conditions, providing compelling evidence that HACE1 also supports NRF2 accumulation by promoting NRF2 protein synthesis. To demonstrate which domains of HACE1 influence NRF2 accumulation, we overexpressed HACE1 or various HACE1 mutants in HEK293 cells treated with the NRF2 inducer tertbutylhydroquinone (tBHQ) (22) and monitored NRF2 levels by Western blotting (Fig. S2J). HACE1 promoted NRF2 accumulation under both resting and tBHQ conditions in an E3 ligaseindependent manner, as the E3 ligase dead mutant, HACE1– C876S (CS) (15), equivalently induced NRF2 levels (Fig. S2J). However, this was not observed when either the HACE1 Nterminal ankyrin repeats or the C-terminal HECT domain were deleted (Fig. S2J). These data indicate that HACE1 induces NRF2 accumulation independently of its E3 ligase activity, and

that the ankyrin repeats and HECT domain are necessary for its NRF2 promoting activity.

8-oxo-dGuo

there was an additional increase in NRF2 protein levels at the latter time point (3 h) in WT cells that was attenuated in Hace1 KO MEFs (Fig. 2C). This was confirmed using subcellular fractionation, whereby NRF2 levels increased in nuclear fractions of H2O2 treated Hace1 WT and KO MEFs at 0.5 h, but were further elevated at 3 h only in WT MEFs (Fig. S2A). Immunofluorescence showed enhanced NRF2 nuclear localization in both WT and Hace1 KO cells at 0.5 h after H2O2 treatment (Fig. 2D). Nuclear localization was retained in Hace1 WT MEFs at the 3 h time point, whereas, in contrast, it was markedly reduced in Hace1 KO MEFs at this time point (Fig. 2D). To confirm this in a second cell line, we performed HACE1 kd in HEK293T cells, which led to reduced total NRF2 levels under AR treatment (Fig. S2 B and C). Moreover, HACE1 kd reduced nuclear NRF2 accumulation in HEK293T cells upon AR treatment (Fig. S2D). These data suggest that HACE1 is involved in optimal expression and nuclear localization and/or retention of NRF2 under oxidative stress, and that reduced NRF2 activity in HACE1-deficient cells may be attributed to defective NRF2 protein accumulation and nuclear localization. We then asked whether NRF2 perturbation is responsible for the hypersensitivity of Hace1 KO cells to oxidative stress. In keeping with this, ectopic expression of NRF2 in Hace1 KO MEFs significantly reduced their sensitivity to oxidative stress (Fig. 2E and Fig. S2E), suggesting that HACE1 protects against oxidative stress by promoting NRF2.

5 4 3 2 1 0

WT KO

*

WT

KO

Fig. 3. HACE1 loss is associated with reduced antioxidants and increased oxidative stress in brain. (A) The striatal regions of Hace1 WT and KO brains were stained using dihydroethidium (DHE), anti-NQO1 antibodies, or H&E as indicated. Sections were imaged using a fluorescent (DHE) or light microscope (NQO1 and H&E). Staining was quantified using ImageJ. n = 3; *P < 0.05. (B) GSH levels were measured in brain lysates from Hace1 WT and KO mice. Values were normalized to WT. *P < 0.05. (C) Nqo1 mRNA levels in mouse brains determined by qRT-PCR. *P < 0.01. (D) Protein carbonylation was measured in Hace1 WT and KO mouse brains. *P < 0.05. (E) Hace1 WT and KO mouse brains were subjected to anti–8-oxo-dGuo immunohistochemistry. Staining in the cortex was quantified using ImageJ. *P < 0.001.

Rotblat et al.

7

0 MSCV HACE1 CS Q111

20

*

* cont H2O2

10 0 MSCV HACE1 CS Q111

E

3 *

2 1

cont H2O2

*

0 MSCV HACE1 Q111

Fig. 4. HACE1 mitigates mHTT-associated oxidative stress and toxicity. (A) GSH levels in the indicated STHdh cells lysates were measured and presented relative to MSCV. n = 3; *P < 0.05. (B) STHdh cells were grown in complete media or serum starved for 6 h. ROS were measured using DCFDA. (Left) Average geometric means relative to MSCV. n = 3; *P < 0.05. (Right) Typical FACS histograms. (C) The indicated STHdh cells were serum starved for 24 h. Cell death was measured using PI staining. n = 3; *P < 0.05. (D) The indicated STHdh cells were treated with H2O2 (400 μM; 24 h) and cell death was measured using PI staining. n = 3; *P < 0.05. (E) NRF2 activity in STHdh cells transfected with the indicated constructs and treated with H2O2 (200 μM) for 8 h was measured using ARE–LUC assay. n = 3; *P < 0.05.

used SH-SY5Y neuroblastoma and HEK293T cells, respectively, and challenged them with H2O2 or AR as exogenous sources of oxidative stress. Transcripts of HACE1 and NQO1 (as an oxidative stress marker) were both induced by H2O2 and AR in SHSY5Y cells (Fig. S3A), and by AR but not by H2O2 in HEK293T cells (Fig. S3B). In agreement, both HACE1 promoter activity (Fig. S3C) and protein expression (Fig. S3D) were induced by AR in HEK293T cells. Together, these results indicate that HACE1 is an oxidative stress response gene, providing further support to the premise that it has evolved a functional role in redox control. HACE1 Protects Against mHTT Toxicity by Promoting NRF2. Oxidative stress is a common feature in neurodegenerative diseases and is implicated in the pathogenesis of HD (2). We therefore hypothesized that in addition to its tumor suppressor function, HACE1 may also play a protective role in neurodegeneration. We chose HD as a model disease to test this, and first characterized Hace1 mRNA levels in immortalized neuronal progenitor cells obtained from the striatum of previously established HD knock-in mice (24). These cells express either full-length WT (Q7) or mHTT (Q111) driven by the endogenous HTT promoter, designated STHdhQ7 (WT) and STHdhQ111 (mHTT) cell lines, respectively. Using a publically available dataset and quantitative (q) RT-PCR, we found that Hace1 mRNA expression is reduced in STHdhQ111 compared with STHdhQ7 cells (Fig. S4 A and B). In addition, HACE1 protein expression is lower in STHdhQ111 versus STHdhQ7 cells under both control and serum starvation (SS) conditions (Fig. S4C). The latter is known to trigger mHTT toxicity in vitro (25), which we confirmed experimentally (Fig. S4D). Accordingly, STHdhQ111 cells exhibited higher basal and SS-induced ROS levels compared with STHdhQ7 cells (Fig. S4E), pointing to the possibility that ROS deregulation is involved in mHTT toxicity in this system. Indeed, mHTT-expressing STHdhQ111 cells exhibited reduced GSH levels (Fig. S4F) and enhanced sensitivity to H2O2 challenge compared with STHdhQ7 cells (Fig. S4G). GSH supplementation rescued the STHdhQ111 cells from enhanced sensitivity to H2O2 (Fig. S4H), indicating Rotblat et al.

HACE1 Is Reduced in HD Striatum. We next asked if HACE1 expression is altered in the brain of the HD YAC128 mouse model. We found that HACE1 levels are not altered in this HD mouse model (Fig. S6 A–C). Although the YAC128 mouse is one of the most comprehensive and well-established models of HD, no mouse model recapitulates all molecular manifestations of human HD. In fact, it is reported that YAC128 mice fail to show concordant gene expression changes with human HD until the mice are 24 mo of age (27), whereas our studies of altered HACE1 expression in YAC128 mice were restricted to mice 12 mo of age or younger. Additionally, in a recent study of 12 genes

A

striatum control

HD

B

cortex control

HD

HACE1 GAPDH Fig. 5. HACE1 is reduced in HD striatum. HACE1 protein levels were determined by Western blot in HD patient or control brain lysates. GAPDH was used as a loading control. A, striatum; B, cortex.


CELL BIOLOGY

cont strv

30

DCFDA

18 8 18 9 19 0 19 3 19 4

D

*

MSCV HACE1 Q111

13 29 37 60 61

*

0

9 19 0 19 3 19 4

14

9

Q111 MSCV cont HACE1 cont MSCV strv HACE strv

18

% cell death

C

cont strv

that GSH deficiency contributes to their hypersensitivity. STHdhQ111 cells thus mimic the phenotypes observed in HACE1deficient MEFs, suggesting that reduced Hace1 levels may be involved in hypersensitivity of STHdhQ111 cells to oxidative stress. To directly assess this, we examined the impact of HACE1 levels on mHTT-associated oxidative stress and toxicity. We generated stable STHdhQ111 cell lines ectopically expressing vector control (murine stem cell virus, MSCV) or HA–HACE1 (Fig. S5A) and found that HACE1 expression increased GSH levels and decreased ROS under both resting and SS conditions (Fig. 4 A and B). Moreover, stable expression of HACE1 decreased mHTTinduced cellular sensitivity to SS and H2O2 challenge (Fig. 4 C and D). This was confirmed by transient expression of GFP– HACE1 in STHdhQ111 cells, which led to increased protection against H2O2 challenge (Fig. S5B). Furthermore, stable expression of the E3 ligase dead HACE1–C876S mutant in STHdhQ111 cells (Fig. S5A) led to enhanced resistance to SS and H2O2 challenge compared with control MSCV cells (Fig. 4 C and D) as well, further supporting the notion that the protective effects of HACE1 are independent of HACE1 E3 ligase activity. Taken together, these results suggest that reduced HACE1 levels contribute to the increased sensitivity toward ROS challenge observed in mHTTexpressing cells, and that HACE1 re-expression can protect cells against mHTT-induced toxicity by increasing their cellular antioxidant capacity in an E3 ligase-independent manner. We next asked whether NRF2 is involved in the ability of HACE1 to protect against mHTT toxicity. In agreement with previous reports (26), we found that NRF2 activity was substantially reduced in STHdhQ111 cells under basal conditions and following H2O2 treatment compared with STHdhQ7 cells (Fig. S5C). This was not rescued by Apocynin or ML171, inhibitors of NADPH oxidase activity (Fig. S5D), suggesting that the reduced NRF2 activity occurs independently of NADPH oxidase activity (19). Similar to Hace1 KO MEFs, NRF2 accumulation was reduced under oxidative stress in mHTT-expressing cells (Fig. S5E). Ectopic HACE1 expression was able to increase NRF2 activity in STHdhQ111 cells under both basal and H2O2-treated conditions (Fig. 4E). Moreover, NRF2 kd using two independent siRNAs (Fig. S5F) significantly increased sensitivity of STHdhQ111– HACE1 cells to H2O2 treatment. These results provide compelling evidence that HACE1 protects neuronal progenitor cells from mHTT-induced oxidative stress by promoting NRF2 activity and the antioxidant response.

11 18 20 60 62

0 MSCV HACE1 Q111

*

ARE-LUC/Renilla

1.5

18

count

B

*

relative DCFDA

3.0

% cell death

relative GSH

A

that were differentially expressed in the striatum of YAC128 versus control mouse striatum, only four of these 12 genes were concordantly changed when assessed in human HD versus control striatum (28). This highlights potential differences in transcriptional responses to mHTT expression in brains across different species. We therefore sought to directly evaluate HACE1 levels in human HD brain tissues. Interrogating publicly available human gene expression data (29), we found that HACE1 mRNA is specifically reduced in the striatum, the most affected region of the brain in HD (30), but not in the cerebellum or cortex of HD patients (Fig. S6D). We next measured HACE1 protein levels in striatal and cortical tissues obtained from control and HD brains (Table S1). Notably, HACE1 protein levels were demonstrably lower in HD compared with control striatal samples, but this was not observed in cortical samples (Fig. 5 A and B and Fig. S6E) and was not a result of differential postmortem intervals (Fig. S6F). Furthermore, low HACE1 levels correlated with dramatically reduced expression of the known NRF2 target, GSS (Fig. S7). We also found that levels of NQO1, another NRF2 target, are increased in HD cortex compared with controls, but not in the striatum (Fig. S7), suggesting that reduced HACE1 levels in HD striatum result in blunted NRF2 activation and, therefore, diminished NQO1 induction. Together, our findings suggest that low HACE1 expression may contribute to reduced expression and/or induction of NRF2 targets in HD striatum, and therefore to deficits in the oxidative stress response and selective vulnerability of striatal cells to mHTT-induced toxicity. Discussion In this study we report that HACE1 is essential for optimal activation of the NRF2 response under oxidative stress conditions by promoting NRF2 protein synthesis, stabilization, and nuclear localization. Recently, we found increased ROS levels in different peripheral tissues of Hace1 KO mice due to increased activity of ROS generating Rac1-dependent NADPH oxidase complexes (19). We show here that brains of Hace1 KO mice exhibit redox imbalance and increased oxidative stress but reduced NQO1 expression, a known NRF2 target gene and a marker of the antioxidative stress response (5, 13). Therefore, the consequences of Hace1 deficiency in mice are very similar to that of genetic loss of Nrf2 (8). These data support a model where HACE1 positively regulates the NRF2-mediated antioxidative stress response and functions to maintain redox homeostasis in brain tissues. This requires HACE1 ankyrin repeats as well as its HECT domain, but occurs independently of HACE1 E3 ligase activity and its ability to negatively regulate NADPH oxidase complexes. Increased oxidative stress and vulnerability of the striatum to mHTT toxicity are prominent features in HD brains (31, 32). We observed a reduction in HACE1 levels in mHTT-expressing STHdhQ111 striatal neuronal progenitor cells that correlated with previously reported diminished NRF2 activity (26) and increased oxidative stress, which could be rescued by reintroduction of 1. Niccoli T, Partridge L (2012) Ageing as a risk factor for disease. Curr Biol 22(17):R741–R752. 2. Johri A, Beal MF (2012) Antioxidants in Huntington’s disease. Biochim Biophys Acta 1822(5):664–674. 3. Kensler TW, Wakabayashi N, Biswal S (2007) Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol 47:89–116. 4. Wild AC, Moinova HR, Mulcahy RT (1999) Regulation of gamma-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J Biol Chem 274(47):33627–33636. 5. Itoh K, et al. (1997) An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236(2):313–322. 6. Motohashi H, Yamamoto M (2004) Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol Med 10(11):549–557. 7. Dinkova-Kostova AT, et al. (2002) Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc Natl Acad Sci USA 99(18):11908–11913.

3036 | www.pnas.org/cgi/doi/10.1073/pnas.1314421111

HACE1. Reduced HACE1 levels and induction of NRF2 target genes were observed in the HD striatum but not in the HD cortex (Fig. 5 and Fig. S7). Although other brain tissues are affected in HD, including cortex (33), the earliest and most dramatic changes are typically observed in the striatum (32). This may be due to physiological differences between striatal and cortical neurons, such as increased susceptibility of striatal neurons to excitotoxicity (34), a process that is thought to lead to ROS production. There is also evidence that mHtt expression in the striatum is sufficient to cause altered expression of oxidative stress genes (35), further indicating that the effects of mHtt expression could be cell type specific. In keeping with this, previous gene expression analyses reported that 90% of genes (including HACE1) that were found to be differentially expressed in HD versus control striatum were not differentially expressed in HD versus control cortex (29). Alternatively, cortical neurons may have evolved alternative mechanisms to retain HACE1 expression, even under mHtt-mediated stress, as these cells may be particularly sensitive to HACE1 loss. HACE1 was recently reported as a putative NRF2 target gene (36), and HACE1 is induced by oxidative stress, raising the possibility that reduced NRF2 activity may explain why HACE1 expression is diminished in mHTT-expressing STHdhQ111 striatal progenitor cells and in HD striatum. Conversely, we found that NQO1 levels are not altered in HD striatum and are actually increased in HD cortex. This suggests redundant mechanisms of NQO1 regulation in vivo, potentially involving other transcription factors such as FBJ Murine Osteosarcoma Viral Oncogene Homolog (c-FOS) (37). Restoring HACE1 expression to STHdhQ111 cells increased their NRF2 activity, rescued redox balance, and enhanced survival under oxidative stress conditions, suggesting that HACE1 loss may contribute to the selective vulnerability of striatal cells to mHTT toxicity. In summary, we have demonstrated that the HACE1 tumor suppressor is an important component of the antioxidative stress response, and functions by facilitating NRF2 activity. Our results support the notion that enhancing HACE1 expression may be therapeutically beneficial in HD and potentially other neurodegenerative diseases. Materials and Methods For determining GHS levels the Glutathione assay kit was used (Cayman Chemicals). For determining protein carbonylation the Protein Carbonyl Colorimetric Assay Kit (Cayman Chemicals) was used. Protocols for ROS measurements, mouse strains, cell culture and transfection, Western blotting, cell fractionation, cell death assays, qRT-PCR, and NQO1 and DNA oxidation staining can be found in SI Materials and Methods. ACKNOWLEDGMENTS. B.R. was supported by a fellowship from the International Human Frontier Science Program Organization. A.L.S. and D.E.E. were supported by Canadian Institutes of Health Research (CIHR) postdoctoral fellowships. This work was supported in part by funds from CIHR (MOP-123416) (to P.H.S.).

8. Satoh H, Moriguchi T, Takai J, Ebina M, Yamamoto M (2013) Nrf2 prevents initiation but accelerates progression through the Kras signaling pathway during lung carcinogenesis. Cancer Res 73(13):4158–4168. 9. Sykiotis GP, Bohmann D (2010) Stress-activated cap’n’collar transcription factors in aging and human disease. Sci Signal 3(112):re3. 10. Chen W, et al. (2009) Direct interaction between Nrf2 and p21(Cip1/WAF1) upregulates the Nrf2-mediated antioxidant response. Mol Cell 34(6):663–673. 11. Komatsu M, et al. (2010) The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol 12(3):213–223. 12. Huang HC, Nguyen T, Pickett CB (2002) Phosphorylation of Nrf2 at Ser-40 by protein kinase C regulates antioxidant response element-mediated transcription. J Biol Chem 277(45):42769–42774. 13. DeNicola GM, et al. (2011) Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature 475(7354):106–109. 14. Purdom-Dickinson SE, Sheveleva EV, Sun H, Chen QM (2007) Translational control of nrf2 protein in activation of antioxidant response by oxidants. Mol Pharmacol 72(4):1074–1081.

Rotblat et al.

27. Kuhn A, et al. (2007) Mutant huntingtin’s effects on striatal gene expression in mice recapitulate changes observed in human Huntington’s disease brain and do not differ with mutant huntingtin length or wild-type huntingtin dosage. Hum Mol Genet 16(15):1845–1861. 28. Becanovic K, et al. (2010) Transcriptional changes in Huntington disease identified using genome-wide expression profiling and cross-platform analysis. Hum Mol Genet 19(8):1438–1452. 29. Hodges A, et al. (2006) Regional and cellular gene expression changes in human Huntington’s disease brain. Hum Mol Genet 15(6):965–977. 30. Ross CA, Tabrizi SJ (2011) Huntington’s disease: From molecular pathogenesis to clinical treatment. Lancet Neurol 10(1):83–98. 31. Zuccato C, Valenza M, Cattaneo E (2010) Molecular mechanisms and potential therapeutical targets in Huntington’s disease. Physiol Rev 90(3):905–981. 32. Tabrizi SJ, et al.; TRACK-HD Investigators (2011) Biological and clinical changes in premanifest and early stage Huntington’s disease in the TRACK-HD study: The 12-month longitudinal analysis. Lancet Neurol 10(1):31–42. 33. Estrada-Sanchez AM, Rebec GV (2013) Role of cerebral cortex in the neuropathology of Huntington’s disease. Front Neural Circuits 7:19. 34. Brustovetsky T, Purl K, Young A, Shimizu K, Dubinsky JM (2004) Dearth of glutamate transporters contributes to striatal excitotoxicity. Exp Neurol 189(2):222–230. 35. Thomas EA, et al. (2011) In vivo cell-autonomous transcriptional abnormalities revealed in mice expressing mutant huntingtin in striatal but not cortical neurons. Hum Mol Genet 20(6):1049–1060. 36. Malhotra D, et al. (2010) Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis. Nucleic Acids Res 38(17):5718–5734. 37. Venugopal R, Jaiswal AK (1996) Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H: quinone oxidoreductase1 gene. Proc Natl Acad Sci USA 93(25):14960–14965.

CELL BIOLOGY

15. Anglesio MS, et al. (2004) Differential expression of a novel ankyrin containing E3 ubiquitin-protein ligase, Hace1, in sporadic Wilms’ tumor versus normal kidney. Hum Mol Genet 13(18):2061–2074. 16. Zhang L, et al. (2007) The E3 ligase HACE1 is a critical chromosome 6q21 tumor suppressor involved in multiple cancers. Nat Med 13(9):1060–1069. 17. Torrino S, et al. (2011) The E3 ubiquitin-ligase HACE1 catalyzes the ubiquitylation of active Rac1. Dev Cell 21(5):959–965. 18. Castillo-Lluva S, Tan CT, Daugaard M, Sorensen PH, Malliri A (2013) The tumour suppressor HACE1 controls cell migration by regulating Rac1 degradation. Oncogene 32(13):1735–1742. 19. Daugaard M, et al. (2013) Hace1 controls ROS generation of vertebrate Rac1dependent NADPH oxidase complexes. Nat Commun 4:2180. 20. Nioi P, McMahon M, Itoh K, Yamamoto M, Hayes JD (2003) Identification of a novel Nrf2-regulated antioxidant response element (ARE) in the mouse NAD(P)H:quinone oxidoreductase 1 gene: Reassessment of the ARE consensus sequence. Biochem J 374(Pt 2):337–348. 21. Itoh K, et al. (2003) Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 8(4):379–391. 22. Kobayashi A, et al. (2006) Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol 26(1):221–229. 23. Somasekharan SP, et al. (2012) Identification and quantification of newly synthesized proteins translationally regulated by YB-1 using a novel Click-SILAC approach. J Proteomics 77:e1–e10. 24. Trettel F, et al. (2000) Dominant phenotypes produced by the HD mutation in STHdh (Q111) striatal cells. Hum Mol Genet 9(19):2799–2809. 25. Kong PJ, et al. (2009) Increased expression of Bim contributes to the potentiation of serum deprivation-induced apoptotic cell death in Huntington’s disease knock-in striatal cell line. Neurol Res 31(1):77–83. 26. Jin YN, et al. (2013) Impaired mitochondrial dynamics and Nrf2 signaling contribute to compromised responses to oxidative stress in striatal cells expressing full-length mutant huntingtin. PLoS ONE 8(3):e57932.

Rotblat et al.


Supporting Information Rotblat et al. 10.1073/pnas.1314421111 SI Materials and Methods Reagents. We obtained 2-Acetylphenothiazine (ML171), Apocynin, tert-Butylhydroquinone (tBHQ), glutathione (GSH), cyclohexamide (CHX), Hydrogen peroxide (H2O2), dihydroethidium (DHE), and MG132 from Sigma. ROS Measurements. Cells were supplemented with 10 μM chloro-

methyl-dichlorodihydrofluorescein diacetate (CM-H2DCFDA; Invitrogen) for 30 min in full media, washed with PBS, trypsinized, and fluorescence was measured using FACS. To measure reactive oxygen species (ROS) in mouse tissues, snap-frozen organs were cut into 20 μm sections on a cryostat at −20 °C, washed with ice-cold buffer, mounted on precooled cover slides, and stained with 10 mM dihydroethidium (DHE) for 30 min. Representative sections from independent tissues were imaged with a Zeiss Axioplan2 microscope and analyzed using ImageJ meandensity calculation. Mouse Strains, Cell Culture, and Transfection. Mouse strains were as described (1). HEK293, HEK293T, and mouse embryonic fibroblasts (MEF) cells were maintained as described (1). SThdh cells were maintained at 33 degrees as described (2). SThdhQ111– Homologous to the E6-AP Carboxyl Terminus (HECT) domain and Ankyrin repeat containing E3 ubiquitin–protein ligase 1 (HACE1) or SThdhQ111–HACE1(CS) or murine stem cell virus (MSCV) cells were generated using retroviral infection as described (1). HACE1 knockdown (kd) in HEK293T was performed using RNAiMAX (Invitrogen) according to the manufacturer’s instructions using Hs_HACE1_1 and Hs_HACE1_2 (FlexiTube, Qiagen). Nuclear factor erythroid 2-related factor 2 (Nrf2) kd in STHdh cells was performed with Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions using ACUCAAAUCCCACCUUAAA and CAUGUUACGUGAUGAGGAU (Dharmacon). Neon (Invitrogen) was used for transfection of STHdh and for transfection of MEFs. Lipofectamine2000 (Invitrogen) was used for transfection of antioxidative stress response element (ARE)–luciferase and pRenilla (RL) vectors in all cell lines. Vectors. GFP–HACE1 and HACE1–promoter–Luciferase vector were as described (3). HA–HACE1, HA–HACE1(C876S), HA– HACE1ΔANK, and HA–HACE1ΔHECT were as described (4). NQO1–ARE–luciferase was as described (5). MYC–NRF2 expression vector was as described (6). For NQO1–ARE, activity cells were plated and transfected in 12-well plates. Following treatments, cells were lysed and firefly and renilla luciferase activity was measured using Dual luciferase assay (Promega). Western Blot and Cell Fractionation. Following treatment, cells grown in a 10 cm dish were washed twice with ice-cold PBS and then lysed with 500 μL 1% Nonidet P-40 buffer supplemented with phosphatase and protease inhibitors (Roche) and benzonase (Sigma). Samples were centrifuged for 15 min at maximum speed, and the supernatant was collected and analyzed by Western blot using anti-HSC70 (stress gene), anti-HA (Covance), anti-HACE1 (Sigma), and anti-eukaryotic Elongation Factor 2 (eEF2) (Cell Signaling) antibodies. The following antibodies were obtained from Santa Cruz: anti-GRB2, anti-NRF2, anti-Actin, anti-NQO1, anti-GCLC, anti–c-Jun, anti–c-Myc, and anti-GSH synthetase (GSS). Cell fractionation was performed

Rotblat et al. www.pnas.org/cgi/content/short/1314421111

using NE-PER kit (Thermo Scientific) according to the manufacturer’s instructions. Immunofluorescence. MEF cells were plated in coverslips and grown for 24 h. Cells were treated, washed with cold PBS, fixed with PFA 4% (wt/vol) for 20 min, permebilized with 0.1% Triton ×100 in PBS, blocked with 5% milk (wt/vol), incubated with antiNRF2 (1:200) for 1 h, washed extensively with PBS, incubated with FITC-conjugated goat anti-rabbit (Molecular probes) (1:200) for 1 h, and washed extensively. Slides were mounted on coverslips and imaged using Axiovision epi-fluorescent microscope (Zeiss). Cell Death Assays. Treated attached and detached cells were collected, stained with annexin V or annexin V and propidium iodide (PI) as indicated using FITC Annexin V Apoptosis Detection Kit I (BD pharmagen) according to the manufacturer’s instructions. Cells were analyzed using FACS, and cell death was normalized to control. For comparing survival in serum starvation between STHdhQ7 and STHdhQ111 cells, we used the MultiTox assay (Promega) according to the manufacturer’s instructions. qRT-PCR. RNA was extracted from cells and analyzed as in ref. 1,

and quantitative RT-PCR was performed and quantified as described (7). The following primers were used: HACE1, forward AGTTGCCCGAGGATAATGAAAC and reverse TCCACCGATCCACAATTTGCT; NQO1, forward GAAGAGCACTGATCGTACTGGC and reverse GGATACTGAAAGTTCGCAGGG; Hace1, forward TAAAGCAGGGGATTGCTGTACG and reverse ATTCACGCACAACGCCTTGA; Nqo1, forward AGGATGGGAGGTACTCGAATC and reverse TGCTAGAGATGACTCGGAAGG; and Hmox1, forward AGGTACACATCCAAGCCGAGA and reverse CATCACCAGCTTAAAGCCTTCT. NQO1 and DNA Oxidation Staining. Paraffin embedded tissues were deparaffinized and rehydrated, followed by antigen retrieval in boiling citrate buffer. Primary rabbit polyclonal antibody for NQO1 (Abcam #Ab34173) was used at a concentration of 4.9 μg/mL and stained with horseradish peroxidase-based detection reagents. DNA oxidation was performed on formalin-fixed, paraffin-embedded tissues after deparaffinization and antigen retrieval. Immunohistochemistry staining was performed with antibodies against 8-oxo-dG (R&D Systems) using the alkaline– phosphatase–labeled streptavidin–biotin ABC kit (Vector Labs). Sections were counterstained with hematoxylin (Vector Labs). Images were acquired with an Axioplan2 microscope (Zeiss). Clinical Material. Snap-frozen matched tissue specimens of human normal brain and Huntington disease (HD) brain were obtained from the Huntington Disease Biobank at the University of British Columbia. Details of genotype, age, sex, and postmortem interval are provided in Table S1. Analysis of Hace1 in Mouse Tissue. Striatal and cortical tissues were microdissected from the brains of 3-, 6-, 9-, or 12-mo-old YAC128 and WT littermates and snap frozen. mRNA analysis was performed by qRT-PCR as in ref. 8. Protein analysis was performed as in ref. 3. Statistics. Bar graphs represent mean and error bars represent

SEM. Significant differences between samples were determined using Student t test.

1 of 8

1. Zhang L, et al. (2007) The E3 ligase HACE1 is a critical chromosome 6q21 tumor suppressor involved in multiple cancers. Nat Med 13(9):1060–1069. 2. Trettel F, et al. (2000) Dominant phenotypes produced by the HD mutation in STHdh (Q111) striatal cells. Hum Mol Genet 9(19):2799–2809. 3. Daugaard M, et al. (2013) The Hace1 tumor suppressor is an integrated component of the oxidative stress response that regulates NADPH oxidase. Nat Commun 4: 2180. 4. Anglesio MS, et al. (2004) Differential expression of a novel ankyrin containing E3 ubiquitin-protein ligase, Hace1, in sporadic Wilms’ tumor versus normal kidney. Hum Mol Genet 13(18):2061–2074.

A

5. Itoh K, et al. (1997) An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236(2):313–322. 6. Furukawa M, Xiong Y (2005) BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol 25(1):162–171. 7. Malhotra D, et al. (2010) Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis. Nucleic Acids Res 38(17):5718–5734. 8. Ehrnhoefer DE, et al. (2013) p53 increases caspase-6 expression and activation in muscle tissue expressing mutant huntingtin. Hum Mol Genet 23(3):717–729.

AR treated HEK293T siCont

B

AR treated HEK293T cells siCont siHACE1#2

siHACE1 24.2

4.7

44.9

56.3

12.8

19.3

31.1

15.26

PI

HACE1

GAPDH 0 siCont siHACE1

C

*

1.5

WT

t 3

KO 2.67

0.84

KO+GSH 13.32

0.13

7.16

annexin V

72.07

13.77

83.49

*

2.5

0 siCont siHACE1#2

H2O2 treated MEFs

89.48

AC E1

on

DCFDA

0 siCont siHACE1

0.69

H

C

0.5

F

si

si

1

1 0.8 0.6 0.4 0.2 0 siCont siHACE1

5

siHACE1#2

4.95

PI

relative GSH

1.2

GAPDH

0 siCont siHACE1#2

siCont

2

DCFDA

E

HACE1

count

siHACE1

2

D

*

2.5 relative DCFDA

count

siCont

*

relative DCFDA

1 0.5

4

11.43

relative cell death

si

si

C on

relative cell death

to l H AC E1

*

2 1.5

#2

FSC

annexin V

relative cell death

54.89

PI

6.7

*

*

2 1 0

WT KO KO + GSH

Fig. S1. HACE1 loss reduces antioxidative stress responses. (A) HEK293T cells were transfected with siRNA targeting HACE1 or control siRNA (siCont). Cells were treated with arsenite (AR) (10 μM) for 8 h, and cell death was determined with annexin V and PI staining. (Upper) Typical FACS plots. (Lower Left) Cell death relative to control. n = 3. *P < 0.05. (Lower Right) Efficiency of siRNA was determined by Western blot. (B) Validation of experiment in Fig. S1A. HEK293T cells were transfected with an independent siRNA targeting HACE1 (siHACE1#2) or control siRNA as indicated. Cells were treated with AR (10 μM) for 8 h, and cell death was determined by PI staining. (Upper) Typical FACS plots. (Lower Left) Cell death relative to control. n = 3. *P < 0.05. (Lower Right) Efficiency of siRNA was determined by Western blot. (C) HEK293T cells were transfected as in A. ROS levels were determined using DCFDA (10 μM; 45 min incubation in full media) and measured by FACS. (Left) Typical FACS histograms. (Right) Geometric means relative to siControl. n = 3; *P < 0.05. (D) Validation of experiment in Fig. S1C. HEK293T cells were transfected with an independent siRNA targeting HACE1 (siHACE1#2) or control siRNA as indicated. ROS levels were determined using DCFDA (10 μM; 45 min incubation in full media) and measured by FACS. (Left) Typical FACS histograms. (Right) Geometric means relative to siControl. n = 3; *P < 0.05. (E) HEK293T cells were transfected with siRNA targeting HACE1 or control siRNA (siCont). GSH levels were measured in lysates and presented relative to control. n = 3; *P < 0.05. (F) Cells were pretreated with GSH or left untreated for 16 h. GSH media was replaced with normal media, and cells were challenged with H2O2 (400 μM; 8 h). Cell death was measured by annexin V and PI staining. (Left) Typical FACS plots. (Right) Relative cell death. n = 3; *P < 0.05.


2 of 8

A

cytosolic WT KO H2O2 (h): 0 0.5 3 0 0.5 3 NRF2

NRF2/PARP:

B

nuclear WT KO 0 0.5 3 0 0.5 3

si cont si HACE1 AR (h): 0 0.5 3 0 0.5 3 HACE1

si cont si HACE1#2 AR (h): 0 0.5 5 0 0.5 5 HACE1 NRF2

NRF2

1 35 63 8 31 35

actin

actin

GAPDH

*

relative NRF2 levels

3

PARP

2 1

0 AR (h): 0 0.5 3 si cont D

C

F

E

ve c N tor R F2

siHACE1 siCont cytosolic nuclear cytosolic nuclear AR (h): 0 0.5 3 0 0.5 3 0 0.5 3 0 0.5 3 NRF2

NRF2

NRF2/LAMIN:

1 1.6 2.1

0.03 0.04 0.03

0 0.5 3 si HACE1

si Cont

CHX (min):

si HACE1 0 10 20 40 60

0 10 20 40 60

HACE1 NRF2

GAPDH

GAPDH

actin

LAMIN

CHX (min)

si Cont

relative NRF2

1

G

si HACE1

CHX (min): 0 10 20 40 60 120 0 10 20 40 60 120 HACE1

0

20 40

siCont siHACE1 t 1/2 =12

R=0.88

0.1

c-Jun

60

R=0.91

t 1/2 =36

c-Myc H

GAPDH

1

0 20 40 60

120 siCont siHACE1

R=0.9

t1/2=48 t1/2=63

R=0.78

0.1

0 20 40 60 1

0.1

AR (h):

120 R=0.89

R=0.87

control

siCont siHACE1 t1/2=42 t1/2=73

0 0.5 3

0 0.5 3

Nrf2 mRNA

*

2.0 1.5 1.0

*

H2O2 (h): 0

0

4

*

2 1.5 1 0.5 0

0 0.5 3

0 0.5 3

siCont

siHACE1

8

control

tBHQ

ve

c H tor AH HA A- C E H HA 1 A- C  E H AN 1(C A- K S H ) EC ve T ct H or AH HA A- C H HA E1 A- C  E H AN 1(C A- K S H ) EC T

J

0 0.5 3

actin

AR+ MG132 (h):

0.5

si HACE1

0 0.5 3

NRF2

relative NRF2 levels

WT KO *

3.0 2.5

si Cont

HACE1

2.5

I

MG132

si Cont si HACE1

CHX (min)

relative C-MYC

relative C-JUN

CHX (min)

250 150 100 75

HA

NRF2 NRF2/GAPDH:

1 5.9 3.4 0.2 0.4

8.5 19 16 10 6.7

GAPDH

Fig. S2. HACE1 is important for stress-induced NRF2 accumulation and localization. (A) Hace1 WT or KO MEFs were treated with H2O2 (200 μM) for the indicated time points. Cells were lysed and fractionated to isolate nuclear and cytosolic fractions as indicated. Fractions were confirmed using Western blot with GAPDH as a marker for cytosolic fractions and PARP for nuclear fractions. NRF2 localization was determined using anti-NRF2 antibodies and quantified relative to Poly(ADP-ribose) Polymerase (PARP). (B) HEK293T cells were transfected with siRNA targeting HACE1 or control siRNA as indicated. Cells were treated with AR (1 μM) for the indicated time points. Cells were lysed and NRF2 protein levels were determined using Western blot. NRF2 levels were normalized to actin. n = 3; *P < 0.05. (C) Validation of experiment in S2B with an independent siRNA targeting HACE1 (siHACE1#2). (D) HEK293T cells were transfected with anti-HACE1 or control siRNA for 72 h. Cells were treated and analyzed as in A. Nuclear fractions were determined using anti-LAMIN A/C (LAMIN) antibodies and cytosolic fractions using anti-GAPDH antibodies. NRF2 levels were normalized to LAMIN. (E) Supporting Fig. 2E. Hace1 WT or KO MEFs Legend continued on following page


3 of 8

were transfected with a vector encoding MYC–NRF2 or empty vector. Western blot demonstrates NRF2 expression in transfected cells. (F) HEK293T cells were transfected with control siRNA (siCont) or HACE1-targeting siRNA (siHACE1) for 72 h. Cells were pretreated with AR (1 μM) for 15 min and then treated with CHX (10 μM). Cell lysates were collected at the indicated time points, and NRF2 levels were determined using Western blot (Upper) and normalized to actin levels and time 0 (Lower). (G) HEK293T cells were transfected with siRNAs targeting HACE1 or with control siRNAs. Cells were treated with AR (1 μM; 15 min). Cells were pulsed with CHX (10 μM) for the indicated times. c-JUN and c-MYC levels were determined using Western blotting (Upper), and indicated protein levels were quantified and normalized to GAPDH (Lower). (H) HEK293T cells were transfected with siRNA targeting HACE1 or control siRNA as indicated. Cells were treated with AR (1 μM) or AR and MG132 (10 μM) for the indicated time points. Cells were lysed and NRF2 protein levels were determined using Western blot. NRF2 levels were normalized to actin. n = 3; *P < 0.05. (I) Hace1 WT or KO MEFs were treated with H2O2 (200 μM) for the indicated time points. Nrf2 mRNA levels were measured using qRT-PCR. (J) HEK293 cells were transfected with the indicated vectors for 48 h. Cells were treated with tBHQ (10 μM) for 3 h as indicated. Cell lysates were analyzed by Western blot using the indicated antibodies.

1.5

HACE1-pro activity

*

0.5 0

* 3.5 3 2.5 2 1.5 1 0.5 0 control

3

6

*

4

1

0 time (h): C

*

* *

NQO1 mRNA

HACE1 mRNA

2

B

H2O2 AR

time (h):

**

1 0

0

3

6

1.5 1 0.5

0 time (h): D

H2O2 AR

*

2

3 2

HEK293T

*

AR

2.5 NQO1 mRNA

SH-SY5Y

HACE1 mRNA

A

0

3

6

*

2 1.5 1 0.5

time (h):

0

0

3

6

- +

HACE1 GAPDH

AR

Fig. S3. HACE1 is an oxidative stress response gene. (A) SH-SY5Y cells were treated with H2O2 (200 μM) or AR (1 μM) for the indicated time points, and HACE1 and NQO1 mRNA expression was determined using qRT-PCR. n = 3; *P < 0.05. (B) HEK293T cells were treated with H2O2 (200 μM) or AR (1 μM) for the indicated time points, and HACE1 and NQO1 mRNA expression was determined using qRT-PCR. n = 3 P < 0.05. (C) HEK293T cells cotransfected with the HACE1–LUC vector along with pRenilla vector as transfection control and were treated with AR (1 μM) for 8 h as indicated. Luciferase activity was determined using a plate reader. n = 3. *P < 0.01. (D) HEK293T cells were treated with AR (1 μM) for 8 h as indicted. HACE1 protein levels were determined using Western blot.


4 of 8

C 12

6.5

*

starved (h): HACE1 starved control

6

actin

E

F

count

Q7 control Q111 control Q7 starvation Q111 starvation

relative DCFDA

10

*

G H O treated cells 2 2

*

PI

11.5

FSC

control H2O2 0.6

0

STHdhQ7 STHdhQ111

15

*

10 5 0 STHdhQ7 STHdhQ111

*

1.5 1.0 0.5

0 STHdhQ7 STHdhQ111

STHdhQ7 STHdhQ111

1.2 Q111

relative cell death

STHdh 6.6

*

control starvation

5

0

DCFDA

STHdh

Q111

0 STHdhQ7 STHdhQ111

6.0 STHdhQ7 STHdhQ111

Q7

STHdh STHdh 0 4 8 0 4 8 Q7

relative GSH

7.0

D

*

H relative cell death

p=0.034

dead/live cells normalized to untreated

B

7.5

Hace1 mRNA

Hace1 expression (AU)

A

3

*

*

2 1 0

Q7 Q111 Q111 + GSH

Fig. S4. Mutant Huntingtin (mHTT)-associated oxidative stress and toxicity is correlated with reduced HACE1 levels. (A) Hace1 mRNA expression in STHdh cells obtained from published microarray experiment Gene Expression Omnibus Accession 2911 (1). (B) STHdh cells were serum starved for 6 h. Hace1 mRNA levels were determined by qRT-PCR. Values were normalized to untreated STHdhQ7 cells. n = 3; *P < 0.01. (C) STHdh cells were treated with serum starvation for the indicated time points. HACE1 protein levels were determined using Western blot. Actin was used as a loading control. (D) STHdh cells were left untreated or treated with serum starvation for 24 h. Cell death was measured using DualTox assay. n = 3; *P < 0.05. (E) The indicated STHdh cells were treated with serum starvation or left untreated for 6 h. ROS were measured using DCFDA. (Left) Typical FACS histograms. (Right) Average geometric means relative to untreated STHdhQ7. n = 3; *P < 0.05. (F) GSH levels were determined in the indicated STHdh cell lines and normalized to STHdhQ7 values. n = 3; *P < 0.05. (G) The indicated STHdh cells were treated with H2O2 (600 μM; 8 h) or left untreated. Cell death was measured using PI. (Left) Typical FACS plots. (Right) Cell death relative to treated STHdhQ111. n = 3; *P < 0.05. (H) STHdhQ111 cells were pretreated with GSH (1 mM) for 24 h. The media was replaced and the cells were challenged with H2O2 (600 μM; 8 h) or left untreated. Cell death was measured using PI. n = 3; *P < 0.05. 1. Lee JM, et al. (2007) Unbiased gene expression analysis implicates the huntingtin polyglutamine tract in extra-mitochondrial energy metabolism. PLoS Genet 3(8):e135.


5 of 8

E

F

NRF2 NRF2/actin: 1.0 1.1 2.7 1.0 1.0 2.1

actin

2 1

*

1

siC

#1

#2

si Nrf2 STHdhQ111-HACE1

siC

#1

cont apo ML171 STHdhQ111

*

0.5

0

1.4 1.2 1 0.8 0.6 0.4 0.2 0

* *

1

2

0

D

0 M H2O2: 0 100 200 0100 200 STHdhQ7 STHdhQ111

*

3 relative cell death

STHdhQ7 STHdhQ111 H2O2 (h): 0 1 4 0 1 4

*

*

Nqo1 mRNA

GFP GFP GFP-HACE1 STHdhQ7 STHdhQ111

3

*

ARE-LUC/Renilla

cont H2O2

50

0

C

*

Nrf2 mRNA

actin

*

ARE-LUC/Renilla

HA-HACE1

B 100 % cell death

ST H

d ST h Q11 1 H d -M ST h Q11 SC 1 H dh -HA V Q 11 C -1C E1 S

A

#2

si Nrf2 STHdhQ111-HACE1

*

1

0.5

0

siC

#1 #2 si Nrf2

STHdhQ111-HACE1

Fig. S5. HACE1 expression rescues STHdh cells from mHTT toxicity. (A) Stable HA–HACE1 or E3 ligase dead mutant HA–HACE1(C876S) (CS) expression was confirmed using Western blot. (B) The indicated STHdh cell lines were transfected with GFP or GFP–HACE1 vector as indicated for 24 h. The cells were treated with H2O2 (600 μM; 24 h), and cell death of the GFP-expressing cells was measured using PI. n = 3; *P < 0.05. (C) The indicated STHdh cell lines were transfected with the NRF2 activity reporter ARE–LUC and pRL transfection control vectors for 24 h. The cells were treated with the indicated concentrations of H2O2 (8 h), and luciferase activity was measured using a plate reader. n = 3; *P < 0.05. (D) STHdhQ111 cells were transfected as in C and were treated with 10 μM of the NADPH oxidase inhibitors 2-Acetylphenothiazine (ML171) or Apocynin (APO) for 3 h as indicated. NRF2 activity was determined using a plate reader. n = 3. (E) The indicated STHdh cells were treated with H2O2 (200 μM) for the indicated time points. NRF2 protein levels were determined using Western blot and normalized to actin. (F) STHdhQ111–HACE1 cells transfected with control siRNA (siC) or NRF2-targeting siRNAs (si Nrf2#1 and Nrf2#2) were treated with H2O2 (400 μM; 24 h). (Left) Cell death was measured using PI staining and normalized to siC. (Center) NRF2 KD was confirmed by qRT-PCR. (Right) Functional validation of NRF2 KD was performed by analyzing mRNA levels of the NRF2 target Nqo1 using qRT-PCR. n = 3; *P < 0.01.


6 of 8

cortex

WT YAC128

1.5 1 0.5

0.5 0

WT

YAC128

GRB2

C 12 month old

cont

1.5

GRB2

0.5 WT YAC128

striatum cont

YAC128

HACE1

1.0

0

WT

HACE1/GRB2

cont

3 6 9 age (months) cortex

HACE1/GRB2

striatum

HACE1

1.5 1.0 0.5 0

WT YAC128

cortex WT

YAC128

HACE1 GRB2

D

1

3 6 9 age (months)

B 3 month old

WT YAC128

1.5

1.5

cont

1.0

HACE1

0.5

GRB2

0

WT

1.5

YAC128

HACE1/GRB2

0

HACE1/GRB2

relative Hace1 mRNA

striatum 2

relative Hace1 mRNA

A

WT YAC128

1.0 0.5 0

WT YAC128

E

HACE1/GAPDH

* 0.5

1.2

cortex *

0.6 0

control

HD

1.5 1 0.5 0

control

HD

pr

im

ca

ud

at

e

nu

cl

eu

ce re s ar fro bel l y nt m al um ot c su pe f or c orte rio ron or x, rm ta tex ot l c or or co tex rte , x

0

striatum HACE1/GAPDH

ratio HACE1 expression (HD/normal)

1

F

HACE1 levels

1.2 1.0

R2=0.005

0.8 0.6 0.4 0

5

10 15 PMI (h)

20

25

Fig. S6. HACE1 expression in HD brain. (A) Hace1 mRNA expression in the indicated brain regions obtained from YAC128 (HD) and FVB (control) mice at the indicated ages. (B) Hace1 protein levels in the indicated brain regions obtained from 3-mo-old YAC128 and WT mice were determined using Western blot. Brain lysates from Hace1 KO mice were used as controls. Hace1 levels were normalized to GRB2. (C) Hace1 protein levels in the indicated brain regions obtained form 12-mo-old YAC128 and FVB mice were determined using Western blot. Brain lysates from Hace1 KO mice were used as controls. Hace1 levels were normalized to GRB2. (D) HACE1 mRNA expression in human HD/control brain regions. Published microarray experiment (1). *P < 10−6. (E) The levels of HACE1 protein in the Western blots presented in Fig. 5 were quantified and normalized to GAPDH. *P < 0.01. (F) The levels of HACE1 protein in the striatal samples obtained from control brains were plotted against their postmortem intervals and analyzed for correlation. There is no significant correlation; P = 0.9. 1. Hodges A, et al. (2006) Regional and cellular gene expression changes in human Huntington’s disease brain. Hum Mol Genet 15(6):965–977.


7 of 8

HD

19

18

9

11 18 20 60 62

control

HD

18 8 18 9 19 0 19 3 19 4

B cortex

control

13 29 37 60 61

striatum

0 19 3 19 4

A

GSS NQO1

0.5 0 control HD

*

1.0 0.5 0 control HD

4 3

*

2 1

1.5 GSS/GAPDH

1.0

1.5

NQO1/GAPDH

1.5 GSS/GAPDH

NQO1/GAPDH

GAPDH

1.0 0.5

0 control HD

0 control HD

Fig. S7. Expression of NRF2 targets in HD striatum and cortex. The levels of the indicated proteins in human brain samples obtained from HD patients or controls were determined by Western blot and normalized to the loading control, GAPDH. (A) Striatum. (B) Cortex. *P < 0.05.

Table S1. Summary of frozen human postmortem striatal and cortical samples Sample HD-188 HD-189 HD-190 HD-193 HD-194 Mean ± SD CTRL-11 CTRL-13 CTRL-18 CTRL-20 CTRL-29 CTRL-37 CTRL-60 CTRL-61 CTRL-62 Mean ± SD

HD grade

Htt CAG length, short/long

3 3 3 3 3

21/49 23/44 17/42 17/53 23/47

Age at death

Sex

43 63 64 53 59 56.4 ± 8.6 65 50 76 74 74 68 46 36 29 57.6 ± 17.7

F F M F F M M M M M M M F F

PMI, h 3.5 5.5 10 9 7 7 ± 2.6 22 5 18 6 2 7 10 10 4.5 9.4 ± 6.6

Details of the human tissue used in this study including HD grade, HTT GAC repeat length, age at death, sex, and postmortem intervals (PMIs). Mean ages at death and PMI ± SD are shown and are not significantly different between HD and controls.


8 of 8