Human Immunodeficiency Virus Type 1 Subtypes ... - Journal of Virology

JOURNAL OF VIROLOGY, Nov. 1996, p. 8209–8212 0022-538X/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 70, No. 11

Human Immunodeficiency Virus Type 1 Subtypes Defined by env Show High Frequency of Recombinant gag Genes MARION CORNELISSEN,* GREETJE KAMPINGA, FOKLA ZORGDRAGER, JAAP GOUDSMIT, AND THE UNAIDS NETWORK FOR HIV ISOLATION AND CHARACTERIZATION Department of Human Retrovirology, Academic Medical Centre, Amsterdam, The Netherlands Received 10 June 1996/Accepted 5 August 1996

Genetic subtypes of human immunodeficiency virus type 1 can be distinguished on the basis of phylogenetic analysis of their envelope (env) gene. A significant proportion of human immunodeficiency virus type 1 strains was retrospectively shown to result from recombination events between viruses belonging genetically to distinct subtypes (D. L. Robertson, P. M. Sharp, F. E. McCutchan, and B. H. Hahn, Nature [London] 374:124–126, 1995). To establish the frequency of natural infections with recombinant viruses and to exclude tissue culture artifacts, we analyzed plasma samples from the UNAIDS sample collection. The collection includes samples from 53 individuals infected with subtype A (n 5 9), subtype B (n 5 15), subtype C (n 5 1), subtype D (n 5 13), and subtype E (n 5 15) on the basis of V3 region analysis. Phylogenetic analysis of the gag gene fragment showed intersubtype recombinant genomes in 23 cases: 3 of 9 (33%) of subtype A, 2 of 15 (13%) of subtype B, 3 of 13 (23%) of subtype D, and all of subtype E. Of the 23 recombinant viruses, 19 had a gag gene from one subtype and env from another (Benv/Cgag, Aenv/Cgag, Denv/Agag, and Eenv/Agag). Phylogenetic analysis clustered the Agag of subtype E viruses as an outgroup of subtype A, suggesting that these viruses may belong to a distinct A* cluster. The remaining four recombinant viruses (Benv/Bp17Fp24, Aenv/Ap17Dp24, Aenv/Ap17Cp24, and Denv/ Dp17Ap24) had breakpoint crossover sites in the proximity of the p17-p24 protein processing site. We conclude that recombination in the gag gene is highly frequent among the major env subtypes and that selection of recombinants is apparently based on particularly beneficial combinations of gag and env gene products. analysis was performed on the V3 env region from 53 HIV-1 isolates obtained from specimens collected during 1992 and 1993 (4, 24). The 53 isolates from four countries included subtypes B (Brazil and Thailand), A (Rwanda and Uganda), D (Uganda), and E (Thailand) and a single strain of subtype C from Brazil (4). On the basis of these partial genome sequences, the only mosaic HIV-1 viruses in this UNAIDS collection were those from Thailand, whose gag genes were placed in the subtype A cluster and whose env genes were classified as subtype E. Recently, phylogenetic analyses of full-length env sequences indicated that all subtype E viruses analyzed today cluster with subtype A in the 39 half of their gp41 coding region (7). Most HIV mosaic sequences studied so far have been derived from viruses adapted to grow in immortalized T-cell lines. In the present study, we sought to analyze possible recombination events in the gag gene and/or discordant branching between the gag and env gene. To exclude the possibility of tissue culture artifacts, we used the UNAIDS collected plasma samples instead of primary virus cultures for our sequence analysis. Our previous work on the env gene had shown that results were identical whether subtyping from the plasma samples or virus isolations were performed (4). The 53 plasma samples comprised env subtype A (n 5 9), subtype B (n 5 15), subtype C (n 5 1), subtype D (n 5 13), and subtype E (n 5 15). One-hundred-microliter plasma samples (n 5 53) collected early in infection were used for RNA isolation according to the procedure of Boom et al. (2). After transcription of viral RNA to cDNA and performance of a nested PCR, the PCR products were directly sequenced. The conditions of the reverse transcription reactions and PCRs were described earlier (3, 17). The antisense primer SK39 (59GCATTCTGGACATAAGAC AAGGACCAAA39, nucleotides [nt] 1630 to 1658 in HxB2) was used in the reverse transcription reaction mixture (20). The first PCR used the 59 sense primer gag-1 (59GCGAGAG

Human immunodeficiency virus type 1 (HIV-1) exhibits extensive genetic variation. Phylogenetic analyses have revealed two distinct groups (M and O). On the basis of envelope sequences, at least 10 genetically distinct subtypes or clades are identified within the main (M) group. These subtypes are essentially equidistant from one another, and a phylogenetic tree based on their matrix and core proteins showed similar topology. Genetic variation results from accumulation of point mutations and from recombination. Recent reports have described intergenic recombinants with interspersed segments of genetic material of two parental genotypes (7, 12, 22, 23). Another study using 114 published sequences of viruses from the Los Alamos database showed that at least 10 virus genomes appear to be recombinants in the gag and/or env sequences from different group M subtypes (22). So far, no sequences that were hybrids of group M and group O viruses have been found. In many cases, recombinant breakpoints were found within genes, and the recombinant events appear to have involved multiple crossovers. All the putative intersubtype recombinants originated from geographic regions where multiple subtypes are known to cocirculate, such as central Africa, South America, and Southeast Asia (8, 13–16). In 1990, the World Health Organization established the Network for HIV Isolation and Characterization (now named UNAIDS) to monitor the genetic and antigenic variation of HIV-1 in four sponsored vaccine evaluation sites: Brazil, Rwanda, Thailand, and Uganda (24). The objectives of the Network were to collect clinical materials from HIV-1-infected individuals, isolate representative strains, and characterize them on a biological and molecular level. Previously, sequence * Corresponding author. Mailing address: Department of Human Retrovirology, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: (3120) 5664853. Fax: (31-20) 6916531. 8209

8210

NOTES

J. VIROL. TABLE 1. V3 and Gag p17/p24 genetic subtyping of HIV-1 from plasma samples collected by the World Health Organizationa

FIG. 1. Results of the phylogenetic analysis of the gag (729-nt) sequences by the neighbor-joining method as implemented in the PHYLIP package from the 53 plasma samples collected by the UNAIDS Network for HIV Isolation and Characterization. Subtype-specific gag consensus sequences were taken from the Los Alamos database (19) and included in the analysis. In seven cases (BR017, BR018, BR023, BR025, RW016, UG001, and UG005), the direct sequences were illegible and individual clones were derived from the PCR product. Six clones were sequenced, and the consensus of the cloned sequences was constructed, denoted as c, and used in this phylogenetic analysis.

CGTCAGTATTAAGC39, nt 795 to 815 in HxB2) (18) and reverse transcription primer SK39. The nested PCR used the primer set 59gag2-Sp6 (sense, 59GGGAAAAATTCGGTTAA GGCC39; nt 835 to 856 in HxB2) and 39gagAE-3T7 (antisense, 59ATAATCCTGGGATTAAATAAAATAGT39; nt 1587 to 1612 in HxB2). Both PCRs worked with a final 2.4 mM MgCl2 concentration. The sense nested primer gag2-Sp6 was tailed with an Sp6 oligonucleotide extension and the antisense nested primer 39gagAE-3T7 was tailed with a T7 oligonucleotide extension to enable direct sequencing. Sequencing was performed with Taq dye primers (Applied Biosystems, Foster City, Calif.) and the Thermo Sequenase fluorescent labelled primer cycle sequencing kit (Amersham International plc, Little Chalfont, Buckinghamshire, England). The sequence products were analyzed on an automatic sequencer (Applied Biosystems DNA sequencer model 370A and model 373A stretch). In total, 729 nt, encoding 243 amino acids, were sequenced, with 109 amino acids in p17 and 134 amino acids in p24. When direct sequences were illegible, the PCR products were cloned into a TA cloning system (Invitrogen, San Diego, Calif.), six clones were sequenced, and a consensus sequence was derived. The consensus was a majority consensus, containing at each position the nucleotide that occurred most frequently in the clonal sequences (referred to as c in Table 1). Alignment of all sequences was straightforward and performed manually. Gaps were introduced for optimal alignment. Consensus sequences for the various subtypes were taken from the Los Alamos database (19). Phylogenetic analysis of the gag sequences was done by the neighbor-joining method as implemented in the PHYLIP package (6) and MEGA program (11). The distance matrix was generated by Kimura’s two-parameter model (10). Consensus sequences for the various subtypes were included, and the statistical strength of the neighbor-joining method was assessed by bootstrap resampling (100 data sets). Figure 1 shows the results of the phylogenetic analysis. All 15 env subtype E samples were found to be very closely related, with a

Genotype

Sample no. or no. of samples and origin

V3

Brazil 92BR003 BR004 BR014 BR017c BR018c BR019 BR020 BR021 BR023c BR024 BR025c BR026 BR028 BR030

B B B B B B B B B B C B B B

B B B B B B B B C B C B B B

B B B B B B B B C F C B B B

Rwanda 92RW008 RW009 RW016c RW020 RW024 RW025 RW026

A A A A A A A

A C A A A A A

A C A A D A C

Thailand n 5 15 n52

E B

A B

A B

Uganda 92UG001c UG005c UG021 UG024 UG029 UG031 UG035 UG038 UG040 UG046 UG053 UG059 UG065 UG067 UG070

D D D D A A D D D D D D D D D

D D D/A D A A A D D D D A D D D

D D A D A A A D D D D A D D D

gag p17

gag p24

a BR, Brazil; RW, Rwanda; UG, Uganda. Plasma samples from Thailand were specified only as to number of samples and subtype, but unique sample designations are shown in Fig. 1. c, consensus sequences derived from six clones. Samples with discrepant genotypes are indicated in boldface.

mean nucleotide difference of 1.45% (range, 0.41 to 2.61%), and clustered with subtype A. They varied from the other subtype A strains by a mean nucleotide difference of 8.76% (range, 7.15 to 10.85%). The high bootstrap value (100%) and the position of the subtype E env cluster in the phylogenetic tree indicate that the subtype E gag sequences belong to a distinct variant of subtype A. We suggest that these viruses be called subtype A9, analogous to the so-called subtype B9, i.e., the subtype B viruses in Thailand that are genetically distinct from subtype B strains found in America and Europe (9). Recombinants can be detected when different genes, or different regions within the same gene, are placed by phylogenetic analysis in different sequence subtypes or as distant members of established subtypes. On the basis of the phylogenetic

VOL. 70, 1996

NOTES

8211

TABLE 2. Localization of crossover breakpointsa Isolate

Br24 Rw24 Rw26 Ug21

gag

p17-p24 p24 p17 p24 p17 p24 p17 p17-p24

Region (nt)

70–561 604–791 70–349 390–791 70–340 390–791 70–260 302–791

Subtype

B F A D A C D A

No. of informative sites 1

2

SIVcpz

14 1 9 0 12 1 12 2

0 10 1 8 2 11 1 20

6 1 2 3 2 0 1 2

P

,0.000 ,0.001 ,0.000 ,0.000

a Localization of intragenic breakpoints between regions belonging to different subtypes in putative recombinant HIV-1 gag sequences is shown. For each sequence, phylogenetic analyses were performed with four taxa: the putative recombinant, two consensus sequences for each of the two subtypes inferred to have been involved in the recombination event, and an outgroup (SIVcpzGAB). The number of phylogenetically informative sites supporting the grouping of the recombinant sequences with each of the other three sequences is given. Breakpoints were inserted at each possible point between adjacent informative sites, and a 2 3 2 heterogeneity chi-square value was calculated for the numbers of sites (to either side of the breakpoint) supporting the clustering of the putative recombinant with each of the consensus sequences. The likely breakpoint was identified as that which gave the maximal chi-square value.

analysis shown in Fig. 1, eight samples are most likely recombinants, in addition to the 15 env subtype E recombinants. Two env subtype A samples (RW024 and RW026) and one env subtype D sample (UG021) could not be assigned to any known subtype. One env subtype A sample was classified with gag as subtype C (RW009). Two env subtype B samples clustered with their gag sequences in subtypes C and F (BR023c and BR024, respectively), and two env subtype D samples had gag sequences with characteristics of subtype A (UG035 and UG059). The results of the phylogenetic analysis are summarized in Table 1. To investigate further the eight unclassified or discordant mosaic HIV-1 gag genes, phylogenetic neighbor-joining trees based on various parts of gag sequences (p17 and part of p24, respectively) were constructed. The tree in Fig. 2 shows only the eight suspected mosaic genome sequences and the consensuses of the subtypes probably involved in the recombination. In four sequences (RW009, BR023, UG035, and UG059), the env and gag sequences exhibit discordant subtype classification. In the other four (BR024, RW024, RW026, and UG021), partial gag sequences exhibit different subtypes. BR024 is a mosaic of subtypes B and F, RW024 is a mosaic of subtypes A and D, RW026 is a mosaic of subtypes A and C, and UG021 is a mosaic of subtypes A and D (Table 1). Breakpoints between genomic regions with different phylogenetic origins were localized by a method adapted from the work of Robertson et al. (21). It utilized four sequences at a time, i.e., the putative recombinant sequence, the consensus of the two putative subtype parents, and an outgroup. In a foursequence alignment, an informative site is one at which two sequences share one nucleotide and the remaining two share another identical nucleotide. Three site configurations are possible, two linking the putative recombinant with one parental sequence or the other and one linking it with the outgroup. The latter type of informative site should be relatively rare and scattered along the alignment, or else the sequences are too divergent for analysis. The position of the breakpoint is indicated by a significant difference in the ratio of the types on either side of the cut, as assessed by the chi-square value. Our analysis of the four putative mosaic gag genes identified the breakpoints in a highly significant fashion (Table 2). Further

FIG. 2. Results of the phylogenetic analysis of the gag sequences by the neighbor-joining method as part of the MEGA program from the eight putative recombinant viruses and the consensuses of the subtypes probably involved in the recombination. (A) All 729 nt analyzed; (B) whole p17, 327 nt; (C) partial p24, 402 nt.

analysis of the other four recombinants with discordant gag and env classifications did not provide any evidence for a breakpoint in the gag region analyzed. The four observed crossover breakpoints were located in the proximity of the p17-p24 protein processing site. The results described in this study confirmed that mosaic genomes occur in vivo. They show that within a given subtype recombinants can be distinguished for one gene or parts of genes and putatively allow for further differentiation of subtypes. The results also show that a geographic area not dominated by a particular subtype may harbor or may once have harbored other subtypes. The frequency of mosaic HIV-1 genomes based on the sequences of HIV-1 virus isolates taken from the Los Alamos database was about 10% (22). Our study of the prevalence of hybrid Gag and Env proteins found a significantly higher fraction bearing interspersed segments from different clades. The phylogenetic analysis of gag p17 and gag p24 fragments showed 3 of 9 (33%) of subtype A, 2 of 25 (15%) of subtype B, 3 of 13 (23%) of subtype D, and all of subtype E to have intersubtype recombinant genomes. Although the evidence for coinfection or superinfection with

8212

NOTES

J. VIROL.

multiple HIV-1 strains remains rare (1, 5, 25), the high frequency of these mosaic forms implies that dual infections are less rare than previously assumed. The Thai env sequences were classified as a distinct subtype, i.e., subtype E. Recently, comparison of the first full-length genomes of clade E viruses showed their genomes to be largely derived from subtype A but with gp120 and the outer or external portion of gp41 derived from subtype E (7). Our data confirm the classification of gag sequences in subtype A, although on the basis of the bootstrap value (100%) these sequences represent a true monophyletic group. This is consistent with the hypothesis that the HIV-1 epidemic in Thailand reflects a founder effect, with the founder virus itself as an A/E recombinant. Recombination between HIV-1 subtypes depends on the cocirculation of subtypes as well as intrinsic genetic characteristics that facilitate homologous recombination. The high frequency of recombination around protein processing sites indicates that after a recombination event survival depends on the competitive advantage (i.e., the phenotypic characteristics) of the chimeric viruses. The selection process is apparently based on particularly beneficial combinations of gag and env gene products. We thank Vladimir Lukashov for the statistical analysis, Carla Kuiken for critical reading of the manuscript, and Lucy Phillips for editorial assistance. This research was supported by the Netherlands Foundation for Preventive Medicine (28-2413 and 28-2370) as part of the Stimulation Program on AIDS Research of the Dutch Program Committee for AIDS Research.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17. REFERENCES 1. Artenstein, A. W., T. C. VanCott, J. R. Mascola, J. K. Carr, P. A. Hegerich, J. Gaywee, E. Sanders-Buell, M. L. Robb, D. E. Dayhoff, S. Thitivichianlert, S. Nitayaphan, J. G. McNeil, D. L. Brix, R. A. Michael, D. S. Burke, and F. E. McCutchan. 1995. Dual infection with human immunodeficiency virus type 1 of distinct envelope subtypes in humans. J. Infect. Dis. 171:805–810. 2. Boom, R., C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheimvan Dillen, and J. van der Noordaa. 1990. A rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495–503. 3. Cornelissen, M., G. Mulder-Kampinga, J. Veenstra, F. Zorgdrager, C. Kuiken, S. Hartman, J. Dekker, L. van der Hoek, C. Sol, R. Coutinho, and J. Goudsmit. 1995. Syncytium-inducing (SI) phenotype suppression at seroconversion after intramuscular inoculation of a non-syncytium-inducing/SI phenotypically mixed human immunodeficiency virus population. J. Virol. 69:1810–1818. 4. de Wolf, F., E. Hogervorst, J. Goudsmit, E. M. Fenyo¨, H. Ru ¨bensamenWaigmann, H. Holmes, B. Galvao-Castro, E. Karita, C. Wasi, S. D. K. Sempala, E. Baan, F. Zorgdrager, V. Lukashov, S. Osmanov, C. Kuiken, M. Cornelissen, and WHO Network on HIV-1 Isolation and Characterization. 1994. Syncytium inducing (SI) and non-syncytium (NSI) capacity of human immunodeficiency virus type 1 (HIV-1) subtypes other than B: phenotypic and genotypic characteristics. AIDS Res. Hum. Retroviruses 11:1387–1400. 5. Diaz, R. S., E. C. Sabino, A. Mayer, J. W. Mosley, M. P. Busch, and The Transfusion Safety Study Group. 1995. Dual human immunodeficiency virus type 1 infection and recombination in a dually exposed transfusion recipient. J. Virol. 69:3273–3281. 6. Felsenstein, J. 1993. PHYLIP manual version 3.5. University Herbarium of the University of California at Berkeley, Berkeley. 7. Gao, F., S. G. Morrison, D. L. Robertson, C. L. Thornton, S. Craig, G. Karlsson, J. Sodroski, M. Morgado, B. Galvao-Castro, H. von Briesen, S. Beddows, J. Weber, P. M. Sharp, G. M. Shaw, B. H. Hahn, and the WHO and

18.

19.

20.

21. 22. 23.

24.

25.

NIAID Networks for HIV Isolation and Characterization. 1996. Molecular cloning and analysis of functional envelope genes from human immunodeficiency virus type 1 sequence subtypes A through G. J. Virol. 70:1651–1667. Jain, M. K., T. J. John, and G. T. Keusch. 1994. A review of human immunodeficiency virus infection in India. J. Acquired Immune Defic. Syndr. 7:1185–1194. Kalish, M. L., C.-C. Luo, B. G. Weniger, K. Limpakarnjanarat, N. Young, C.-Y. Ou, and G. Schochetman. 1994. Early HIV type 1 strains in Thailand were not responsible for the current epidemic. AIDS Res. Hum. Retroviruses 10:1573–1575. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitution through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111–120. Kumar, S., K. Tamura, and M. Wei. 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. Institute of Molecular Evolutionary Genetics, The Pennsylvania State University, University Park. Leitner, T., D. Escanilla, S. Marquina, J. Wahlberg, C. Brostrom, H. B. Hansson, M. Uhlen, and J. Albert. 1995. Biological and molecular characterization of subtype D, G, and A/D recombinant HIV-1 transmissions in Sweden. Virology 209:136–146. Louwagie, J., W. Janssens, J. Mascola, L. Heyndrickx, P. Hegerich, G. van der Groen, F. E. McCutchan, and D. S. Burke. 1995. Genetic diversity of the envelope glycoprotein from human immunodeficiency virus type 1 isolates of African origin. J. Virol. 69:263–271. Louwagie, J., F. E. McCutchan, M. Peeters, T. P. Brennan, E. Sanders-Buell, G. A. Eddy, G. van der Groen, K. Fransen, G.-M. Gershy-Damet, R. Deleys, and D. S. Burke. 1993. Phylogenetic analysis of gag genes from 70 international HIV-1 isolates provides evidence for multiple genotypes. AIDS 7:769– 780. Lukashov, V. V., M. T. E. Cornelissen, J. Goudsmit, M. N. Papuashvilli, P. G. Rytik, R. M. Khaitov, E. V. Karamov, and F. de Wolf. 1995. Simultaneous introduction of distinct HIV-1 subtypes into different risk groups in Russia, Byelorussia and Lithuania. AIDS 9:435–439. McCutchan, F. E., P. A. Hegerich, T. P. Brennan, P. Phanuphak, P. Singharaj, A. Jugsudee, P. W. Berman, A. M. Gary, A. K. Fowler, and D. P. Burke. 1992. Genetic variants of HIV-1 in Thailand. AIDS Res. Hum. Retroviruses 8:1887–1895. Mulder-Kampinga, G. A., C. L. Kuiken, J. Dekker, H. J. Scherpbier, K. Boer, and J. Goudsmit. 1993. Genomic HIV-1 RNA variation in mother and child following intra-uterine virus transmission. J. Gen. Virol. 74:1747–1756. Mulder-Kampinga, G. A., A. Simonon, C. Kuiken, J. Dekker, H. J. Scherpbier, P. van de Perre, K. Boer, and J. Goudsmit. 1995. Similarity in env and gag genes between genomic RNAs of human immunodeficiency virus type 1 (HIV-1) from mother and infant is unrelated to time of HIV-1 RNA positivity in the child. J. Virol. 69:2285–2296. Myers, G., B. Korber, B. H. Hahn, K.-T. Jeang, J. W. Mellors, F. E. McCutchan, L. E. Henderson, and G. N. Pavlakis. 1995. Human retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics, Los Alamos, N.Mex. Ou, C. Y., S. Kwok, S. W. Mitchell, D. H. Mack, J. J. Sninsky, J. W. Krebs, P. Feorino, D. Warfield, and G. Schochetman. 1988. DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 239:295–297. Robertson, D. L., B. H. Hahn, and P. M. Sharp. 1995. Recombination in AIDS viruses. J. Mol. Evol. 40:249–259. Robertson, D. L., P. M. Sharp, F. E. McCutchan, and B. H. Hahn. 1995. Recombination in HIV-1. Nature (London) 374:124–126. Sabino, E. C., E. G. Shpaer, M. G. Morgado, B. T. M. Korber, R. S. Diaz, V. Bongertz, S. Cavalcante, B. Galva ˜o-Castro, J. I. Mullins, and A. Mayer. 1994. Identification of human immunodeficiency virus type 1 envelope genes recombinant between subtypes B and F in two epidemiologically linked individuals from Brazil. J. Virol. 68:6340–6346. WHO Network for HIV Isolation and Characterization. 1994. HIV type 1 variation in World Health Organization-sponsored vaccine evaluation sites: genetic screening, sequence analysis and preliminary biological characterization of selected viral strains. AIDS Res. Hum. Retroviruses 10:1327–1343. Zhu, T., N. Wang, A. Carr, S. Wolinsky, and D. D. Ho. 1995. Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconvertor. J. Virol. 69:1324–1327.