JOURNAL OF VIROLOGY, Mar. 2011, p. 2342–2350 0022-538X/11/$12.00 doi:10.1128/JVI.02046-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 85, No. 5
Human Ago2 Is Required for Efficient MicroRNA 122 Regulation of Hepatitis C Virus RNA Accumulation and Translation䌤 Joyce A. Wilson,1,2* Chao Zhang,1,2 Adam Huys,1,2 and Christopher D. Richardson3 Department of Microbiology and Immunology, University of Saskatchewan, Saskatoon, SK, Canada1; Vaccine and Infectious Disease Organization (VIDO), University of Saskatchewan, Saskatoon, SK, Canada2; and Department of Microbiology and Immunology, 5850 College St., Dalhousie University, Halifax, NS, Canada3 Received 27 September 2010/Accepted 14 December 2010
MicroRNA 122 (miR-122) increases the accumulation and translation of hepatitis C virus (HCV) RNA in infected cells through direct interactions with homologous sequences in the 5ⴕ untranslated region (UTR) of the HCV genome. Argonaute 2 (Ago2) is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. We investigated the function of Ago2 in HCV replication to determine whether it plays a role in enhancing the synthesis and translation of HCV RNA that is associated with miR-122. siRNA-mediated depletion of Ago2 in human hepatoma cells reduced HCV RNA accumulation in transient HCV replication assays. The treatment did not adversely affect cell viability, as assessed by cell proliferation, capped translation, and interferon assays. These data are consistent with complementary roles for Ago2 and miR-122 in enhancing HCV RNA amplification. By using a transient HCV replication assay that is dependent on an exogenously provided mutant miR-122, we determined that Ago2 depletion still reduced luciferase expression and HCV RNA accumulation, independently of miR-122 biogenesis. miR-122 has previously been found to stimulate HCV translation. Similarly, Ago2 knockdown also reduced HCV translation, and its depletion reduced the ability of miR-122 to stimulate viral translation. These data suggest a direct role for Ago2 in miR-122-mediated translation. Finally, Ago2 was also necessary for efficient miR-122 enhancement of HCV RNA accumulation. These data support a model in which miR-122 functions within an Ago2-containing protein complex to augment both HCV RNA accumulation and translation. target the 3⬘ UTR of mRNA transcripts and suppress translation, miR-122 is unusual in that it binds to the 5⬘ UTR of the virus genome and does not suppress, but rather augments, translation and RNA accumulation. The mechanism of action of miR-122 in the HCV life cycle is unknown, but it has been shown to enhance viral-RNA interaction with ribosomes (6), and part, but not all, of the positive effect of miR-122 on HCV may be due to translation stimulation (10). miR-122 does not affect RNA elongation rates during virus replication (36), and so it does not appear to enhance the actual rate of RNA synthesis. It has been shown by in vitro modeling systems that miR-122 alters the conformation of the 5⬘ UTR of HCV by modulating RNA-RNA interactions between the 5⬘ UTR and the HCV core sequence, but the biological relevance of these conformation changes remains to be confirmed (4). An inhibitor of miR-122 has recently been shown to have potent antiviral activity in HCV-infected chimpanzees and has generated significant interest in its potential for use as an HCV therapeutic agent (17). Thus, there is a need to gain more knowledge of the mechanism of action of miR-122 in HCV infections. In mammals, microRNAs normally function to regulate the translation of cellular mRNAs through incorporation into a protein complex called the RNA-induced silencing complex (RISC) (29). At the heart of the RISC are proteins called Argonautes (Ago). Human cells have four human Ago proteins (Ago1, -2, -3, and -4). The onboard microRNA (guide strand) targets the RISC to the 3⬘ UTR of mRNA by imperfect sequence complementarity and induces translational suppres-
Hepatitis C virus (HCV) is an important human pathogen that is estimated to infect over 180 million people worldwide. Chronic HCV infection causes liver failure and hepatocellular carcinoma and in North America is currently the primary indication for liver transplantation (2). Therapy for HCV infection is limited to a combination of interferon (IFN) and ribavirin. However, therapy is not only difficult to tolerate due to severe side effects, but is successful in only about 50% of all cases. Clearly, there is a need for the development of more effective antiviral therapies. The focus currently is on studying specific interactions with the host that are required for HCV replication. A more complete understanding of viral replication will allow researchers to identify molecular targets for antiviral drug development. Perhaps one of the most interesting interactions between HCV and the host cell is with the microRNA pathway. Efficient HCV translation and viral-RNA accumulation in Huh-7 cells is stimulated by a microRNA called miR-122 (6, 10, 13, 14). miR-122, like all microRNAs, is an imperfectly basepaired small RNA duplex, and to enhance HCV RNA levels in cells, it requires direct binding of the guide strand of the microRNA to dual sites on the 5⬘ untranslated region (UTR) of the HCV genome (10, 13, 14). While most microRNAs
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of Saskatchewan, Saskatoon, SK, Canada. Phone: (306) 966-1544. Fax: (306) 966-7478. E-mail: joyce
[email protected]. 䌤 Published ahead of print on 22 December 2010. 2342
VOL. 85, 2011
Ago2 KNOCKDOWN AFFECTS HCV RNA ACCUMULATION/TRANSLATION
2343
FIG. 1. Schematic representation of the sequence for the HCV 5⬘ UTR, the location of the miR-122 binding sites, and binding of miR-122. (Left) Sequence of the 5⬘ UTR of J6/JFH-1 Rluc HCV RNA, with miR-122 binding site 1 (S1) and site 2 (S2) in boldface. (Right) Model for binding of miR-122 to the HCV 5⬘ UTR.
sion. The mechanism of microRNA-directed translational suppression is currently unknown but has been shown to function both before and after translation initiation. Following suppression, microRNA and Ago proteins relocalize the mRNA to cellular structures called processing (P) bodies (19, 32); however, assembly of and transport to P bodies appear to be the result rather than a cause of translational inhibition (3, 5). It is unknown whether activity of miR-122 in HCV RNA translation or RNA accumulation requires association with a protein complex similar to the RISC and if the activity of miR-122 on HCV involves processes common to microRNA gene suppression. Unlike the function of miR-122 in augmentation of HCV replication, there is also evidence that the microRNA pathway has antiviral activity against HCV. Several microRNAs were determined to downregulate HCV in cultured cells (24, 27), and some were upregulated by interferon stimulation (27). In plants and worms, RNA interference (RNAi), a process similar to microRNA gene suppression in which exogenous RNAs are processed into small RNAs called small interfering RNAs (siRNAs), plays an important antiviral role (37). Doublestranded viral RNA is recognized as foreign in infected plant cells and is cleaved by Dicer into 21-bp fragments, or siRNAs. Similar to microRNA, siRNAs are incorporated into the RISC, and the onboard siRNA targets the RISC to single-stranded viral RNA that has homologous sequences. In RNAi, however, targeted RNAs are cleaved by Ago2 protein within the RISC (18) and lead to viral-RNA degradation and clearance of the viral RNA from the cell. RNAi has been described as an RNA-based “immune” system in worms and plants and is believed to be an ancient defense mechanism to combat invading nucleic acids. RNAi is used as a tool to induce the knockdown of genes in mammalian cells by the introduction of synthetic siRNA, but it is controversial whether endogenous RNAi functions as a defense mechanism in mammalian cells. It is therefore interesting that HCV core has been reported to suppress the activity of Dicer, which is required for microRNA biogenesis in mammals and both microRNA and siRNA biogenesis in Drosophila, presumably to prevent HCV RNA from being processed into antiviral siRNAs (11). Since miR-122 plays a critical role in the HCV life cycle and Ago2 plays a central role in siRNA and microRNA activities, we set out to explore the potential significance of Ago2 for HCV RNA levels. We used transient HCV replication assays and siRNA-mediated depletion to determine whether Ago2
functions in concert with miR-122 as a stimulator of HCV. Our data support a role for Ago2 in HCV RNA accumulation, since depletion of Ago2 caused HCV RNA levels to decrease. In addition, Ago2 is required for efficient miR-122 augmentation of HCV RNA levels. Ago2 is also required for miR-122 stimulation of HCV translation, and its depletion attenuates HCV translation. We propose a model in which miR-122 binds to the HCV genome within a nucleoprotein complex containing Ago2. MATERIALS AND METHODS Cell culture. The cell line Huh 7.5 (25) was kindly provided by Charles Rice. Huh 7.5 cells were routinely grown in Dulbecco’s minimal essential medium supplemented with nonessential amino acids, 100 U/ml of penicillin, 100 g/ml of streptomycin, and 10% fetal calf serum (FCS) (Wisent Inc., Montreal, Canada). Plasmids and DNA probes. The HCV replicon plasmids pHCVrepAB12luc and pHCVrepAB12luc GND (38) and the full-length HCV genome pJ6/JFH-1 Rluc and pJ6/JFH-1 Rluc GNN (12) plasmids were described previously. pJ6/ JFH-1 Rluc m3-4 and pJ6/JFH-1 Rluc m3-4 GNN contain point mutations within the miR-122 binding sites in the HCV 5⬘ UTR (U26C, A27G, U41C, and A42G) (Fig. 1). Mutations were made by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Mississauga, ON, Canada) and the following mutagenic primers: Site 1 p3-4s, AGGGGCGA CACAGCGCCATGAAT; Site 1 p3-4as, ATTCATGGCGTCTCTGCGGGGA; Site 2 p3-4s, CATGAATCACAGCCCCTGTGAGGA; and Site 2 p3-4as, TCC TCACAGGGGCTGTGATTCATGG. Small interfering RNAs and microRNA sequences. RNA oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The target sequences for the siRNAs were as follows: siControl, GAGAGUCAGUCAGCUAAUCA CTT; siControl B, GCAGCAGCUGUUCCAGGCACCUTT; SiAgo2, CAGAC UCCCGUGUGUCCUATT; SiAgo2-ORF, CGGACAAUCAGACCUCCA CTT; miControl, GAGAGUCAGUCAGCUAAUCACTT; miR-122, UGGAG UGUGACAAUGGUGUUUGU; miR-122p3-4, UGCUGUGUGACAAUGG UGUUUGU; and miR-122*, AAACGCCAUUAUCACACUAAAUA. The duplexes miR-122 and miR-122p3-4 were made by annealing miR-122/miR-122* and miR-122p3-4/miR-122*, respectively. In vitro transcription of replicon RNA. HCV RNA was transcribed from plasmid pHCVrepAB12luc (and derivatives) linearized with ScaI or from pJ6/ JFH-1 Rluc (and derivatives) linearized with XbaI and mung bean nuclease, using the T7-Megascript in vitro transcription kit (Ambion, Austin, TX) according to the instructions of the manufacturer. Capped firefly luciferase mRNA was transcribed from pT7Luc (Promega Co., Madison, WI), linearized with XmnI, by using the mMessageMachine in vitro transcription kit (Ambion, Austin, TX). Transient HCV replication assays. For transient HCV replication assays, Huh 7.5 cells were prepared and electroporated according to the methods previously described by Lohmann et al. (21). Cells were first electroporated with 60 pmol of siAgo or siControl or with no siRNA before the start of the experiment to knock down the targeted genes. Three days later, the cells were prepared and electroporated a second time with 5 g of HCVrepAB12luc RNA or J6/JFH-1 Rluc (and derivatives) and 60 pmol of the same siRNA used in the primary electroporation. Following electroporation, the cells were resuspended in 8 ml of me-
2344
WILSON ET AL.
dium and plated for subsequent harvest for luciferase assays (500 l per time point) at 2 h and 1, 2, 3, and 4 days postelectroporation; for protein analysis (500 l); for RNA purification (2 ml); and for Wst-1 assay (25 l). For experiments designed to measure transient replication of J6/JFH-1 Rluc m3-4, 5 g of viral RNA was coelectroporated with 60 pmol of miR-122p3-4/miR-122* or control synthetic microRNA duplexes. For experiments designed to measure miR-122 augmentation of HCV replication, 1 g of J6/JFH-1 Rluc RNA was coelectroporated with 60 pmol of miR-122/miR-122* or control microRNA duplexes. Transient HCV translation assays. For transient HCV translation assays, Huh 7.5 cells were first electroporated with 60 pmol of Ago2 or control siRNA. Three days following the first electroporation, the cells were prepared and reelectroporated with 5 g of J6/HCV RLuc GNN RNA and 1 g of capped luciferase RNAs as an internal control. Before the second electroporation, a 50-l sample of the prepared cells was harvested for analysis of Ago2 protein levels. After electroporation, the cells were resuspended in 5 ml of medium and plated for harvest to assay luciferase expression (500 l) at 3.5 and 4 h postelectroporation, to purify total RNA (3 ml) at 4 h postelectroporation, and to measure cell growth by Wst-1 assay (50 l). Luciferase assays. Cells were washed twice in phosphate-buffered saline (PBS) and harvested in 100 l luciferase assay buffer (for firefly luciferase assays), Renilla luciferase assay buffer (for Renilla luciferase assays), or passive lysis buffer (for dual luciferase assays) (Promega Co., Madison, WI) by cell scraping. Luciferase activity was assayed by using the manufacturer’s instructions; emitted light was measured by using a Glomax 20/20 luminometer (Promega Co., Madison, WI). Wst-1 assays. Immediately following the second siRNA/HCV replicon RNA electroporation, 25 l of cells from each sample was seeded into a 96-well tissue culture plate. Three days later, cell numbers were assessed by using Wst-1 reagent (Roche Canada, Mississauga, ON, Canada). RNA purification and Northern blot analysis. Cells were harvested into 1 ml of Trizol reagent (Invitrogen, Burlington, ON, Canada) and purified by using the recommended protocol. Three to 10 g of total RNA was treated with glyoxal and subjected to electrophoresis in a 0.9% agarose gel using standard techniques (1). The gels were transferred to a Hybond N⫹ nylon membrane (GE Healthcare, Mississauga, ON, Canada), immobilized by UV cross-linking, and probed with 32P-labeled probes (Ready-To-Go DNA-labeling beads; GE Healthcare, Mississauga, ON, Canada). The probes used were a 1.3-kbp PstI-digested fragment from human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA and a 2-kbp BamHI-to-XbaI fragment from bp 7272 to 10678 of the pJ6/JFH-1 Rluc plasmid to probe for HCV RNA. Real-time PCR analysis of RNA. All RNA was reverse transcribed using the iScript reverse transcription kit (Bio-Rad Inc., Mississauga, ON, Canada). Ago2 mRNA and HCV genomic RNA levels were quantified using TaqMan probes and primers. For Ago2 mRNA quantification, the Applied Biosystems gene expression assay Hs00293044_m1 was used (Applied Biosystems Inc., Carlsbad, CA). To quantify HCV genomic RNA, we used a custom TaqMan MGB probe, 6-carboxyfluorescein (FAM)-CCT TCA TCT CCT TGA GCA CGT CCC, and PCR primers CTT TGA CAG ACT GCA GG TCC TG and GCC TTA ACT GTG GAC GCC TTC. Human 18s rRNA was quantified using the TaqMan rRNA control reagents (Applied Biosystems Inc., Carlsbad, CA) as an endogenous control. Relative amounts of Renilla luciferase RNA (representing HCV RNA amounts) and firefly luciferase RNA (controlling for transfection efficiency) were quantified by real-time PCR using Sso Fast EvaGreen Supermix (Bio-Rad, Mississauga, ON, Canada) according to the manufacturer’s protocol. The genespecific primers used were 5⬘ TCGCCAGTCAAGTAACAAC 3⬘ and 5⬘ ACTT CGTCCACAAACACAA 3⬘ to amplify firefly luciferase cDNA and 5⬘ AACGC GGCCTCTTCTTATTT 3⬘ and 5⬘ GTCTGGTATAATACACCGCG 3⬘ for Renilla luciferase found in the HCV replicon genome (13). Quantitative reverse transcriptase (qRT) PCR was carried out using the CFX 96 system (Bio-Rad, Mississauga, ON, Canada). miR-122 quantification. For real-time reverse transcriptase PCR analysis of endogenous miR-122 amounts following Ago2 knockdown, 1 g of total RNA was reverse transcribed in vitro to cDNA with miR-122 (TM2245) and small nuclear RNA U6 (U6 snRNA) (RT1093)-specific RT primers provided in the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) according to the manufacturer’s instructions. SDS-PAGE and Western blot analysis. Total protein from equal numbers of cells was harvested in SDS-PAGE protein sample buffer (10% SDS, 10 nM DTT, 20% glycerol, 0.2 M Tris-HCl, pH 6.8, 0.05% bromophenol blue). Samples were subjected to electrophoresis and transferred to a Hybond-C Extra nitrocellulose membrane (GE Healthcare, Mississauga, ON, Canada). The blots were probed with primary antibody, mouse monoclonal anti-actin (AC-15; Abcam, Cam-
J. VIROL. bridge, MA) or rabbit anti-Ago2 (a gift from T. Hobman, University of Alberta, Edmonton, AB, Canada). Subsequently, the blots were probed with secondary goat anti-mouse and/or goat anti-rabbit antiserum conjugated with horseradish peroxidase (Jackson Immunoresearch Laboratories, West Grove, PA) and visualized using enhanced chemiluminescence (GE Healthcare, Mississauga, ON, Canada).
RESULTS Reduced luciferase expression and HCV RNA levels in transient HCV replicon replication assays following Ago2 knockdown. Our goal was to analyze the effect of the human Ago2 gene on HCV RNA accumulation using transient HCV replication assays. To that end, we designed two siRNAs to knock down Ago2 mRNA levels, one targeting the 3⬘ UTR (siAgo2) and the other targeting the open reading frame (siAgo2-ORF). To confirm Ago2 knockdown, we used real-time PCR analysis to determine the levels of Ago2 RNA following siRNA electroporation and found 70% and 50% mRNA knockdown by siAgo2 and siAgo2-ORF, respectively (Fig. 2D). To analyze the influence of Ago2 on viral-RNA synthesis, we used transient HCV replication assays. The assays are based on those previously described, in which it has been confirmed that luciferase expression levels correlate with HCV RNA levels (12, 20). The transient HCV replication assays showed 80% (siAgo2) and 50% (siAgo2-ORF) reductions in luciferase expression in cells in which Ago2 had been knocked down compared to control siRNAs (Fig. 2B). Partial inhibition of HCV luciferase expression and RNA accumulation was likely due to incomplete knockdown of Ago2 or to the possible effects of another Argonaute protein (Ago1, -3, or -4). Quantification of HCV RNA levels by real-time PCR analysis at 3 days following replicon electroporation confirmed that the HCV RNA levels correlated with the levels of luciferase reporter (Fig. 2C). These results suggest that Ago2 is required for efficient HCV replication in Huh 7.5 cells and support a scenario in which the RNAi machinery enhances HCV RNA accumulation. Ago2 knockdown does not affect cell proliferation, capped translation, or IFN stimulation. A decrease in HCV RNA levels in our assays could have been due to a generalized effect on cellular proliferation or translation levels due to Ago2 knockdown. To rule out these possibilities, we measured the effects of Ago2 siRNA electroporation, cell proliferation, and capped-translation levels (Fig. 2E and F). By using Wst-1 assays, we measured cell proliferation to determine if Ago2 knockdown affected cell metabolism or growth. We plated equivalent cell volumes from each sample following electroporation and saw no difference in cell numbers 3 days later. This result showed no significant differences between cell proliferation rates in samples in which Ago2 had been depleted and those of the control samples (Fig. 2E). We also evaluated the effect of Ago2 depletion on capped mRNA translation. For these experiments, we transcribed capped luciferase RNA in vitro and introduced it into cells during the second electroporation step. One day later, we saw no significant difference in the levels of luciferase expression in cells with and without Ago2 knockdown (Fig. 2F). These data support the conclusion that Ago2 depletion did not have a measurable negative effect on normal cell growth or translation and suggest that Ago2 has a more direct role in augmenting HCV RNA levels.
VOL. 85, 2011
Ago2 KNOCKDOWN AFFECTS HCV RNA ACCUMULATION/TRANSLATION
FIG. 2. Effects of Ago2 knockdown on replication from the HCV subgenomic replicon. (A) Schematic representation of the HCVrepAB12luc subgenomic replicon RNA. EMCV, encephalomyocarditis virus; FLuc, firefly luciferase. (B) Huh 7.5 cells were electroporated with the indicated siRNAs. Three days later, they were reelectroporated with HCVrepAB12luc or HCVrepAB12luc GND RNA, as indicated, and with another dose of the indicated siRNA. Luciferase expression levels at 3 days after the second electroporation are shown relative to those obtained from HCVrepAB12luc following treatment with the control siRNA (siControl-B). (C) RNA samples were harvested from the experiment shown in panel B, and HCV RNA levels were measured by real-time reverse transcriptase PCR. HCV RNA levels are shown relative to the levels seen in HCVrepAB12luc treated with siControl. (D) RNA samples were also analyzed for levels of Ago2 mRNA to assess the efficiency of siRNA-directed mRNA depletion. (E) Cell proliferation measured by using Wst-1 is shown relative to that seen in the control sample (HCVrepAB12luc plus miControl-B). (F) Translation of a capped luciferase mRNA was not altered by depletion of Ago2. Cells electroporated with the indicated siRNAs were reelectroporated with a capped luciferase RNA and assayed for luciferase expression levels 6 h later. Luciferase expression is shown relative to that seen following electroporation with siControl. wt, wild type. Data for all experiments are shown as averages from three independent experiments; the error bars represent standard deviations.
Reduced accumulation of HCV JFH-1 genomic RNA following knockdown of Ago2. To rule out the possibility that reduced replicon synthesis was an artifact associated with the use of HCV subgenomic replicons, we measured the effects of Ago2 knockdown using the full-length RNA from genotype 2a
2345
FIG. 3. Ago2 depletion also attenuates replication from a fulllength JFH-1 genomic RNA. (A) Schematic representation of the full-length HCV JFH-1 RNA. RLuc, Renilla luciferase. (B) Huh 7.5 cells were electroporated with the indicated siRNAs. Three days later, the cells were reelectroporated with J6/JFH-1 Rluc RNA plus siRNA, and 2 days later, they were assayed for luciferase expression. The luciferase expression levels are presented relative to that seen in the sample treated with J6/JFH-1 Rluc and miControl. (C) Samples from the experiment in panel B prepared 2 days after the second electroporation were subjected to Northern blot analysis for HCV RNA using GAPDH RNA as a loading control (top) and by immunoblot analysis of human Ago2 protein with -actin as a loading control (bottom). (D) Relative cell numbers in each sample from the experiment in panel B as measured by Wst-1 assay. (E) miR-122 levels 2 days after the second electroporation were analyzed in cells from panel B by realtime reverse transcriptase PCR. The data are shown as averages from four independent experiments; the error bars represent standard deviations.
JFH-1. We used a monocistronic HCV genome containing an integrated Renilla luciferase gene that can be used to monitor replication levels (Fig. 3A). Assays were performed by coelectroporation of specific siRNAs and HCV RNA and by analyzing luciferase and RNA levels at 2 days postelectroporation. Following Ago2 knockdown, both luciferase (Fig. 3B) and HCV RNA (Fig. 3C) levels were decreased. Efficient Ago2 knockdown was confirmed by Western blot analysis (Fig. 3D). Wst-1 assays confirmed that inhibition of HCV RNA synthesis was not due to decreased cell viability following gene knockdown (Fig. 3E). In addition, there was no significant difference in the levels of miR-122 following Ago2 knockdown (Fig. 3F). Ago2 knockdown also decreases HCV luciferase expression and RNA accumulation in HCV replication assays independently of endogenous miR-122. To confirm that the effects of
2346
WILSON ET AL.
J. VIROL.
FIG. 4. Ago2 is required for HCV replication in assays in which replication is independent of endogenous miR-122 levels. (A) Time course expression of luciferase (in arbitrary units) in extracts from cells electroporated with wild-type J6/JFH-1 Rluc (samples 1, 2, 9, and 10), nonreplicative J6/JFH-1 Rluc GNN (sample 8), or J6/JFH-1 Rluc m3-4 (samples 3, 4, 5, 6, and 7), an HCV genome having point mutations to both miR-122 binding sites in the 5⬘UTR. HCV RNAs were coelectroporated with combinations of miR-122, miR-122p3-4, or miControl, as well as siRNA to knock down Ago2 or control siRNA, as indicated. miR-122 augmented the levels of J6/JFH-1 Rluc replication (sample 2) to levels higher than those induced by the addition of control microRNA (sample 1), and siAgo2 decreased Rluc expression when added to each of these samples (samples 9 and 10). Luciferase expression from J6/JFH-1 Rluc m3-4 (sample 4) was equivalent to that of the nonreplicative control J6/JFH-1 Rluc GNN (sample 9) and was not enhanced by coelectroporation of miR-122 (sample 3). Luciferase expression was reinstated in cells electroporated with J6/JFH-1 Rluc m3-4 when coelectroporated with the complementary microRNA miR-122p3-4 (sample 5) and was not changed significantly by the addition of control siRNA (sample 6). Depletion of Ago2 attenuated luciferase expression levels from cells electroporated with J6/JFH-1 Rluc m3-4 and miR-122p3-4 (sample 7). (B) RNA samples prepared 3 days after coelectroporation from some samples described in the legend to panel A were analyzed by Northern blot analysis for HCV levels, using GAPDH levels as a loading control. HCV RNA accumulation shown in panel B correlates with luciferase expression shown in panel A. The luciferase levels are the averages of three independent experiments; the error bars represent the standard deviations.
Ago2 knockdown on HCV RNA accumulation were not due to altered miR-122 levels in the cell, we measured transient HCV replication in assays in which viral-genome amplification is not dependent on endogenous miR-122 but on an exogenously provided microRNA. In this assay, we constructed a mutant HCV J6/JFH-1 genome that contained point mutations within both of the miR-122 binding sites that are located in the 5⬘ UTR. This HCV RNA mutant (HCV J6/JFH-1 Rluc m3-4) is based on those described previously (13, 14) and does not replicate when transfected into Huh7.5 cells alone (Fig. 4A and B, sample 4). However, replication of this mutant was evident following coelectroporation with a synthetic microRNA that had compensatory mutations that restored binding to the mutant miR-122 binding sites (Fig. 4A, line 5, and B). Enhanced luciferase expression and RNA accumulation following miR122p3-4 complementation was observed, but the levels on day 3 were less than those of the wild-type HCV genome (Fig. 4A and B, sample 4 versus sample 5). This could have been due to the nature of the primary sequence changes introduced into the RNA but also appeared to be due to a delay in the initiation of RNA accumulation in this sample. Initiation of increas-
ing HCV luciferase expression was delayed by 1 day in J6/ JFH-1 Rluc m3-4 plus miR-122p3-4 (Fig. 4A, sample 5) compared to wild-type HCV RNAs (Fig. 4A, sample 1), but the kinetics of HCV luciferase expression were similar on subsequent days. The delay could have been due to the time required for sufficient loading of miR-122p3-4 into Ago2. However, in in vitro assays, RISC assembly is rapid and is accomplished in an hour or less (35). Thus, the delay may be due to actions necessary for augmentation of HCV RNA accumulation subsequent to miR-122 binding to Ago2, perhaps the assembly of a more complex Ago2/miR-122p3-4 nucleoprotein complex. Importantly, knockdown of Ago2 reduced both the levels and the rate of increase in HCV-directed luciferase expression (Fig. 4A and B, sample 8), which suggests that Ago2 is required to maintain HCV accumulation rates and that the activity of Ago2 is not solely based upon a function in miR-122 biogenesis. Ago2 knockdown decreases translation from full-length HCV JFH-1 genomic RNA. Interestingly, analysis of HCV translation using a full-length HCV JFH-1 genome showed that Ago2 knockdown had a significant, albeit small, negative
VOL. 85, 2011
Ago2 KNOCKDOWN AFFECTS HCV RNA ACCUMULATION/TRANSLATION
2347
FIG. 5. siRNA knockdown of Ago2 diminishes HCV translation. (A) Schematic representation of the HCV genomic RNA and firefly mRNA used in transient-translation assays. In transient HCV translation assays, Huh 7.5 cells were electroporated with the indicated siRNAs and 3 days later coelectroporated with J6/JFH-1 Rluc GNN (incapable of replication) and capped mRNA for firefly luciferase as a control. (B) Ratios of Renilla luciferase/firefly luciferase expression levels measured at 3.5 and 4 h postelectroporation. Translation from the HCV RNA decreased significantly following Ago knockdown. (C) Cell proliferation levels measured by Wst-1 analysis at 4 h following the second electroporation (D) Relative HCV/firefly luciferase RNA levels measured by real-time PCR at 4 h after the second electroporation. The data are shown as averages from three independent experiments; the error bars represent standard deviations.
effect on HCV translation. In the context of the full-length HCV JFH-1 genome (Fig. 5A), knockdown of Ago2 caused a significant decrease in HCV translation levels at 3.5 and 4 h postelectroporation compared to a capped firefly luciferase mRNA control (Fig. 5B). Ago2 knockdown did not affect cell proliferation during the assay (Fig. 5C). In addition, the HCV/ firefly luciferase RNA ratios in the assays remained consistent (Fig. 5D), suggesting that the changes in expression ratios were not due to changing quantities of the two RNAs. Efficient knockdown of Ago2 was confirmed by Western blot analysis (data not shown). The effects of Ago2 knockdown on HCV translation were relatively small (20 to 25%) but were similar to those seen by impeding the function of miR-122 (6), and this led us to speculate that the two activities might be related. Decreased HCV translation following Ago2 knockdown is dependent on direct interaction between miR-122 and its binding sites on the HCV genome. Since knockdown of Ago2 reduces HCV translation by about 25% and others have shown that miR-122 stimulates HCV translation levels from the HCV genome by approximately 50% (6), we hypothesized that the effects of miR-122 in augmenting HCV translation may occur via the function of an Ago2-containing complex. To test this hypothesis, we analyzed the effect of Ago2 knockdown on translation from a nonreplicating HCV RNA (GNN) in which the miR-122 binding sites have been mutated (Fig. 6A). Viral translation was assayed by measuring Renilla luciferase levels relative to those from a capped mRNA encoding firefly luciferase. Basal translation levels from J6/JFH-1 Rluc m3-4 GNN were approximately 50% of that seen from wild-type J6/JFH-1 Rluc GNN (Fig. 6B). While knockdown of Ago2 caused a 25% decrease in the relative translation levels from the wild-type J6/JFH-1 Rluc GNN RNA (Fig. 5B), Ago2 depletion did not affect translation levels from HCV J6/JFH-1 Rluc m3-4 GNN (Fig. 6C, miControl). This result suggested that miR-122 bind-
ing sites are necessary for Ago2 regulation of HCV translation. Importantly, supplementation with miR-122p3-4 stimulated translation from J6/JFH-1 Rluc m3-4 GNN by 2-fold, and this stimulation was attenuated following Ago2 depletion (Fig. 6D). These data indicate that the effects of Ago2 depletion on HCV translation require miR-122 binding to the 5⬘ UTR and that efficient stimulation of HCV translation by miR-122 also requires the function of Ago2. These data are important, since they support the hypothesis that augmentation of HCV translation and RNA accumulation by miR-122 is mediated by Ago2, possibly through association with a RISC-like complex. Ago2 depletion and microRNA supplementation did not affect the ratios of J6/JFH-1 Rluc m3-4 GNN to firefly luciferase mRNA (Fig. 6E) or cell proliferation (Fig. 6F). Efficient miR-122 augmentation of HCV RNA amplification is dependent on Ago2. Our evidence suggested a dependence on Ago2 for miR-122 stimulation of HCV translation. We were then interested in determining whether Ago2 also plays a supporting role in the accumulation of HCV RNA, which appears to be mediated by miR-122. To test this, we analyzed the influence of Ago2 depletion on the ability of miR-122 to stimulate Renilla luciferase expression from J6/JFH-1 Rluc reporter constructs and to increase HCV RNA levels during HCV replication assays. In transient HCV replication assays using full-length J6/JFH-1 Rluc RNA, miR-122 augmented the relative luciferase expression level 3.4-fold (Fig. 7A). Following Ago2 knockdown, the luciferase expression levels decreased, as expected, and the average luciferase expression levels did not change significantly following Ago2 depletion and miR-122 supplementation (Fig. 7A). These data suggest that Ago2 depletion abolishes miR-122 augmentation of HCV RNA levels. The data were also analyzed by comparing the levels of miR-122 augmentation, with and without Ago2 depletion, in each individual experiment (Fig. 7B). When ana-
2348
WILSON ET AL.
J. VIROL.
FIG. 6. Reduction in HCV translation following Ago2 knockdown depends upon direct microRNA binding to the miR-122 binding sites in the HCV 5⬘ UTR. (A) Huh 7.5 cells were electroporated with the indicated siRNAs and 3 days later electroporated with J6/JFH-1 RLuc m3-4 GNN, capped polyadenylated firefly luciferase mRNA, and control microRNA or miR-122p3-4. (B) Relative basal levels of translation from J6/JFH-1 Rluc GNN and J6/JFH-1 Rluc m3-4 GNN. (C) Relative ratios of Renilla luciferase/firefly luciferase expression levels measured at 3.5 h postelectroporation. Ago2 depletion did not affect translation from J6/JFH-1 Rluc m3-4 GNN when coelectroporated with a control microRNA (miControl) but attenuated HCV translation when coelectroporated with miR-122p3-4. (D) Data from the experiment shown in panel C were reanalyzed to compare the fold stimulation of translation induced by miR-122p3-4. (E) Relative ratios of HCV genomic RNA/firefly luciferase mRNA in each sample were similar, as measured by real-time reverse transcriptase PCR analysis, and (F) no difference was seen in the relative cell proliferation rates in each sample. The data are shown as averages from three independent experiments; the error bars represent standard deviations.
lyzed in this manner, there was a measurable increase in HCV luciferase expression levels due to the presence of miR-122, even with Ago2 knockdown. However, enhancement of HCV reporter activity decreased from 3.4-fold in control cells to 1.4-fold following Ago2 knockdown (Fig. 7B). Thus, miR-122 enhancement of HCV luciferase expression in transient HCV replication assays was attenuated, but not abolished, following Ago2 knockdown. These data suggest that Ago2 is required for efficient miR-122 enhancement of HCV RNA accumulation. Analysis of HCV RNA levels in these experiments (Fig. 7C) supported the conclusion that Ago2 is required for efficient miR-122 enhancement of HCV RNA accumulation. HCV RNA levels increased 2.9-fold in the presence of Ago2 and 1.6-fold following Ago2 depletion (Fig. 7D). Cell growth and viability were equivalent in each sample (Fig. 7E), and knockdown of Ago2 was confirmed by Western blot analysis (Fig. 7F). The fact that the miR-122-mediated increase in RNA accumulation was not completely abolished by Ago2 depletion suggests residual Ago2 protein, or other human Argonaute gene products, such as Ago1, -3, or -4, could also play a redundant role in miR-122-enhanced HCV replication. Knockdown of Ago1, -3, and -4 was previously reported to attenuate HCV replication levels (30). These data support a model in
which miR-122 associates with a ribonucleoprotein complex containing an Argonaute protein(s) to mediate enhancement of HCV RNA accumulation and translation. DISCUSSION We found that HCV RNA accumulation in cultured Huh 7.5 cells was reduced following Ago2 knockdown, suggesting that the activity of Ago2 in this system facilitates HCV RNA accumulation. Furthermore, we have evidence suggesting that miR-122, which binds to two tandem binding sites near the 5⬘ end of the HCV genome (13, 14), requires Ago2 to enhance HCV RNA levels. Based on the activity of Ago2 in RISC assembly, its binding to microRNA, and its role in microRNA translational suppression, we hypothesize that miR-122 likely binds to the HCV genome within an Ago2containing protein complex. Ago proteins are the best-characterized components of the siRNA- or microRNA-containing RISCs and are the central players in RNAi-related pathways. They incorporate and process small RNA duplexes, such as siRNA and microRNA, and mediate translational suppression. Ago proteins contain characteristic structural elements called PAZ and PIWI domains (34). The
VOL. 85, 2011
Ago2 KNOCKDOWN AFFECTS HCV RNA ACCUMULATION/TRANSLATION
FIG. 7. siRNA knockdown of Ago2 diminishes miR-122 augmentation of HCV replication. (A) Huh 7.5 cells were electroporated with the indicated siAgo2 or siControl siRNA. Three days later, the cells were reelectroporated with siRNA, J6/JFH-1Rluc RNA, and either miR-122 or miControl RNA. Relative Renilla luciferase expression levels in transient HCV replication assays were measured in cells harvested 2 days after the second electroporation. (B) Data from panel A were analyzed to calculate the fold increase in Renilla luciferase expression following miR-122 supplementation. (C) HCV RNA samples from cells from the experiment shown in panel A were analyzed by Northern blotting, using GAPDH RNA as a loading control. (D) Phosphorimage analysis of HCV RNA levels in the Northern blot shown in panel C. (E) Cell proliferation in the transient HCV replication assay shown in panel A was analyzed with Wst-1 2 days following the second electroporation. (F) Ago2 depletion in cells from the experiment in panel A was confirmed by Western blot analysis. The data are shown as averages of three independent experiments; the error bars represent standard deviations.
PAZ domain of Ago2 binds to RNA in a sequence-independent manner through recognition of single-stranded 3⬘ overhangs of microRNA duplexes (23). The crystal structures of Ago proteins
2349
revealed that the RNA duplex resides in a positively charged groove formed by both the PAZ and PIWI domains (33). The RISC (miRISC) mediates translational suppression of targeted mRNA. The mechanism of gene suppression by microRNAs is controversial. Following microRNA binding, Ago2 mediates unwinding of the microRNA imperfect duplex and exposure of the guide strand. Some evidence suggests that Ago2 proteins bind to EIF4E protein to abolish cap-dependent translation (16), while others refute this (15). Evidence suggests that the RISC inhibits both translation initiation (28) and elongation (31). Subsequent to mRNA suppression, the mRNA is targeted to cytoplasmic structures called P bodies for degradation or storage (5, 8, 19). It appears that Ago2 has a central role in microRNA regulation of mRNA translation, stability, and localization. We hypothesize that miR-122 functions to augment HCV RNA accumulation and translation via association with a ribonucleoprotein complex similar or identical to the miRISC. Assembly of the miR-122/Ago2 complex required for activation of HCV translation is rapid, as the effects can be seen by 3.5 h postelectroporation. The complex likely mediates miR122 strand selection and binding to the HCV 5⬘ UTR. Following binding, we predict that the miR-122/Ago2 complex then functions to stimulate translation and increased HCV RNA accumulation. The mechanism of miR-122 activation of translation is unknown, but microRNA activation of translation by binding to the 5⬘ UTR is not unique to HCV. miR-10a also binds to and enhances translation of a ribosomal protein mRNA under starvation conditions while still suppressing other mRNAs (26). In addition, internal ribosome entry site (IRES) elements have been reported to be both resistant and susceptible to microRNA-directed translational suppression activity when present on transfected RNAs (7, 28). The HCV IRES has been reported to be susceptible to microRNA-directed suppression of translation during translation elongation and when Ago2 is tethered to the 5⬘ UTR (22). However, our data suggest that miR-122 recruits Ago2 to the 5⬘ UTR to enhance translation. The reason Ago2 association with the 5⬘ UTR can suppress HCV translation in one case and stimulate translation in another is unclear. Perhaps cell-specific differences modulate microRNA activity, or perhaps the specific context of the miR-122 binding sites on the HCV 5⬘ UTR alters the influence of Ago2 on translation. The mechanism of miR-122 augmentation of HCV RNA accumulation is unknown. Since miR-122 does not alter the rate of viral-RNA polymerization (36), miR-122/Ago2 may function through modulating HCV translation, initiation of RNA replication, or RNA stability. Our data suggest that miR122 functions within an Ago2-containing protein complex, presumably in association with the HCV 5⬘ UTR. Our data suggest that the miR-122/Ago2 complex that is required for augmentation of HCV translation is active by 3.5 h after coelectroporation of microRNA and HCV RNA. However, in transient HCV replication assays, luciferase accumulation appeared to be delayed in experiments where viral RNA and microRNA were coelectroporated. The nature of this delay is unknown. Ago2 and miR-122 may relocalize viral RNA within the cell, perhaps to the sites of virus replication, or protect RNA from degradation. Ago2 is capable of unwinding doublestranded small RNAs and thus may induce changes in the
2350
WILSON ET AL.
secondary structure of the HCV 5⬘ UTR that influence virus translation, replication, or stability. Ago2 has been called the RISC “slicer,” since it has the ability to cleave mRNA, but it is unknown whether Ago2’s slicer (RNase H) activity influences HCV replication. While it is likely that Ago2 and miR-122 associate within a RISC-like protein complex, it is possible that Ago2 and miR122 have independent functions in enhancing HCV translation and replication. One possibility is that Ago2 simply unwinds and then delivers miR-122 to the binding sites on the HCV genome but miR-122 functions alone to enhance HCV replication levels. Alternatively, Ago2 may function alone in the process of HCV RNA replication augmentation while miR-122 simply acts to target Ago2 to the HCV genome. The latter mechanism is analogous to the process of microRNA translational suppression, where Ago2 alone is sufficient to suppress mRNA translation if it is targeted and tethered to the mRNA by a protein rather than microRNA (28). If this is true, then Ago2 may also be able to augment HCV replication independently of miR-122. However, the mechanism of action of miR122 on HCV RNA accumulation appears to differ, at least in some respects, from that of microRNA translation suppression, since it does not require the protein RCK (9), a protein that is essential for microRNA suppression activity (3). Further studies concerning the mechanism of Ago2 and miR-122 enhancement of HCV translation and RNA accumulation may not only identify new drug targets for HCV therapy, but also provide insight into novel RISC activities. ACKNOWLEDGMENTS We thank Charles M. Rice and Tom Hobman for reagents and Patricia Thibault for critical reading of the manuscript. This study was funded by grants from the National Science and Engineering Research Council (G9631), the Saskatchewan Health Research Foundation (establishment, 10156, and team grant, RAPID and 1927), and the Canadian Foundation for Innovation (18622) to J.A.W. The study was also funded by grants from the Canadian Institutes of Health Research (EOP-38155 and MOP-10638) and CANVAC, Canadian National Centres of Excellence, to C.D.R. REFERENCES 1. Brown, T., and K. Mackey. 1997. Analysis of RNA by Northern and slot blot hybridization, p. 4.9.1–4.9.16. In F. M. Ausubel et al. (ed.), Current protocols in molecular biology, vol. 1. John Wiley & Sons, Inc., Hoboken, NJ. 2. Chisari, F. V. 2005. Unscrambling hepatitis C virus-host interactions. Nature 436:930–932. 3. Chu, C. Y., and T. M. Rana. 2006. Translation repression in human cells by microRNA-induced gene silencing requires RCK/p54. PLoS Biol. 4:e210. 4. Díaz-Toledano, R., A. Ariza-Mateos, A. Birk, B. Martinez-Garcia, and J. Gomez. 2009. In vitro characterization of a miR-122-sensitive double-helical switch element in the 5⬘ region of hepatitis C virus RNA. Nucleic Acids Res. 37:5498–5510. 5. Eulalio, A., I. Behm-Ansmant, D. Schweizer, and E. Izaurralde. 2007. P-body formation is a consequence, not the cause, of RNA-mediated gene silencing. Mol. Cell. Biol. 27:3970–3981. 6. Henke, J. I., et al. 2008. microRNA-122 stimulates translation of hepatitis C virus RNA. EMBO J. 27:3300–3310. 7. Humphreys, D. T., B. J. Westman, D. I. Martin, and T. Preiss. 2005. MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and poly(A) tail function. Proc. Natl. Acad. Sci. U. S. A. 102:16961–16966. 8. Jakymiw, A., et al. 2005. Disruption of GW bodies impairs mammalian RNA interference. Nat. Cell Biol. 7:1267–1274. 9. Jangra, R. K., M. Yi, and S. M. Lemon. 2010. DDX6 (Rck/p54) is required
J. VIROL.
10.
11.
12.
13.
14.
15. 16. 17.
18. 19.
20. 21.
22.
23. 24.
25.
26.
27. 28. 29. 30. 31.
32.
33.
34. 35. 36.
37. 38.
for efficient hepatitis C virus replication but not for internal ribosome entry site-directed translation. J. Virol. 84:6810–6824. Jangra, R. K., M. Yi, and S. M. Lemon. 2010. Regulation of hepatitis C virus translation and infectious virus production by the microRNA miR-122. J. Virol. 84:6615–6625. Ji, J., et al. 2008. Suppression of short interfering RNA-mediated gene silencing by the structural proteins of hepatitis C virus. J. Gen. Virol. 89: 2761–2766. Jones, C. T., C. L. Murray, D. K. Eastman, J. Tassello, and C. M. Rice. 2007. Hepatitis C virus p7 and NS2 proteins are essential for production of infectious virus. J. Virol. 81:8374–8383. Jopling, C. L., S. Schutz, and P. Sarnow. 2008. Position-dependent function for a tandem microRNA miR-122-binding site located in the hepatitis C virus RNA genome. Cell Host Microbe 4:77–85. Jopling, C. L., M. Yi, A. M. Lancaster, S. M. Lemon, and P. Sarnow. 2005. Modulation of hepatitis C virus RNA abundance by a liver-specific microRNA. Science 309:1577–1581. Kinch, L. N., and N. V. Grishin. 2009. The human Ago2 MC region does not contain an eIF4E-like mRNA cap binding motif. Biol. Direct. 4:2. Kiriakidou, M., et al. 2007. An mRNA m7G cap binding-like motif within human Ago2 represses translation. Cell 129:1141–1151. Lanford, R. E., E. S. Hildebrandt-Eriksen, A. Petri, R. Persson, M. Lindow, M. E. Munk, S. Kauppinen, and H. Orum. 2010. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science 327:198–201. Liu, J., et al. 2004. Argonaute2 is the catalytic engine of mammalian RNAi. Science 305:1437–1441. Liu, J., M. A. Valencia-Sanchez, G. J. Hannon, and R. Parker. 2005. MicroRNA-dependent localization of targeted mRNAs to mammalian Pbodies. Nat. Cell Biol. 7:719–723. Lohmann, V. 2009. HCV replicons: overview and basic protocols. Methods Mol. Biol. 510:145–163. Lohmann, V., F. Korner, A. Dobierzewska, and R. Bartenschlager. 2001. Mutations in hepatitis C virus RNAs conferring cell culture adaptation. J. Virol. 75:1437–1449. Lytle, J. R., T. A. Yario, and J. A. Steitz. 2007. Target mRNAs are repressed as efficiently by microRNA-binding sites in the 5⬘ UTR as in the 3⬘ UTR. Proc. Natl. Acad. Sci. U. S. A. 104:9667–9672. Ma, J. B., K. Ye, and D. J. Patel. 2004. Structural basis for overhang-specific small interfering RNA recognition by the PAZ domain. Nature 429:318–322. Murakami, Y., H. H. Aly, A. Tajima, I. Inoue, and K. Shimotohno. 2009. Regulation of the hepatitis C virus genome replication by miR-199a. J. Hepatol 50:453–460. Nakabayashi, H., K. Taketa, K. Miyano, T. Yamane, and J. Sato. 1982. Growth of human hepatoma cell lines with differentiated functions in chemically defined medium. Cancer Res. 42:3858–3863. Ørom, U. A., F. C. Nielsen, and A. H. Lund. 2008. MicroRNA-10a binds the 5⬘UTR of ribosomal protein mRNAs and enhances their translation. Mol. Cell 30:460–471. Pedersen, I. M., et al. 2007. Interferon modulation of cellular microRNAs as an antiviral mechanism. Nature 449:919–922. Pillai, R. S., et al. 2005. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 309:1573–1576. Rana, T. M. 2007. Illuminating the silence: understanding the structure and function of small RNAs. Nat. Rev. Mol. Cell Biol. 8:23–36. Randall, G., et al. 2007. Cellular cofactors affecting hepatitis C virus infection and replication. Proc. Natl. Acad. Sci. U. S. A. 104:12884–12889. Seggerson, K., L. Tang, and E. G. Moss. 2002. Two genetic circuits repress the Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev. Biol. 243:215–225. Sen, G. L., and H. M. Blau. 2005. Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat. Cell Biol. 7:633–636. Song, J. J., S. K. Smith, G. J. Hannon, and L. Joshua-Tor. 2004. Crystal structure of Argonaute and its implications for RISC slicer activity. Science 305:1434–1437. Tolia, N. H., and L. Joshua-Tor. 2007. Slicer and the argonautes. Nat. Chem. Biol. 3:36–43. Tomari, Y., et al. 2004. RISC assembly defects in the Drosophila RNAi mutant armitage. Cell 116:831–841. Villanueva, R. A., et al. 2010. miR-122 does not modulate the elongation phase of hepatitis C virus RNA synthesis in isolated replicase complexes. Antiviral Res. 88:119–123. Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet. 6:206–220. Wilson, J. A., et al. 2003. RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc. Natl. Acad. Sci. U. S. A. 100:2783–2788.
