Human Uroplakin Ib in Ocular Surface Epithelium - Semantic Scholar

Human Uroplakin Ib in Ocular Surface Epithelium Wakako Adachi,1,2 Kousaku Okubo,2 and Shigeru Kinoshita1 PURPOSE. To investigate the expression and localization of the human gene encoding uroplakin Ib in ocular surface epithelium. METHODS. The full-length cDNA of human uroplakin Ib was isolated from a cDNA library of human corneal epithelium, and the expression of uroplakin Ib in various tissues was examined by reverse transcription–polymerase chain reaction (RT-PCR). In cornea and conjunctiva, the expressions of uroplakin Ia, II, and III were also examined by RT-PCR. Finally, the localization of uroplakin Ib in the ocular surface was analyzed by immunofluorescence confocal microscopy, by using an antiserum against a synthetic peptide. RESULTS. Two mRNA isoforms, arising through two polyadenylation sites, were isolated. RT-PCR detected uroplakin Ib in cornea, conjunctiva, bladder, placenta, and kidney. Among other uroplakins, uroplakin II was also faintly detected in cornea and conjunctiva. Immunofluorescence confocal microscopy documented uroplakin Ib protein in the cell membranes of superficial and wing cells in the corneal epithelium. It was not found, however, in the most apical corneal epithelial cells. In limbus and conjunctiva, uroplakin Ib was also localized in the cell membranes of all epithelial layers, apart from the most apical cells. CONCLUSIONS. Uroplakin Ib is highly expressed in ocular surface epithelia. As in bladder epithelium, uroplakin Ib may protect the ocular surface from bacterial infection. (Invest Ophthalmol Vis Sci. 2000;41:2900 –2905)

I

n previous experiments we identified several genes uniquely and abundantly active in human corneal epithelium. This was achieved by a random 3⬘-directed expressed sequence tag (EST) collection that we called a gene expression profile.1– 4 Among the expressed genes, GS8103 appeared twice and GS8043 once in 1062 isolates; both encoded human uroplakin Ib. Uroplakins Ia, Ib, II, and III are transmembrane proteins constituting the asymmetrical unit membrane of urothelial umbrella cells. They are believed to play a major role in stabilizing the apical surface of the mammalian urothelium, thereby preventing it from rupturing during bladder distension.5–7 Uroplakin Ia and Ib are members of the transmembrane 4 (TM4) superfamily that contains many leukocyte differentiation-related surface proteins including CD9, CD37, CD53, CD63, and CD81.8 –12 Recent work has shown that uroplakin Ia and Ib can bind specifically to Escherichia coli, expressing type 1 pili that can result in the exfoliation of bladder epithelial cells as part of

From the 1Department of Ophthalmology, Kyoto Prefectural University of Medicine, Japan; and the 2Institute for Molecular and Cellular Biology, Osaka University, Japan. Supported in part by research grants 10470365 from the Japanese Ministry of Education, Science, and Culture; a Health Science Research Grant from the Japanese Ministry of Health and Welfare; and research grants from the Kyoto Foundation for the Promotion of Medical Science and the intramural research fund of Kyoto Prefectural University of Medicine. Submitted for publication November 29, 1999; revised February 23, 2000; accepted March 31, 2000. Commercial relationships policy: N. Corresponding author: Wakako Adachi, Department of Ophthalmology, Kyoto Prefectural University of Medicine, Kawaramachi, Hirokoji, Kamigyo-ku, Kyoto, 602-0841, Japan. [email protected]

2900

an innate host defense system through an apoptosis-like mechanism.13,14 In this study, we determined the complete nucleotide sequence of uroplakin Ib cDNA tagged by GS8103. Moreover, the tissue distribution of uroplakin Ib mRNA was determined by reverse transcription–polymerase chain reaction (RT-PCR), and the ocular localization of the protein was examined by immunofluorescence confocal microscopy.

MATERIALS

AND

METHODS

Isolation and Sequence Analysis of Human Uroplakin Ib cDNA By use of the cDNA library of the human corneal epithelium, approximately 80,000 plaques were screened with 32P-labeled random primed fragments of GS8103 (331 bp) after cutting off Alu-repetitive sequences. Among the positive plaques, the longest cDNA insert was sequenced by the shotgun method.15,16

Reverse Transcription–Polymerase Chain Reaction All investigations followed the tenets of the Declaration of Helsinki, informed consent was gained from the patients, and approval was obtained from the Research Committee of the Kyoto Prefectural University of Medicine. Normal cornea and conjunctiva were obtained at autopsy; skin was excised during orthopedic surgery. Total RNA from other tissues (bladder, brain, heart, kidney, liver, lung, placenta, skeletal muscles, small intestine, and uterus) was purchased from Clontech (Palo Alto, CA). cDNA of each tissue was generated from 1 ␮g of total RNA according to standard procedures.17 The mRNA tissue distribution of uroplakin Ib was examined by RT-PCR Investigative Ophthalmology & Visual Science, September 2000, Vol. 41, No. 10 Copyright © Association for Research in Vision and Ophthalmology

Uroplakin Ib in Ocular Surface Epithelium

IOVS, September 2000, Vol. 41, No. 10 TABLE 1. Primers for RT-PCR

Gene PCR Size Uroplakin Ia (293 bp) Uroplakin Ib (221 bp) Uroplakin II (284 bp) Uroplakin III (243 bp) Uroplakin Ib extended 3⬘-UTR (154 bp)

scanning confocal microscope (Fluoview; Olympus, Tokyo, Japan).

GenBank Accession Number AF085807 AB015234 Y13645 AF085808 AB002155

2901

Primers F: R: F: R: F: R: F: R: F: R:

CTTACGTCCTTCCACTTCCA GGTGATGATGGGGACAGTAA GGCGTAAATGGTCCATCAGA AGGCGTGTCGGTTCATTGGA GTGCTGGGCTTCATCATTGC TGGGAGGAAAGTCAACTCTG CAACCAGCTCACCCCATACT ACGGACGTGTAGGAAGACTC GTCTTTGCCCTGAATGGTCT AGAATTTCCTTCAGGACCACA

F, forward; R, reverse.

using a protocol described previously.1 The expressions of uroplakin Ia, II, and III mRNA in corneal epithelium and conjunctival epithelium were also examined by RT-PCR in comparison with the expressions in bladder. Specific primers for uroplakin Ia, Ib, II, and III were produced by selecting specific nucleotide sequences from among the published sequences (Table 1).18 –20 The expression of the extended 3⬘-untranslated region (UTR) of uroplakin Ib was examined using additional primers produced from the sequence of GS8103 (Table 1). Glyceraldehyde 3-phosphate dehydrogenase(G3PDH) primers were used as controls.

Western Blot Analysis and Immunofluorescence Confocal Microscopy of Uroplakin Ib Protein in the Ocular Surface Normal human cornea, limbus, and conjunctiva were obtained from eyes at autopsy. For Western blot analysis, scraped corneal epithelial cells were solubilized, after which approximately 50 ␮g of protein was fractionated by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDSPAGE), blotted to a polyvinylidene difluoride membrane, and analyzed as described previously.1 To prepare antiserum for uroplakin Ib, a synthetic peptide that corresponds to amino acid residues 2 to 12 (AKDNSTVRCFQ; Fig. 1) in uroplakin Ib was conjugated to keyhole limpet hemocyanin and used to immunize the rabbit.1 The localization of uroplakin Ib in normal human cornea, limbus, and conjunctiva was investigated by immunofluorescence confocal microscopy. Tissue specimens were snap frozen, sectioned into 7-␮m-thick slices and fixed in cold acetone at 4°C for 10 minutes. To block nonspecific binding, the tissues were incubated with 10% goat serum at room temperature for 20 minutes. Subsequently, the sections were incubated at room temperature for 30 minutes with diluted 1:4000 antiuroplakin Ib antiserum. Preabsorbed anti-uroplakin Ib antiserum with 5 ␮g/ml synthetic peptides was used for controls after a 2-hour incubation at room temperature. Sections were incubated further with fluorescein isothiocyanate– conjugated swine anti-rabbit immunoglobulins (working dilution 1:500; Dako, Carpinteria, CA) for 30 minutes at room temperature and mounted with antifading medium containing propidium iodide (Vectashield; Vector, Burlingame, CA). Between each of these steps, the tissue sections were rinsed thoroughly with 0.1 M phosphate-buffered saline. Slides were examined using a laser

RESULTS Sequence Analysis The longest cDNA clone corresponding to GS8103 comprised 2018 bp of nucleotides and contained an open reading frame encoding 260 amino acids of human uroplakin Ib (GenBank accession number, AB002155). The nucleotide sequence 977 to 1135 corresponded to another gene signature (GS), GS8043, that matched the 3⬘-UTR of human uroplakin Ib in GenBank (accession numbers AB015234 and AF0422331). These results imply that the uroplakin Ib gene has two polyadenylation sites. A canonical polyadenylation signal (AATAAA) was found in the region of GS8043, but not in the region of GS8103. In the coding region, it was 92% identical with bovine uroplakin Ib and 93% identical with mink TI1 (mink uroplakin Ib), as described by Finch et al.19 In the 3⬘-UTR, the nucleotide sequence 1462 to 1741 of human uroplakin Ib corresponded to the Alu-repetitive sequence. Bovine uroplakin Ib also contained a bovine Alu-like repetitive sequence that was not present in mink TI1.8,21 Compared with bovine uroplakin Ib in the 3⬘-UTR, the nucleotide sequence 1984 to 1989 (AGTAAA) of human uroplakin Ib may be a noncanonical polyadenylation site of GS8103.

Tissue Distribution of Human Uroplakin Ib mRNA The mRNA expression of uroplakin Ib was examined in various tissues by RT-PCR. Uroplakin Ib transcript was clearly detected in bladder, corneal epithelium, conjunctival epithelium and placenta. It was detected faintly in kidney and not at all in skin, brain, heart, liver, lung, skeletal muscle, small intestine, and uterus (Fig. 2A). Among other uroplakins, uroplakin II was also detected weakly in cornea and conjunctiva, although at a much lower level than in bladder (Fig. 2B). Uroplakin Ia and III were not detected in corneal epithelium or conjunctival epithelium (Fig. 2B). The results of RT-PCR using uroplakin Ib primers and RT-PCR using uroplakin Ib extended 3⬘-UTR primers showed that two mRNA isoforms of uroplakin Ib were present in cornea, conjunctiva, and bladder (Fig. 2B).

Localization of Uroplakin Ib Protein in the Ocular Surface Western blot analysis of human corneal epithelium revealed an immunoreactive band with a molecular weight of approximately 28 kDa that corresponds to uroplakin Ib protein8 (Fig. 3, lane 1). The specificity of this reaction was established by the fact that the staining was completely blocked by preincubating the antiserum with the peptide antigens (5 ␮g/ml; Fig. 3, lane 2). The localization of uroplakin Ib protein was investigated by immunofluorescence confocal microscopy using the same antiserum with specificity confirmed by Western blot analysis. In corneal epithelium, the cell membranes of the superficial and wing cells immunoreacted intensely with the antibody. The most apical cells, however, did not stain (Fig. 4A). In conjunctival epithelium, the pattern of positive immunostaining was little different from that in corneal epithelium. Although the staining was less than that in corneal epithelium, it was seen in all the epithelial layers except for the most apical

2902

Adachi et al.

IOVS, September 2000, Vol. 41, No. 10

FIGURE 1. Nucleotides and amino acid sequences of human uroplakin Ib (GenBank accession number AB002155). Four stretches of hydrophobic amino acids that are long enough to span the lipid bilayer are boxed and shaded. 3⬘-UTRs corresponding to GS8043 and GS8103 are marked. Canonical polyadenylation signal (AATAAA) of GS8043, an Alurepetitive sequence, are represented respectively by solid and dashed underlines. The region of synthetic peptide is indicated in bold.

cells (Fig. 4E). In limbal epithelium, the staining pattern was similar to that in conjunctival epithelium (Fig. 4C). All the control slides showed negative staining (Figs. 4B, 4D, 4F).

DISCUSSION Herein, we report how we cloned human uroplakin Ib cDNA and found that it has two polyadenylation sites, tagged by

GS8043 and GS8103. These two transcripts are present in approximately equal intensities in normal human urothelium examined by Northern blot analysis.19 By RT-PCR, we found that these two transcripts are also present in the normal ocular surface epithelia of humans. When we searched against database (db) EST, however, we found that the expressions of the two GS sequences were quite different. GS8043 matched five of EST’s material sources: invasive kidney tumor (GenBank


FIGURE 2. (A) RT-PCR of human uroplakin (UP) Ib in corneal epithelium and other tissues. Amplified products were electrophoresed on 1.2% agarose gel and stained with SYBR Green I (FMC Bioproducts, Rockland, ME). Lane 1, bladder; lane 2, corneal epithelium; lane 3, conjunctival epithelium; lane 4, skin; lane 5, brain; lane 6, heart; lane 7, kidney; lane 8, liver; lane 9, lung; lane 10, placenta; lane 11, skeletal muscles; lane 12, small intestine; and lane 13, uterus. (B) RT-PCR of human uroplakins in corneal epithelium, conjunctival epithelium, and bladder. Amplified products were electrophoresed on 1.5% agarose gel and stained with SYBR Green I. Lane M, 1 kbp DNA ladder; lane 1, corneal epithelium; lane 2, conjunctival epithelium; lane 3, bladder.

accession numbers AA513869 and AA484313), well-differentiated endometrial adenocarcinoma (AI632869), poorly differentiated endometrial adenocarcinoma (AI811548), and gallbladder (AA345,951); GS8103 was not found at all. Judging by this, the transcript corresponding to GS8043 may be more highly expressed in carcinoma tissues than in normal tissues. Using RT-PCR, we clearly detected uroplakin Ib and faintly detected uroplakin II in corneal and conjunctival epithelia. Uroplakins Ia and III, were not detected. Our results therefore seem to indicate a difference between ocular surface epithelia and bladder epithelium, because it is known that uroplakin Ib makes a heterodimer with uroplakin III in bladder epithelium.22 Uroplakins Ia and Ib are members of the TM4 family of proteins and have been implicated in diverse cellular processes, including cell activation, proliferation, differentiation, adhesion, and motility by facilitating specific interactions between cell surface proteins.23,24 Recent studies have shown that CD9, CD63, and CD81 form complexes with integrins on the cell surface.25,26 To clarify the possible function of uroplakin Ib in the ocular surface, it would be useful to investigate its possible association with other proteins.


2903

In the corneal epithelium, uroplakin Ib was identified by immunofluorescence confocal microscopy in the membranes of cells in the superficial half of this multicellular layer. This localization is generally similar to that in bladder epithelium, except that in bladder it is the superficial epithelial cells that label the strongest.27 As in corneal epithelium, in conjunctival epithelium and limbal epithelium, uroplakin Ib was found in the cell membranes in all epithelial layers, albeit with lower levels of immunostaining. It is interesting that uroplakin Ib protein was not detected in the most superficial cells in the ocular surface epithelium, even when immunofluorescence confocal microscopy was performed after treatment with neuraminidase or acetylcysteine to avoid an effect of heavily glycosylated proteins (data not shown). When we consider the tissue distribution of uroplakin Ib as described in dbEST, it is apparent that it exists in several nonkeratinized epithelia at the tissue–fluid interface. In the ocular surface, apolipoprotein J and mucin proteins are known to localize at the tissue–fluid interface.28,29 Similar to these proteins, uroplakin Ib may function to maintain ocular surface homeostasis at the tear– ocular surface interface. Uroplakin Ib is one of the major components of bladder, where it is thought to prevent rupturing during distension.5–7 We reason that if uroplakin Ib has a similar mechanical function in ocular surface, it may help resist mechanical forces on the cornea by intraocular pressure or external pressures such as those due to blinking. As an ocular surface defense system and to prevent bacterial infection, tear fluid contains secretory IgA and IgG, com-

FIGURE 3. Western blot analysis of uroplakin Ib protein in corneal epithelium. Approximately 50 ␮g of protein was electrophoresed on 12% SDS polyacrylamide gels and transferred to a polyvinylidene difluoride membrane. Western blot analysis was performed with antipeptide antiserum. A competitive experiment was performed with 5 ␮g/ml synthetic peptides. Lane 1: An approximate 28-kDa band in corneal epithelium lysates; lane 2: competitive experiment with equal amounts of human corneal lysates.

2904

Adachi et al.


FIGURE 4. Immunoconfocal localization of uroplakin Ib in cornea (A, B), limbus (C, D), and conjunctiva (E, F). Cryosections were incubated with antiserum (A, C, E) or preabsorbed antiserum (B, D, F) to uroplakin Ib (green), then incubated with a fluorescein isothiocyanate– conjugated second antibody and examined on a laser scanning confocal microscope. Nuclei were stained with propidium iodide (red). Uroplakin Ib was localized in the cell membranes of the superficial and wing cells of the corneal epithelium. The apical-most cells were not immunostained (A). In limbal (C) and conjunctival (E) epithelia, immunostaining was less than in corneal epithelium; however, it was clear that the cell membranes of all epithelial layers were immunopositive for uroplakin Ib. All the control slides showed negative staining (B, D, F). Scale bar, 20 ␮m.

plement components, lactoferrins, and lysozyme.30 Recently, it has been indicated that antimicrobial peptides called defensins are produced by the cornea, conjunctiva, and lacrimal gland.31 In the corneal epithelium, there are numerous solid junctions, and the permeability of this cellular layer is much less than that of conjunctival epithelium.32 However, if the defense system is compromised and bacteria invade the corneal epithelium, the immunologic defense of the cornea is lower than that of the conjunctiva.30 With this in mind, it is interesting to note that uroplakin Ia and Ib are able to bind to E. coli type I pili and that this results in exfoliation of host bladder epithelial cells as part of an innate host defense system.13,14 We postulate that uroplakin Ib expressed in ocular surface epithelium, especially the apical side of corneal epithelium, may prevent bacterial invasion into deeper tissues. The most superficial cells may not need uroplakin Ib, because they fall off in a short time, whether bacteria attach them or not. The reason the uroplakin

Ib, not uroplakin Ia, is necessary in ocular surface epithelium is not clear at present and is the subject of proposed studies.

Acknowledgments The authors thank Satoshi Kawasaki for technical help and Tung-Tien Sun, New York University, and Andrew Quantock, Cardiff University, United Kingdom, for critical reading and comments on the manuscript.

References 1. Adachi W, Kawamoto S, Ohno I, et al. Isolation and characterization of human cathepsin V: a major proteinase in corneal epithelium. Invest Ophthalmol Vis Sci. 1998;39:1789 –1796. 2. Nishida K, Adachi W, Shimizu–Matsumoto A, et al. A gene expression profile of human corneal epithelium and the isolation of human keratin 12 cDNA. Invest Ophthalmol Vis Sci. 1996;37: 1800 –1809.

IOVS, September 2000, Vol. 41, No. 10 3. Okubo K, Hori N, Matoba R, Niiyama T, Matsubara K. A novel system for large-scale sequencing of cDNA by PCR amplification. DNA Seq. 1991;2:137–144. 4. Okubo K, Hori N, Matoba R, et al. Large scale cDNA sequencing for analysis of quantitative and qualitative aspects of gene expression. Nat Genet. 1992;2:173–179. 5. Wu XR, Lin JH, Walz T, et al. Mammalian uroplakins: a group of highly conserved urothelial differentiation-related membrane proteins. J Biol Chem. 1994;269:13716 –13724. 6. Staehelin LA, Chlapowski FJ, Bonneville MA. Lumenal plasma membrane of the urinary bladder, I: three-dimensional reconstruction from freeze-etch images. J Cell Biol. 1972;53:73–91. 7. Chlapowski FJ, Bonneville MA, Staehelin LA. Lumenal plasma membrane of the urinary bladder, II: isolation and structure of membrane components. J Cell Biol. 1972;53:92–104. 8. Yu J, Lin JH, Wu XR, Sun TT. Uroplakins Ia and Ib, two major differentiation products of bladder epithelium, belong to a family of four transmembrane domain (4TM) proteins. J Cell Biol. 1994; 125:171–182. 9. Angelisova P, Vlcek C, Stefanova I, Lipoldova M, Horejsi V. The human leukocyte surface antigen CD53 is a protein structurally similar to the CD37 and MRC OX-44 antigens. Immunogenetics. 1990;32:281–285. 10. Boucheix C, Benoit P, Frachet P, et al. Molecular cloning of the CD9 antigen: a new family of cell surface proteins. J Biol Chem. 1991;266:117–122. 11. Oren R, Takahashi S, Doss C, Levy R, Levy S. TAPA-1, the target of an antiproliferative antibody, defines a new family of transmembrane proteins. Mol Cell Biol. 1990;10:4007– 4015. 12. Hotta H, Ross AH, Huebner K, et al. Molecular cloning and characterization of an antigen associated with early stages of melanoma tumor progression. Cancer Res. 1988;48:2955–2962. 13. Wu XR, Sun TT, Medina JJ. In vitro binding of type 1-fimbriated Escherichia coli to uroplakins Ia and Ib: relation to urinary tract infections. Proc Natl Acad Sci USA. 1996;93:9630 –9635. 14. Mulvey MA, Lopez–Boado YS, Wilson CL, et al. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science. 1998;282:1494 –1497. 15. Frischauf A, Garoff H, Lerach H. A subcloning strategy for DNA sequence analysis. Nucleic Acids Res. 1980;8:5541–5549. 16. Bankier AT, Weston KM, Barrell BG. Random cloning and sequencing by the M13/dideoxynucleotide chain termination method. Methods Enzymol. 1987;155:51–93. 17. Sambrook J, Fritsch EF, Maniatis T. Construction and analysis of cDNA library. In: Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989:8.1– 8.86.


2905

18. Yuasa T, Yoshiki T, Tanaka T, Kim CJ, Isono T, Okada Y. Expression of uroplakin Ib and uroplakin III genes in tissues and peripheral blood of patients with transitional cell carcinoma. Jpn J Cancer Res. 1998;89:879 – 882. 19. Finch JL, Miller J, Aspinall JO, Cowled PA. Cloning of the human uroplakin 1B cDNA and analysis of its expression in urothelialtumor cell lines and bladder-carcinoma tissue. Int J Cancer. 1999; 80:533–538. 20. Wu RL, Osman I, Wu XR, et al. Uroplakin II gene is expressed in transitional cell carcinoma but not in bilharzial bladder squamous cell carcinoma: alternative pathways of bladder epithelial differentiation and tumor formation (published correction appears in Cancer Res 1998;58:2904). Cancer Res. 1998;58:1291–1297. 21. Kallin B, de Martin R, Etzold T, Sorrentino V, Philipson L. Cloning of a growth arrest-specific and transforming growth factor betaregulated gene, TI 1, from an epithelial cell line. Mol Cell Biol. 1991;11:5338 –5345. 22. Wu XR, Medina JJ, Sun TT. Selective interactions of UPIa and UPIb, two members of the transmembrane 4 superfamily, with distinct single transmembrane- domained proteins in differentiated urothelial cells. J Biol Chem. 1995;270:29752–29759. 23. Wright MD, Tomlinson MG. The ins and outs of the transmembrane 4 superfamily. Immunol Today. 1994;15:588 –594. 24. Maecker H, Todd S, Levy S. The tetraspan superfamily: molecular facilitators. FASEB J. 1997;11:428 – 442. 25. Berditchevski F, Zutter MM, Hemler ME. Characterization of novel complexes on the cell surface between integrins and proteins with 4 transmembrane domains (TM4 proteins). Mol Biol Cell. 1996;7: 193–207. 26. Jones PH, Bishop LA, Watt FM. Functional significance of CD9 association with beta 1 integrins in human epidermal keratinocytes. Cell Adhes Commun. 1996;4:297–305. 27. Lobban ED, Smith BA, Hall GD, et al. Uroplakin gene expression by normal and neoplastic human urothelium. Am J Pathol. 1998;153: 1957–1967. 28. Inatomi T, Spurr–Michaud S, Tisdale AS, Gipson IK. Human corneal and conjunctival epithelia express MUC1 mucin. Invest Ophthalmol Vis Sci. 1995;36:1818 –1827. 29. Nishida K, Kawasaki S, Adachi W, Kinoshita S. Apolipoprotein J expression in human ocular surface epithelium. Invest Ophthalmol Vis Sci. 1996;37:2285–2292. 30. Smolin G, Thoft R. The Cornea. 3rd ed. Little, Brown; 1994. 31. Haynes RJ, Tighe PJ, Dua HS. Antimicrobial defensin peptides of the human ocular surface. Br J Ophthalmol. 1999;83:737–741. 32. Yokoi K, Yokoi N, Kinoshita S. Impairment of ocular surface epithelium barrier function in patients with atopic dermatitis. Br J Ophthalmol. 1998;82:797– 800.