JOURNAL OF VIROLOGY, July 2007, p. 6947–6956 0022-538X/07/$08.00⫹0 doi:10.1128/JVI.02798-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 81, No. 13
Human Immunodeficiency Virus Type 1 Protease Cleaves Procaspase 8 In Vivo䌤 Zilin Nie,1 Gary D. Bren,1 Stacey R. Vlahakis,1 Alicia Algeciras Schimnich,1 Jason M. Brenchley,3 Sergey A. Trushin,1 Sarah Warren,1 David J. Schnepple,1 Colin M. Kovacs,4 Mona R. Loutfy,4 Daniel C. Douek,3 and Andrew D. Badley1,2* Division of Infectious Diseases1 and Program in Translational Immunovirology and Biodefense,2 Mayo Clinic College of Medicine, Rochester, Minnesota 55905; VRC, NIAID, NIH, Human Immunology Section, Bethesda, Maryland 208923; and Department of Medicine, University of Toronto, Toronto, Ontario, Canada M5B 1L64 Received 19 December 2006/Accepted 11 April 2007
Human immunodeficiency virus type 1 (HIV-1) infection causes apoptosis of infected CD4 T cells as well as uninfected (bystander) CD4 and CD8 T cells. It remains unknown what signals cause infected cells to die. We demonstrate that HIV-1 protease specifically cleaves procaspase 8 to create a novel fragment termed casp8p41, which independently induces apoptosis. casp8p41 is specific to HIV-1 protease-induced death but not other caspase 8-dependent death stimuli. In HIV-1-infected patients, casp8p41 is detected only in CD4ⴙ T cells, predominantly in the CD27ⴙ memory subset, its presence increases with increasing viral load, and it colocalizes with both infected and apoptotic cells. These data indicate that casp8p41 independently induces apoptosis and is a specific product of HIV-1 protease which may contribute to death of HIV-1-infected cells. cleaves procaspase 8 and, in a cell-free system, this results in an apoptotic signaling cascade that involves Bid cleavage, mitochondrial loss of transmembrane potential (⌬␥M), cytochrome c release, caspase 9 and 3 activation, and nuclear fragmentation (28). The objectives of this study were to define the cleavage site where HIV-1 PR cleaves procaspase 8, to determine whether the cleaved fragment induces apoptosis, and to determine if this cleavage event occurs during HIV-1 infection in vivo.
Infection with human immunodeficiency virus type 1 (HIV-1) is known to cause the death of cells directly infected with the virus, as well as uninfected bystander cells. Each of the HIV-1 proteins, Tat, Nef, Env, protease (PR), and Vpr, is capable of initiating cell death (15), but the mechanism by which HIV-1 causes the death of infected cells in vivo is unknown. It has been widely believed that bystander mechanisms of cell death are the principal causes of CD4 T-cell depletion in patients with HIV-1 infection (14). However, recent studies suggest that death of T cells in lymphoid tissues is due to direct cytotoxicity, viral cytopathicity, or lytic infection, rather than bystander killing. Indeed, in both HIV-1-infected patients with acute disease and macaques acutely infected with simian immunodeficiency virus, there is a rapid and profound destruction of virus-containing activated memory CD4⫹ CCR5⫹ T cells in the gut that occurs within the first weeks of infection (6, 23–25). The molecular basis for this direct cytotoxicity remains unknown. The cytotoxic properties of HIV-1 PR were exploited early in the HIV-1 epidemic as a tool with which to screen for potential protease inhibitors. Ectopic expression of HIV-1 PR in a variety of both prokaryotic and eukaryotic cells causes the death of cells that express this protein (1, 3, 27, 33), but not the death of uninfected bystander cells (Z. Nie and A. Badley, unpublished observations). The molecular mechanisms by which PR-induced death occurs have been debated. The observations that HIV-1 PR may mediate cleavage of actin (1), laminin (34), Bcl-2 (35), and the eukaryotic initiation factor 4G of translation (38) have led to speculation that the cleavage of these proteins leads to either apoptotic or necrotic forms of cell death. More recently, we have shown that HIV-1 PR
MATERIALS AND METHODS Assessment of protease activity. To directly measure the protease activity in the cytoplasmic compartment of infected cells, 200 ⫻ 106 HIV-1-infected Jurkat cells were harvested at the time when the infected cells start to die (usually at day 3 or 4 postinfection). The harvested cells were washed twice to remove the cell surface-attached virus particles and then resuspended in swelling buffer (10 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 30 mM NaCl, 1 mM EGTA, 1 mM dithiothreitol [DTT], 100 mM phenylmethylsulfonyl fluoride, 10 g/ml leupeptin, 2 g/ml aprotinin). After 15 min on ice, the cells were disrupted with 30 strokes of a tight-fitting B-type glass Dounce homogenizer. The nuclei and subcellular organelles were removed by centrifugation at 10,000 rpm for 30 min (at 4°C). The supernatant from this spin was further centrifuged for 1 h at 100,000 ⫻ g using a Beckman SW Ti55 rotor with 2-ml Quick-Seal centrifuge tubes. The resulting supernatant was collected as the cytosolic fraction and the pellet, the membrane fraction, was suspended with 500 l of the swelling buffer supplemented with 0.1% Triton X-100. The same numbers of uninfected Jurkat cells underwent the same processes in parallel. The protease activities were measured with the same amount of proteins from both cytosolic fractions and membrane fractions using a fluorogenic substrate, as we have previously described (10). HIV-1 PR cleavage of procaspase 8 and peptide sequencing. Recombinant HIV-1 protease was purchased from Bachem Biosciences Inc. (King of Prussia, PA) with a specific activity of 1.81 ⫻ 104 mM/min/mg at 37°C, a purity of ⬎96% by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and a single peak by reverse-phase high-performance liquid chromatography (HPLC). HIV-1 PR assays were performed in buffer containing 50 mM NaOacetate (pH 4.9), 200 mM NaCl, 5 mM DTT, and 10% glycerol. Recombinant active caspase 8 was purchased from R&D Systems (Minneapolis, MN). After cleavage by HIV-1 PR, the products were separated by SDS-PAGE and stained by Silver Stain Plus (Bio-Rad, Hercules, CA). These silver-stained bands were digested with trypsin, and the extracted peptides were analyzed by tandem mass spectrometry in the Mayo Proteomics Research Center.
* Corresponding author. Mailing address: Mayo Clinic College of Medicine, 200 First Street SW, Rochester, MN 55905. Phone: (507) 284-3747. Fax: (507) 284-3757. E-mail:
[email protected]. 䌤 Published ahead of print on 18 April 2007. 6947
6948
NIE ET AL.
In this tandem mass spectrometry system, a Waters Micromass Q-tof API-US quadrupole time-of-flight mass spectrometer (MS) with the Z-spray electrospray ionization source, was coupled to a CapLC HPLC system, each controlled by MassLynx 4.0. The HPLC conditions consisted of running a gradient of increasing acetonitrile in 0.1% formic acid on a Vydac C4 column (300 m by 100 mm) at a flow rate of 4 l/min and eluting directly into the mass spectrometer. The MS experiment consisted of continuous 2-second scans of 400 to 2,000 m/z, and the spectra were deconvoluted using the MassLynx MaxEnt algorithm to give monoisotopic masses. Plasmid construction and site-directed mutagenesis. pcDNA3caspase8 was obtained from P. Krammer. To construct the pcDNAFlag-caspase8-Myc plasmid, a PCR was carried out on pcDNA3caspase8 with a pair of primers, Flag sense, 5⬘-CCCAAGCTTATGGACTACAAAGACGATGACGGTACC ATGGACTTCAGC-3⬘, and Myc antisense, 5⬘-CCGGGCCCTTACTACAG ATCCTCTTCTGAGATGAGTTTTTGTTCTCTAGATTGATCAGAAGGG AAAAG-3⬘. The Flag-caspase8-Myc fragment from the PCR was inserted back into HindIII and Xbal sites of the pcDNA3 vector. Plasmid pcDNA3Flagcaspase8-Myc harboring an Arg(R)355Asn(N)356(RN) substitution for Phe355(F)Phe(F)356(FF) was created by site-directed mutation using the QuikChange site-directed mutagenesis kit (Stratagene). To generate the plasmid pcDNAFlag-caspase8p41, the code TTT (Phe356) on caspase 8 cDNA was changed to a stop code TGA using the QuikChange site-directed mutagenesis kit (Stratagene). Plasmid pEGFPC1caspase8 was prepared by subcloning full-length caspase 8 cDNA from pGEX-4T-1 caspase 8 (28) into the BamHI site of pEGFPC1 (Clontech, Mountain View, CA). In vitro translation, radiolabeling, and SDS-PAGE autoradiography. The fusion protein Flag-procaspase 8-Myc was prepared by TNT quick-coupled in vitro transcription/translation (IVTT) systems (Promega, Madison, WI). Briefly, in the nuclease-free reaction mixture, 1 g of plasmid DNA, pcDNA3 Flagprocaspase 8-Myc, or pcDNA3Flag (as a control) was added into 50 l of the mixture containing 40 l of TNT Quick master mix and 1 l of 1 mM methionine. The reaction was carried out at 30°C for 90 min and stopped using 200 g/ml RNase at 30°C for 5 min. [35S]methionine-labeled fusion protein was prepared by adding 40 Ci [35S]methionine instead of 1 l of 1 mM methionine, separated on 10 to 15% SDS-PAGE, and visualized by autoradiography. IVTT products were cleaned using a G50 column (Amersham Biosciences, Piscataway, NJ) and reconstituted in caspase buffer (25 mM HEPES, pH 7.5, 0.15 M NaCl, 5 mM DTT, 10% sucrose). Western blot analysis. For Western blot analysis, 50 to 200 g of cytosolic proteins was fractionated on 10 or 15% polyacrylamide gels and then transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA) for 3 h at 100 V using transfer buffer (25 mM Tris, 192 mM glycine). The membranes were blocked by incubation in TBS buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween, pH 7.5) containing 2% bovine serum albumin overnight at 4°C or for 2 h at room temperature and washed five times with TBST buffer (TBS buffer plus 0.2% Tween 20). Then, the membranes were blotted for 1 h at room temperature with primary antibodies as follows: monoclonal anti-caspase 8 (Biosource International, Camarillo, CA), anti-caspase 9 (Medical & Biological Laboratories Co., Watertown, MA), and anti-cytochrome c and goat anti-Bid (Santa Cruz Biotechnology, Santa Cruz, CA). The blots were washed five times with TBST and developed with horseradish-linked secondary antibodies, sheep anti-mouse immunoglobulin G (IgG), donkey anti-rabbit Ig (Amersham Pharmacia, Oakville, ON, Canada), and anti-goat IgG (Santa Cruz Biotechnology, Santa Cruz, CA). All the blots were developed by using SuperSignal (Pierce, Rockford, IL), an enhanced chemiluminescence method, following the manufacturer’s protocol. Flow cytometry and confocal microscopy. Death in the cells transfected by pEGFPC1 (BD Biosciences Clontech, Palo Alto, CA) and pEGFPC1casp8p41 was measured by annexin V-phycoerythrin (PE) and terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) staining with gating specifically on green fluorescent protein (GFP)-positive cells. In the annexin V staining assay, 1 ⫻ 106 cells were harvested, washed, and stained with 2 l annexin V-PE (BD Pharmingen, San Diego, CA) at 37°C for 20 min. GFP and annexin V-PE double-positive cells were analyzed by flow cytometry at 30,000 events per sample. TUNEL staining for detection of apoptosis was done according to the manufacturer’s protocol (Roche, Nutley, NJ). To determine the expression of intracellular HIV-1 p24 and casp8p41, 106 peripheral blood lymphocytes (PBL) were permeabilized with phosphate-buffered saline (PBS) plus 0.1% NP-40 on ice for 2 min and the casp8p41 antibody, followed by a PE-labeled secondary antibody (Becton Dickinson Immunocytometry Systems, San Jose, CA), and then anti-p24–fluorescein isothiocyanate (FITC) was added. Flow cytometry was performed using a FACScan (Becton Dickinson Immunocytometry Systems, San Jose, CA), and analysis was done using CellQuest software. Laser scanning confocal microscopy was performed using a Zeiss LSM-510 (Carl
J. VIROL. Zeiss Inc., Thornwood, NY). Images were saved at 8 bits per channel and were analyzed for fluorescent interaction using the computer analysis package ANALYZE (Mayo Foundation, Rochester, MN). Flow cytometric cell sorting. Monoclonal antibodies used for phenotypic characterization of T-cell subsets were anti-CD19–Cascade blue, anti-CD14– Cascade blue, anti-CD27–PE, anti-p41–Alexa 647, anti-CD45RO–FITC (Coulter, Miami, FL), anti-CD3–Cy7-allophycocyanin, anti-CD8–QDot705, and anti-CD4– Cy5.5-PE (Caltag, South San Francisco, CA). Unconjugated antibodies against CD19, CD14, and CD8 were obtained from BD Pharmingen, and p41 antibody was produced, purified, and then conjugated with Alexa 647 (Invitrogen, Carlsbad, CA) using standard protocols (http://drmr.com/abcon). Qdot conjugations were performed as previously described (7). All sorts were performed on stained cells fixed with 1% paraformaldahyde (Electron Microscopy Sciences, Ft. Washington, PA) using a modified fluorescence-activated cell sorter (Aria; BD Pharmingen, San Diego, CA). Instrument setup was performed according to the manufacturer’s instructions. All sorts were performed at 25 lb/in2. Instrument compensation was performed using antibody capture beads (BD Pharmingen, San Diego, CA) stained singly with individual antibodies used in the test samples. Quantitation of viral DNA. HIV-1 DNA was quantified by quantitative PCR with an ABI7700 apparatus (Perkin-Elmer, Norwalk, CT) as previously described (13). To quantify cell number in each reaction, quantitative PCR was performed simultaneously for albumin gene copy number as previously described (13). Standards were constructed for absolute quantification of Gag and albumin copy number and were validated with sequential dilutions of 8E5 and Ach2 cell lysates that contained 1 copy of Gag per cell. Duplicate reactions were run and template copies calculated using ABI7700 software. Development of neoepitope-specific antibody against casp8p41. A peptide corresponding to the C-terminal end of the caspase 8-p41 protein (CPSLAGK PKVF) was synthesized in the Protein Core Facility at Mayo and linked via the N-terminal cysteine to keyhole limpet hemocyanin, and the anti-casp8p41 monoclonal antibody was produced using the method of Fazekas de St. Groths and Scheidegger, as described previously (11). Initial screening was done by enzymelinked immunosorbent assay using the full-length antigen peptide. Subsequent screening and selection of hybridomas were completed using a peptide consisting of a seven-alanine leader and the four most-C-terminal amino acids of the antigen peptide (AAAAAAAPKVF). The selected clones were then screened by immunofluorescence and protein Western blotting to ensure specificity for the p41 fragment of caspase 8. Apoptosis induction. Jurkat T cells (106) were treated with 10 M campothecin (CPT), 100 ng/ml SuperKillerTRAIL (Axxora, San Diego, CA), 250 ng/ml anti-Fas antibody CH-11 (Upstate Cell Signaling Solutions, Charlottesville, VA), 50 ng/ml tumor necrosis factor alpha (R&D Systems, Minneapolis, MN) plus 5 g/ml cycloheximide, 2 M HIV-1 Tat (NIH AIDS Research and Reference Reagent Program), 1 g/ml of HIV-1 gp120 (ImmunoDiagnostics, Woburn, MA), or vehicle controls for 8 h at 37°C. For Vpr-induced apoptosis, Jurkat T cells were incubated with isotonic glucose-HEPES buffer (2.4% glucose, 13 mM HEPES, 68 mM NaCl, 1.3 mM KCl, 4 mM Na2HPO4, and 0.7 mM KH2PO4, pH 7.2) alone or containing 10 M Vpr-derived peptide (amino acids 61 to 75; NIH AIDS Research and Reference Reagent Program) for 4 h at 37°C. After the incubation, cells were washed in PBS and incubated overnight at 37°C. After incubation for the indicated times, cells were fixed in 2% paraformaldehyde at 4°C overnight. To determine the presence of casp8p41 in apoptotic cells, cells were permeabilized with PBS plus 0.1% NP-40 on ice for 2 min. Cells were then incubated with the mouse anti-casp8p41 antibody followed by PElabeled goat anti-mouse antibody (Becton Dickinson Immunocytochemistry, San Jose, CA) and FITC-labeled rabbit anti-active caspase 3 antibody. Patient samples. Patient samples were collected following informed consent and PBL harvested by using Ficoll hypaque. This protocol was reviewed and approved by the Mayo Clinic Institutional Review Board, protocol 1039-03, reviewed and approved in 2003. Cell lines and transfections. HeLa and Jurkat cells were purchased from ATCC. Cells were maintained in Dulbecco modified Eagle medium or RPMI 1640 (GIBCO, Grand Island, NY) supplemented with 10% (vol/vol) fetal bovine serum and 1% antibiotics penicillin, streptomycin, and 2 mM L-glutamine and incubated at 37°C in a humidified atmosphere containing 5% CO2 and 95% air. To transfect HeLa cells, exponentially growing cells were seeded at 2,500 to 5,000 cells/well (96-well plate). DNA plasmids were prepared with a CsCl gradient and delivered into cells with Fugene 6 at a ratio of 1 g DNA/3 l Fugene 6 following the manufacturer’s protocol. Jurkat T cells were transfected with 1 g of pEYFPprotease per 107 cells using a square wave electroporator (BTX, San Diego, CA) at 320 V for 10 ms. Immediately following transfection, 7 M nelfinavir or 20 M Z-VAD-fmk was added, and the following morning casp8p41 was assessed by flow cytometry. PBL from HIV-1-negative donors were isolated and transfected
VOL. 81, 2007
casp8p41 IN HIV-1-INFECTED CELLS
with 2 g/10 ⫻ 106 cells with pcDNA3HA GSK3 (obtained from D. Billadeau [29]) or pcDNA3HA casp8p41 using nucleofectin (AMAXA, Gaithersburg, MD) and using program U14. Cell viability assay. Cell viability was assessed using a cell titer glow luminescent assay (Promega, Madison, WI), which determines cell viability based upon quantitation of ATP as a marker of metabolically active cells, according to the manufacturer’s instructions. Cell-free system. Jurkat cell extracts were prepared as previously described (28). Briefly, cells (0.5 ⫻ 106 cells/ml) were harvested by centrifugation at 1,600 rpm for 5 min at 4°C. The cell pellet was washed twice with ice-cold PBS (pH 7.4), followed by a single wash with ice-cold caspase buffer {20 mM piperazineN,N⬘-bis(2-ethanesulfonic acid), 100 mM NaCl, 10 mM DTT, 1 mM EDTA, 0.1% 3[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate, 250 mM sucrose, pH 7.2}. After centrifugation, the cells were resuspended with two volumes of ice-cold complete caspase buffer, which was supplemented with protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 10 g/ml leupeptin, 2 g/ml aprotinin), and then transferred to a 2-ml Dounce homogenizer. After sitting on ice for 15 min, the cells were disrupted with 50 strokes of a B-type pestle (Fisher Scientific Ltd., Nepean, ON, Canada). Cell disruption (⬎95%) was confirmed by examination of a 5-l aliquot of suspension under a light microscope after staining with trypan blue. The nuclei were removed by centrifugation at 1,000 ⫻ g for 10 min at 4°C. Protein concentrations were determined with a bicinchoninic acid protein assay kit (Pierce Chemical Co., Rockford, IL), and the resultant suspension was incubated with either HIV PR or casp8p41 as indicated. Cytosols from Jurkat cells were treated overnight with 10 M CPT as a positive control.
RESULTS HIV-1 PR is active within infected cells. Observations that transfection or microinjection (18) of protease causes loss of cell viability have led to the suggestion that HIV-1 PR might initiate death of infected cells. Protease maturation occurs by autoproteolytic processing after Gag-Pol precursor dimerization, which may occur at the membrane during new viral particle release (20) and possibly within the cytoplasm, where generation of active protease causes viral cytotoxicity (21, 22). We assessed whether protease was active within the cytosolic compartment, as well as the membrane fraction, during HIV-1 infection. Following HIV-1 infection of Jurkat T cells, cytosolic and membrane fractions were separated and purity confirmed by immunoblotting for the membrane-specific marker linker for activation of T cells (LAT) (37). Each fraction was assessed for protease activity using a fluorogenic Gag-Pol substrate. As expected, the membrane fraction of HIV-1-infected cells contained more protease activity than the membrane fraction of uninfected cells (P ⫽ 0.0047) (Fig. 1A). In addition, the cytosolic fraction of HIV-1-infected cells contained significant protease activity (P ⫽ 0.0378 compared to uninfected cells), indicating that HIV-1 PR is active within the cytoplasm of infected T cells, consistent with prior observations (21, 22). More recent studies have demonstrated that HIV-1 assembly and budding occur at both the plasma membrane and endosomal membrane within infected cells (16, 19, 30), further supporting the presence of protease activity within the cytosolic compartment. This intracellular protease activity allows for the possibility that protease cleavage of cytosolic host cell proteins might contribute to viral cytopathicity. HIV-1 PR cleaves procaspase 8 between amino acids 355 and 356. We have previously shown that HIV-1 PR cleaves procaspase 8 in a cell-free system and can initiate an apoptosis signaling cascade that requires procaspase 8 (28). We therefore sought to identify the site at which protease cleaves procaspase 8. We constructed a procaspase 8 construct with an
6949
amino-terminal Flag epitope and a carboxyl-terminal Myc epitope (Fig. 1B). The 35S-labeled Flag-caspase 8-Myc fusion protein generated by IVTT was cleaved in vitro with HIV-1 PR (Fig. 1C), resulting in a predominant band of approximately 41 kDa containing a Flag epitope, suggesting that the cleavage site lies within the carboxyl-terminal half of the p18 subunit of procaspase 8. By contrast, another aspartyl protease, renin, did not cause procaspase 8 cleavage (Fig. 1C, right panel). Highly purified procaspase 8 p18 subunit was sequenced by tryptic digestion and mass spectroscopy, resulting in three trypsin digest-specific peptides, RGYCLIINNHNFAK (N terminal), KGIIYGTDGQEAPIYELTSQFTGLK, and KVFFIQA CQGDNYQK (C terminal), in wild-type p18. When p18 was first digested with HIV-1 PR, the tryptic peptide KVFFIQAC QGDNYQK (C terminal) was lost, suggesting that the cleavage site for protease resides within that C-terminal tryptic fragment. To define the precise cleavage site for PR, the molecular weight of the cleaved p18 fragment was measured by LC-MS, demonstrating a weight of 16,158 mass units (cleaved form), indicating a cleavage event between Phe355 and Phe356. To confirm this result, amino acids 355 and 356 were mutated in full-length procaspase 8 in order to reduce the likelihood of HIV-1 PR cleavage at that site. Mutations were chosen based upon the Markov chain model of HIV-1 PR substrate cleavage (8, 9), which predicts whether a specific octapeptide can be cleaved by HIV-1 PR. Whereas the wild-type octapeptide surrounding amino acids 355 and 356 is predicted to be cleaved with high efficiency, the F355R, F356N mutation is predicted to be cleaved by HIV-1 PR much less efficiently. [35S]methionine-labeled wild-type procaspase 8 and the less cleavable HIV PR mutant procaspase 8 F355R, F356N were reacted with HIV-1 PR and analyzed by autoradiography for cleavage. The wild-type or the FF(RN) mutant procaspase 8 contained minimal amounts of contaminating protein (presumably degradation products) between 41 kDa and 56 kDa, with a predominant 56-kDa procaspase 8 band. Whereas incubation of wild-type procaspase 8 with HIV-1 PR resulted in a p41 procaspase 8 fragment, incubation of procaspase 8 F355R, F356N with HIV-PR resulted in negligible cleavage (Fig. 1D). casp8p41 causes apoptosis. Because HIV-1 PR-mediated killing requires procaspase 8, it follows that the p41 cleavage fragment of procaspase 8 produced by HIV-1 PR should possess similar cytotoxic properties as HIV-1 PR itself. We therefore compared the abilities of HIV-1 PR and the procaspase 8 cleavage fragment p41 (hereafter referred to as casp8p41) to initiate an apoptotic signaling cascade in the cell-free system. The addition of either casp8p41 or HIV-1 PR to cytosols obtained from healthy Jurkat T cells resulted in identical Bid cleavage to p15 tBid. Cytochrome c was also released from the mitochondrial fraction into the cytosol, leading to the cleavage of caspase 9 (Fig. 2A). These findings suggest that casp8p41 initiates apoptosis in a manner similar to PR. In a cellular expression model, transient expression of HIV-1 protease or GFPcasp8p41 in HeLa cells caused loss of mitochondrial transmembrane potential (data not shown) and TUNEL-positive apoptosis of GFP-positive cells but did not cause apoptosis of GFP-negative bystander cells (Fig. 2B). Primary CD4 T cells were transfected with GFPcasp8p41, and the cellular effects were assessed by flow cytometry, gating only on the
6950
NIE ET AL.
J. VIROL.
FIG. 1. HIV-1 protease is present in the cytosol of infected cells and cleaves procaspase 8 into a novel p41 fragment. (A) HIV-1-infected Jurkat cells and uninfected Jurkat cells were fractionated into cytosolic and membrane fractions and assessed for purity by immunoblotting for the membrane-specific protein LAT (insert), and equal amounts of cytosol or membrane fractions were assessed for protease activity using a fluorogenic Gag-Pol substrate. (B) Determination of HIV-1 PR cleavage site in procaspase 8. Procaspase 8 with an amino-terminal Flag epitope and a carboxyl-terminal Myc epitope was constructed. The F355, F356 site is indicated by an arrow. (C) Recombinant 35S-labeled Flag-procaspase 8-Myc was reacted with HIV-1 PR or renin and analyzed by autoradiography (right panel). PR-digested Flag-procaspase 8-Myc was immunoblotted with Flag (left panel, middle) or Myc (left panel, bottom). The 41-kDa peptide produced by protease digestion that contains the Flag epitope was sequenced. (D) Wild-type procaspase 8 or procaspase 8 with mutations F355R, F356N [FF(RN)] was reacted with various amounts of protease and analyzed by autoradiography. Wild-type procaspase 8 incubated with HIV-1 PR resulted in a 41-kDa band that was much less evident in the RN mutant. Results are representative of three independent experiments.
GFP-positive cells. casp8p41 expression in primary CD4 T cells causes apoptosis as measured by TUNEL positivity (Fig. 2C), active caspase 3 expression (Fig. 2D), and annexin positivity in a time-dependent manner (Fig. 2E).
HIV-1 PR generates casp8p41 in cells. During death receptor-initiated apoptosis, procaspase 8 is cleaved through induced proximity autoactivation (4), generating a p43 fragment of procaspase 8 from cleavage after amino acid Asp374 (36),
VOL. 81, 2007
casp8p41 IN HIV-1-INFECTED CELLS
6951
which is distinct from the cleavage event that generates casp8p41. We reasoned therefore that HIV-1 PR cleavage of procaspase 8 would expose the unique epitope at F355 that would not be exposed in the full-length procaspase 8 nor in caspase 8 processing intermediates formed during death receptor-initiated death. Consequently, the unique carboxyl terminus might allow us to detect casp8p41 but not other caspase 8 cleavage products. A monoclonal antibody was produced by immunizing mice with the 11 amino acids at the carboxylterminal end of casp8p41 and selecting a clone that specifically recognized the four amino acids at the carboxyl terminus. Since death receptor-induced processing of caspase 8 does not induce cleavage at residues F355 F356, the anti-casp8p41 antibody should not recognize full-length caspase 8 nor other caspase 8 processing intermediates. We showed this to be the case, since the anti-casp8p41 antibody selectively recognizes casp8p41 by immunoblotting (Fig. 3A) and by immunohistochemistry (Fig. 3B) but recognizes neither casp8p43 nor fulllength procaspase 8. Moreover, casp8p41 is detectable in HIV-1 PR-transfected cells, and inhibiting protease activity abrogates casp8p41 production (Fig. 3C), yet pan-caspase inhibition does not alter casp8p41 production, indicating that HIV-1 PR, but not caspase activity, is required for casp8p41 production. Since apoptosis occurring as a consequence of HIV-1 infection may be due to tumor necrosis factor alpha, TRAIL, Fas ligation, gp120, Tat, and/or Vpr, we assessed casp8p41 presence following treatment with these stimuli. Treated Jurkat cells contained active caspase 3, indicating apoptosis, but in these cells casp8p41 was not detected (Fig. 3D). Likewise, casp8p41 was not produced in the apoptotic cells induced by CPT. Conversely, HIV-1-infected cells analyzed for casp8p41 and active caspase 3 at 3 days after infection were 25% apoptotic (active caspase 3⫹), and casp8p41 was detected in a similar percentage of cells (and predominately in a colocalized fashion; see below). Consequently, we conclude that casp8p41 is a selective marker of HIV-1 PR-induced apoptosis that is not generated by other stimuli in which caspase 8 processing occurs. casp8p41 is produced in HIV-1-infected cells and colocalizes with dying cells. During an HIV-1 infection time course, casp8p41 expression was detected only in HIV-1-infected, but not mock-infected, cultures and, within the infected cells, casp8p41 expression increased with time postinfection and only in those cells which coexpressed p24 (Fig. 4A). Moreover, inhibiting protease activity with nelfinavir abrogated casp8p41 production (data not shown). In these infections, casp8p41 immunoreactivity varied directly with both the proportion of cells expressing p24 (Fig. 4A) and with cell death (Fig. 4B).
FIG. 2. Casp8p41 induces apoptosis. (A) Cytosolic extracts from Jurkat T cells were reacted with recombinant HIV-1 PR, glutathione S-transferase (GST) alone, or recombinant GST-casp8p41, or with cytosolic extracts from CPT-treated cells, and analyzed for events of apoptosis; both HIV-1 PR and casp8p41 induce Bid cleavage into p15 tBid, cytochrome c release into the cytosol, and procaspase 9 cleavage. The cytosolic and mitochondrial extracts were blotted for the mitochondria-specific protein HSP70 to confirm purity. (B) HeLa cells were trans-
fected with GFP alone, GFP-HIV protease, or GFPcasp8p41 and stained with 4⬘,6⬘-diamidino-2-phenylindole (DAPI) to identify cell nuclei and TUNEL to identify apoptosis. As controls, campothecin-treated cells and DNase I-treated cells were included. (C) Primary human CD4 T cells were transfected with GFP alone or GFPcasp8p41 and analyzed by flow cytometry, gating only on the GFP-positive cells, and analyzed by TUNEL and for active caspase 3 (D)or annexin V-PE staining (E). Results are representative of three independent experiments.
6952
NIE ET AL.
J. VIROL.
FIG. 3. casp8p41 antibody specifically recognizes casp8p41 but not other caspase 8 fragments. (A) 293T cells were transfected with GFP, GFP full-length (FL) caspase 8, GFPcasp8p43, or GFPcasp8p41 and immunoblotted with anti-casp8p41 antibodies or anti-GFP. Only cells transfected with GFPcasp8p41 contained protein that was recognized by the casp8p41 antibody, whereas the GFP antibody identified transfected protein in all cells. (B) HeLa cells were transfected with either GFPcasp8p41, GFP FL caspase 8, or GFPcasp8p43 and analyzed by immunofluorescence with either casp8p41 monoclonal antibody or isotype control antibody with secondary anti-mouse PE. Only those cells transfected with casp8p41 and stained with the casp8p41 antibody were PE positive. (C) Jurkat T cells were transfected with HIV-1 PR alone (0), in the presence of the HIV-1 PR inhibitor nelfinavir (Nfv), or in the presence of the pancaspase inhibitor Z-VAD fmk (z-VAD) and analyzed for casp8p41 production. (D) Jurkat T cells were treated with the indicated stimuli and analyzed by flow cytometry for casp8p41 and active caspase 3. The percentages of active caspase 3⫹ cells and casp8p41-positive cells were determined.
casp8p41 expression localizes to CD4 T cells and correlates with HIV-1 replication in vivo. To determine how casp8p41 expression is localized within individual T-cell subsets in vivo, we analyzed peripheral blood mononuclear cells from HIV-1infected and uninfected individuals by staining with monoclonal antibodies against CD3, CD4, CD8, CD45RO, CD27, casp8p41, CD14, and CD16. casp8p41 was not detected in cells from HIV-1-negative patients, nor was it detected in CD8 cells, CD14 cells, or CD16 cells from HIV-1-infected patients (data not shown). Both memory and naı¨ve CD4 T cells were found to be casp8p41 positive; however, the majority belonged to the CD27⫹ memory CD4⫹ T-cell subset (Fig. 5A; Table 1), consistent with previous studies demonstrating that CD27⫹ memory CD4⫹ T cells represent the most frequently infected T-cell subset in vivo (5). We next assessed the expression of casp8p41 in bulk PBL
from patients infected with HIV-1. In patients with suppressed levels of viral replication, less than 2% of PBL contained casp8p41. In patients with greater levels of viral replication, greater levels of casp8p41 were detected (Fig. 5B) that colocalized with p24 (Fig. 5C) and active caspase 3 (Fig. 5D). Importantly, almost half of the cells which contained active caspase 3 did not contain casp8p41, suggesting that other signals, such as bystander effects of HIV-1 proteins, including Tat, Nef, Env, etc., induce apoptosis in these casp8p41-negative cells. DISCUSSION It is well established that numerous HIV-1-encoded proteins are capable of causing cell death, but it has previously been impossible to determine which protein(s) is responsible for
VOL. 81, 2007
casp8p41 IN HIV-1-INFECTED CELLS
6953
FIG. 4. HIV-1 infection results in casp8p41. Jurkat T cells acutely infected with HIV-1 IIIB were analyzed at the indicated days by flow cytometry for intracellular p24 and casp8p41 or an isotype control. (A) Only p24-positive cells contained casp8p41, and the proportion of casp8p41⫹ cells increased as a function of time. (B) Jurkat T cells were infected with HIV-1 as above and analyzed for casp8p41 positivity, as well as cell death as assessed by trypan positivity. Results are representative of three independent experiments.
T-cell death in vivo. Our data indicate that HIV-1 PR generates a novel peptide, casp8p41, which independently initiates apoptotic cell death in both a cell-free system and after its transfection, in primary T cells. casp8p41 is not produced by caspase 8-dependent death stimuli other than HIV-1 protease. Moreover, after in vitro HIV-1 infection, casp8p41⫹ cells are overwhelmingly apoptotic, whereas casp8p41-negative cells are not. Production of casp8p41 by HIV-1 infection or by protease expression is inhibited by a protease inhibitor, but not a caspase inhibitor, demonstrating the requirement for protease activity to generate casp8p41. In cells from HIV-1 patients, casp8p41 is present only in CD4 T cells, predominantly the
memory subset, and correlates with viral replication. Therefore, HIV-1 protease generation of casp8p41 is a novel mechanism whereby HIV-1 infection can cause death of HIV-1infected cells. The relative contribution of this mode of HIV-1 killing to others remains to be determined. Our data also provide insights into the potential reasons why not all T cells infected with HIV-1 die. In the case of virologic latency, absence of protease activity would be associated with absence of casp8p41 production and, consequently, an apoptotic stimulus responsible for infected cell death would not be present. A unique feature of HIV-1 protease-mediated killing is that exogenous protease added to cells does not result in
TABLE 1. Frequency of casp8p41 in CD4⫹ T-cell subsets and CD8⫹ T cells Subject no.
CD4 T-cell count
1 2 3 4 5 6 7 8
552 145 205 752 HIV-1 negative HIV-1 negative HIV-1 negative HIV-1 negative
a
ND, not detected.
HIV-1 plasma viral load
% Memory CD4 that are casp8p41⫹
% Naive CD4 that are casp8p41⫹
% CD8 that are casp8p41⫹
22,000 35,000 54,000 18,000
0.06 0.09 0.1 0.07 ND ND ND ND
0.01 0.03 0.04 0.02 ND ND ND ND
NDa ND ND ND ND ND ND ND
6954
NIE ET AL.
J. VIROL.
FIG. 5. casp8p41 is present in infected and apoptotic cells from HIV-1 patients and colocalizes with the memory subset. (A) Peripheral blood mononuclear cells from an HIV-1⫹ individual were surface stained with monoclonal antibodies against CD3, CD4, CD8, CD27, and CD45RO and then fixed and permeabilized, followed by intracellular staining for casp8p41. The casp8p41-positive CD4 T cells (red) were assessed for CD27 and CD45RO expression and compared to casp8p41-negative CD4 T cells. (B) Peripheral blood lymphocytes from HIV-1-infected patients, with a range of viral replication, were analyzed by flow cytometry for casp8p41. (C) PBL from HIV-1-infected patients or uninfected donors were analyzed for p24 and casp8p41. In the representative results shown, neither p24 nor casp8p41 was observed in uninfected donors. In patients with suppressed levels of viral replication, low levels of p24 and casp8p41 were seen. However, in patients with a high viral burden, high levels of p24 positivity and casp8p41 positivity were observed that in most cases were colocalized. (D) Cells from a patient with a viral load of ⬎50,000 were costained for active caspase 3 and for casp8p41.
their death (data not shown), whereas exogenous Tat, Nef, Vpr, and gp120 added to cells do. Therefore, absence of viral replication on a single-cell basis (such as would occur in a latently infected cell) is sufficient reason for why latently infected cells do not die if HIV-1 protease is responsible for
infected cell death. Conversely, the same argument does not hold true if viral proteins Tat, Nef, Vpr, or Env are responsible, since these proteins would be produced by neighboring productively infected cells present in the microenvironment of latently infected cells.
VOL. 81, 2007
casp8p41 IN HIV-1-INFECTED CELLS
Putative causes of T-cell depletion during HIV-1 infection include reduced thymic output (12) and enhanced immune activation causing T cells to die through physiologic activationinduced cell death (17), resulting in reduced numbers of both infected and uninfected cells. Additionally, necrotic forms of cell death have been implicated in the T-cell depletion seen in HIV-1 (32). Moreover, enhanced production of death-inducing ligands (e.g., Fas ligand [2] and/or TRAIL [26]) by HIV1-infected cells results in paracrine death of uninfected cells. Each of the HIV-1 proteins Tat, Nef, gp120, gp160, and Vpr are also capable of causing the death of T cells following their overexpression or addition to culture medium (reviewed in reference 26). More recently, the combination of Vpr and Vif has been implicated in infected CD4 T-cell death based on experiments with viral isolates engineered to reduce expression of selected proteins (31). Since these proteins have been identified in the serum of HIV-1-infected patients, it has been argued that they may contribute to the death of both infected and uninfected T cells in untreated HIV-1-infected patients. HIV-1 protease can also kill T cells following its overexpression, yet unlike other cytotoxic HIV-1 proteins, exogenous protease does not kill uninfected cells; consequently, HIV-1 protease has only been proposed to kill infected cells but not uninfected cells (35). Generation of a selective and non-cross-reactive antibody, which recognizes the C-terminal end of casp8p41, has allowed us to detect a molecular signature of cells where HIV-1 protease has cleaved procaspase 8. Consequently, it is now possible to determine whether HIV-1 protease cleavage of procaspase 8 occurs in patients and, if so, whether these cells are infected and whether they become apoptotic. Our results indicate that casp8p41 is generated in HIV-1-infected patients, but not uninfected patients, that it is present preferentially in central memory HIV-1-infected CD4 T cells in vivo, and that casp8p41-positive cells are overwhelmingly apoptotic. Consequently, we propose that casp8p41 is a novel apoptosis-initiating peptide that is specifically produced in HIV-1infected cells by protease, which alone can cause the death of some infected cells.
5.
6.
7.
8. 9. 10. 11. 12.
13.
14.
15. 16. 17.
18.
19. 20.
ACKNOWLEDGMENTS Andrew Badley is supported by grants from the National Institutes of Health (R01 AI62261 and R01 AI40384) and the Burroughs Wellcome Fund’s Clinical Scientist Award in Translational Research (ID no. 1005160). We gratefully acknowledge the administrative expertise of Teresa Hoff, the technical assistance of Robert Brown, the assistance with coordination and shipment of patient blood samples from Roberta Halpenny and Len Noay, the assistance of Thomas Beito and the Mayo Monoclonal Core Facility, and Benjamin Madden and the Mayo Proteomics Research Center.
21. 22. 23.
24.
REFERENCES 1. Adams, L. D., A. G. Tomasselli, P. Robbins, B. Moss, and R. L. Heinrikson. 1992. HIV-1 protease cleaves actin during acute infection of human Tlymphocytes. AIDS Res. Hum. Retrovir. 8:291–295. 2. Badley, A. D., J. A. McElhinny, P. J. Leibson, D. H. Lynch, M. R. Alderson, and C. V. Paya. 1996. Upregulation of Fas ligand expression by human immunodeficiency virus in human macrophages mediates apoptosis of uninfected T lymphocytes. J. Virol. 70:199–206. 3. Blanco, R., L. Carrasco, and I. Ventoso. 2003. Cell killing by HIV-1 protease. J. Biol. Chem. 278:1086–1093. 4. Boatright, K. M., M. Renatus, F. L. Scott, S. Sperandio, H. Shin, I. M. Pedersen, J. E. Ricci, W. A. Edris, D. P. Sutherlin, D. R. Green, and G. S.
25.
26.
27.
6955
Salvesen. 2003. A unified model for apical caspase activation. Mol. Cell 11:529–541. Brenchley, J. M., B. J. Hill, D. R. Ambrozak, D. A. Price, F. J. Guenaga, J. P. Casazza, J. Kuruppu, J. Yazdani, S. A. Migueles, M. Connors, M. Roederer, D. C. Douek, and R. A. Koup. 2004. T-cell subsets that harbor human immunodeficiency virus (HIV) in vivo: implications for HIV pathogenesis. J. Virol. 78:1160–1168. Brenchley, J. M., T. W. Schacker, L. E. Ruff, D. A. Price, J. H. Taylor, G. J. Beilman, P. L. Nguyen, A. Khoruts, M. Larson, A. T. Haase, and D. C. Douek. 2004. CD4⫹ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J. Exp. Med. 200:749–759. Chattopadhyay, P. K., D. A. Price, T. F. Harper, M. R. Betts, J. Yu, E. Gostick, S. P. Perfetto, P. Goepfert, R. A. Koup, S. C. De Rosa, M. P. Bruchez, and M. Roederer. 2006. Quantum dot semiconductor nanocrystals for immunophenotyping by polychromatic flow cytometry. Nat. Med. 12: 972–977. Chou, K. C. 1996. Prediction of human immunodeficiency virus protease cleavage sites in proteins. Anal. Biochem. 233:1–14. Chou, K. C., and C. T. Zhang. 1993. Studies on the specificity of HIV protease: an application of Markov chain theory. J. Protein Chem. 12:709– 724. Cuerrier, D., Z. Nie, A. D. Badley, and P. L. Davies. 2005. Ritonavir does not inhibit calpain in vitro. Biochem. Biophys. Res. Commun. 327:208–211. de StGroth, S. F., and D. Scheidegger. 1980. Production of monoclonal antibodies: strategy and tactics. J. Immunol. Methods 35:1–21. Douek, D. C., M. R. Betts, B. J. Hill, S. J. Little, R. Lempicki, J. A. Metcalf, J. Casazza, C. Yoder, J. W. Adelsberger, R. A. Stevens, M. W. Baseler, P. Keiser, D. D. Richman, R. T. Davey, and R. A. Koup. 2001. Evidence for increased T cell turnover and decreased thymic output in HIV infection. J. Immunol. 167:6663–6668. Douek, D. C., J. M. Brenchley, M. R. Betts, D. R. Ambrozak, B. J. Hill, Y. Okamoto, J. P. Casazza, J. Kuruppu, K. Kunstman, S. Wolinsky, Z. Grossman, M. Dybul, A. Oxenius, D. A. Price, M. Connors, and R. A. Koup. 2002. HIV preferentially infects HIV-specific CD4⫹ T cells. Nature 417:95–98. Finkel, T. H., G. Tudor-Williams, N. K. Banda, M. F. Cotton, T. Curiel, C. Monks, T. W. Baba, R. M. Ruprecht, and A. Kupfer. 1995. Apoptosis occurs predominantly in bystander cells and not in productively infected cells of HIV- and SIV-infected lymph nodes. Nat. Med. 1:129–134. Gougeon, M. L. 2003. Apoptosis as an HIV strategy to escape immune attack. Nat. Rev. Immunol. 3:392–404. Grigorov, B., F. Arcanger, P. Roingeard, J. L. Darlix, and D. Muriaux. 2006. Assembly of infectious HIV-1 in human epithelial and T-lymphoblastic cell lines. J. Mol. Biol. 359:848–862. Groux, H., G. Torpier, D. Monte, Y. Mouton, A. Capron, and J. C. Ameisen. 1992. Activation-induced death by apoptosis in CD4⫹ T cells from human immunodeficiency virus-infected asymptomatic individuals. J. Exp. Med. 175:331–340. Honer, B., R. L. Shoeman, and P. Traub. 1991. Human immunodeficiency virus type 1 protease microinjected into cultured human skin fibroblasts cleaves vimentin and affects cytoskeletal and nuclear architecture. J. Cell Sci. 100:799–807. Jouvenet, N., S. J. Neil, C. Bess, M. C. Johnson, C. A. Virgen, S. M. Simon, and P. D. Bieniasz. 2006. Plasma membrane is the site of productive HIV-1 particle assembly. PLoS Biol. 4:e435. Kaplan, A. H., M. Manchester, and R. Swanstrom. 1994. The activity of the protease of human immunodeficiency virus type 1 is initiated at the membrane of infected cells before the release of viral proteins and is required for release to occur with maximum efficiency. J. Virol. 68:6782–6786. Kaplan, A. H., and R. Swanstrom. 1991. The HIV-1 gag precursor is processed via two pathways: implications for cytotoxicity. Biomed. Biochim. Acta 50:647–653. Kaplan, A. H., and R. Swanstrom. 1991. Human immunodeficiency virus type 1 Gag proteins are processed in two cellular compartments. Proc. Natl. Acad. Sci. USA 88:4528–4532. Li, Q., L. Duan, J. D. Estes, Z. M. Ma, T. Rourke, Y. Wang, C. Reilly, J. Carlis, C. J. Miller, and A. T. Haase. 2005. Peak SIV replication in resting memory CD4⫹ T cells depletes gut lamina propria CD4⫹ T cells. Nature 434:1148–1152. Mattapallil, J. J., D. C. Douek, B. Hill, Y. Nishimura, M. Martin, and M. Roederer. 2005. Massive infection and loss of memory CD4⫹ T cells in multiple tissues during acute SIV infection. Nature 434:1093–1097. Mehandru, S., M. A. Poles, K. Tenner-Racz, A. Horowitz, A. Hurley, C. Hogan, D. Boden, P. Racz, and M. Markowitz. 2004. Primary HIV-1 infection is associated with preferential depletion of CD4⫹ T lymphocytes from effector sites in the gastrointestinal tract. J. Exp. Med. 200:761–770. Miura, Y., N. Misawa, N. Maeda, Y. Inagaki, Y. Tanaka, M. Ito, N. Kayagaki, N. Yamamoto, H. Yagita, H. Mizusawa, and Y. Koyanagi. 2001. Critical contribution of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) to apoptosis of human CD4⫹ T cells in HIV-1-infected hu-PBLNOD-SCID mice. J. Exp. Med. 193:651–660. Nie, Z., et al. 2006. HIV protease and cell death, p. 155–168. In A. D. Badley (ed.), Cell death during HIV infection. CRC Press, Boca Raton, FL.
6956
NIE ET AL.
28. Nie, Z., B. N. Phenix, J. J. Lum, A. Alam, D. H. Lynch, B. Beckett, P. H. Krammer, R. P. Sekaly, and A. D. Badley. 2002. HIV-1 protease processes procaspase 8 to cause mitochondrial release of cytochrome c, caspase cleavage and nuclear fragmentation. Cell Death Differ. 9:1172–1184. 29. Ougolkov, A. V., M. E. Fernandez-Zapico, D. N. Savoy, R. A. Urrutia, and D. D. Billadeau. 2005. Glycogen synthase kinase-3 participates in nuclear factor B-mediated gene transcription and cell survival in pancreatic cancer cells. Cancer Res. 65:2076–2081. 30. Pelchen-Matthews, A., B. Kramer, and M. Marsh. 2003. Infectious HIV-1 assembles in late endosomes in primary macrophages. J. Cell Biol. 162:443– 455. 31. Sakai, K., J. Dimas, and M. J. Lenardo. 2006. The Vif and Vpr accessory proteins independently cause HIV-1-induced T cell cytopathicity and cell cycle arrest. Proc. Natl. Acad. Sci. USA 103:3369–3374. 32. Sakai, K., M. Smith-Raska, and M. J. Lenardo. 2005. Nonapoptotic HIVinduced cell death, p. 279–291. In A. D. Badley (ed.), Cell death during HIV infection. CRC Press, Boca Raton, FL. 33. Shoeman, R. L., B. Honer, T. J. Stoller, C. Kesselmeier, M. C. Miedel, P. Traub, and M. C. Graves. 1990. Human immunodeficiency virus type 1
J. VIROL.
34.
35.
36. 37.
38.
protease cleaves the intermediate filament proteins vimentin, desmin, and glial fibrillary acidic protein. Proc. Natl. Acad. Sci. USA 87:6336–6340. Shoeman, R. L., C. Sachse, B. Honer, E. Mothes, M. Kaufmann, and P. Traub. 1993. Cleavage of human and mouse cytoskeletal and sarcomeric proteins by human immunodeficiency virus type 1 protease. Actin, desmin, myosin, and tropomyosin. Am. J. Pathol. 142:221–230. Strack, P. R., M. W. Frey, C. J. Rizzo, B. Cordova, H. J. George, R. Meade, S. P. Ho, J. Corman, R. Tritch, and B. D. Korant. 1996. Apoptosis mediated by HIV protease is preceded by cleavage of Bcl-2. Proc. Natl. Acad. Sci. USA 93:9571–9576. Thornberry, N. A., and S. M. Molineaux. 1995. Interleukin-1 beta converting enzyme: a novel cysteine protease required for IL-1 beta production and implicated in programmed cell death. Protein Sci. 4:3–12. Tridandapani, S., T. W. Lyden, J. L. Smith, J. E. Carter, K. M. Coggeshall, and C. L. Anderson. 2000. The adapter protein LAT enhances fcgamma receptor-mediated signal transduction in myeloid cells. J. Biol. Chem. 275: 20480–20487. Ventoso, I., R. Blanco, C. Perales, and L. Carrasco. 2001. HIV-1 protease cleaves eukaryotic initiation factor 4G and inhibits cap-dependent translation. Proc. Natl. Acad. Sci. USA 98:12966–12971.
