Journal of Horticultural Science & Biotechnology (2008) 83 (3) 323–327
Hybridisation between chocolate cosmos and yellow cosmos confirmed by phylogenetic analysis using plastid subtype identity (PSID) sequences By T. OKU, H. TAKAHASHI, F. YAGI, I. NAKAMURA* and M. MII Laboratory of Plant Cell Technology, Graduate School of Horticulture, Chiba University, Matsudo 648, Matsudo, Chiba 271-8510, Japan (e-mail:
[email protected]) (Accepted 9 January 2008) SUMMARY Chocolate cosmos has chocolate-coloured flowers with a scent of chocolate, and leaves like miniature dahlias. Chocolate cosmos is endangered in its native Mexico. It has been classified ambiguously as Cosmos atrosanguineus or Bidens atrosanguinea. We have resolved the phylogenetic relationship of chocolate cosmos among the genera Cosmos, Bidens and Dahlia by an analysis of plastid subtype identity (PSID) sequences. PSID sequences showed that chocolate cosmos has a closer relationship with Cosmos than with Bidens or Dahlia. Based on this finding, chocolate cosmos was open-pollinated with two Cosmos species, C. bipinnatus and C. sulphureus. We successfully produced a hybrid plant with C. sulphureus using embryo rescue. The hybrid plant showed an intermediate phenotype such as crimson-red flowers. Its hybrid nature was confirmed by DNA fingerprinting and flow cytometric analysis.
C
hocolate cosmos (Cosmos atrosanguineus) is a unique plant that usually has dark red or marooncoloured flowers with a strong scent of chocolate, and leaves resembling miniature dahlias (Sherff, 1932). The species is native to Mexico, where it has become extinct in the wild. Consequently, chocolate cosmos is ranked as a “first priority endangered species” in the flowering plants, and only one surviving clone has been vegetatively propagated for ornamental purposes. The Royal Botanical Gardens (Kew, London, UK) have been campaigning that its wild habitat should be restored in Mexico (Fay, 1993). However, seed propagation has not yet been achieved in this species due to its selfincompatible nature, which hinders recovery in its natural habitat. Moreover, inter-specific hybridisation of chocolate cosmos has not yet been reported, probably due to a lack of sound information on the taxonomy of this species. It has been classified ambiguously into the genus Cosmos, as C. atrosanguineus, or the genus Bidens, as B. atrosanguinea (Sherff, 1932; Hind and Fay, 2003), and its close relatives have not yet been clarified. This is because, whereas its floral shape is similar to that of other Cosmos species, it has a perennial character, producing rhizomes like Dahlia species. Another elusive point is that almost all species in the genus Cosmos are diploid (2n = 24), but chocolate cosmos has 48 chromosomes, equivalent to being tetraploid. In this report, we have used plastid DNA analysis to show that chocolate cosmos has a closer relationship with species of Cosmos than species of Bidens or Dahlia. Furthermore, chocolate cosmos (C. atrosanguineus) successfully produced a hybrid plant, with crimson-red flowers, by crossing it with C. sulphureus, having yellow flowers. *Author for correspondence.
MATERIALS AND METHODS Plant material Segments of rhizome of chocolate cosmos, and seed from C. bipinnatus, C. sulphureus, Dahlia pinnata, and Bidens frondosa (Table I) were planted in the field in April 2000. In early Summer, flowers of chocolate cosmos were open-pollinated with those of yellow cosmos (C. sulphureus) by random pollen dispersal between the two species in the field. As chocolate cosmos is strictly self-incompatible, it cannot produce selfed seeds, but we discovered a characteristic property of the Compositae (i.e., the stigmas of ligulate flowers turned down when they were fertilised). Eighteen swollen ovaries of flowers with such a fertilisation response were collected approx. 1 week after flowering. DNA extraction and amplification of two plastid sequences Total genomic DNA was isolated from fresh leaves by the CTAB method (Doyle and Doyle, 1987). Two plastid subtype identity (PSID) sequences of intergenic spacer regions between the rpl16 and rpl14 genes (PSID1; Nakamura et al. 1997), and between the atpF and atpA genes (PSID2) were amplified by PCR using two different pairs of primers, rpl5P-rpl3P and atp5P-atp3P, respectively (Figure 1). PCR amplification was performed with ExTaq DNA polymerase (Takara Co., Shiga, Japan) following the manufacturer’s instructions. TABLE I Plant material used in this study Common name Chocolate cosmos Cosmos Yellow cosmos Dahlia Bidens
Species Cosmos atrosanguineus Cosmos bipinnatus Cosmos sulphureus Dahlia pinnata Bidens frondosa
2n 48 24 24 64 48
324
Hybrid between chocolate and yellow cosmos
FIG. 1 Schematic representation of a plant plastid DNA showing the PSID1 and PSID2 regions. The relative locations of PSID1, PSID2, rbcL, matK, and inverted repeats are shown (Panel A). Sequencing strategy for the intergenic PSID1 (Panel B) of rpl16 – rpl14 and PSID2 (Panel C) of atpF – atpA amplified by PCR using two pairs of primers, rpl5P – rpl3P and of atp5P – atp3P, respectively. The sequences of the purified PCR products were determined by the direct sequencing with the same primers. rpl5P: 5’-AAAGATCTAGATTCCGTAAACAACATAGAGGAAG AA-3’, rpl3P: 5’-ACAGC AACAATAACGTCACCAATATGAGCATATCG-3’, atp5P: 5’-TTACGAGGAGCTC TAGGAACTCTGAATAGTTGTTTG-3’, atp3P: 5’-GCCATTACTTCATCAAGACCG TGAAT ACGAGCAATGCC-3’.
PCR was performed for 40 cycles of 94°C for 30 s denaturation, 55°C for 30 s annealing, and 72°C for 1 min elongation in a PTC200 thermocycler (MJ Research, Watertown, MA, USA). The amplified PCR products were checked by 1.2% (w/v) agarose gel electrophoresis, and then purified with the QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA). The purified PCR products were directly sequenced from both ends using the same primers as the initial amplification and an ABI310 DNA Automated Sequencer with the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster, CA, USA). Embryo rescue and plant regeneration The collected ovaries were surface-sterilised by soaking them in 70% (v/v) ethanol for 20 s, followed by 10 min in 1% (v/v) NaHClO3 with 0.01% (v/v) Tween 20, then rinsing them three-times in sterile water. Although 16
ovaries were found to be empty, two immature embryos were excised successfully from the ovaries on wet sterile filter paper and placed on 0.2% (w/v) gellan gumsolidified medium (Gelrite; Kelco, Division of Merck and Co. Inc., San Diego, CA, USA) containing 12 MS basal salts, pH 5.8 (Murashige and Skoog, 1962) supplemented with 20 g l–1 sucrose, 0.1 mg l–1 naphthaleneacetic acid (NAA), and 1.0 mg l–1 6-benzylamino purine (BA). One of the embryos germinated successfully in vitro and the regenerated plantlet was transferred to the same medium without any phytohormone to induce rooting. After rooting, the regenerated plant was grown in a greenhouse at Chiba University under natural light and temperature conditions. Measurement of nuclear DNA contents using flow cytometry The relative nuclear DNA contents of the parental
PSID1 (116 bp) and PSID2 (92 bp) are plastid DNA sequences in the intergenic spacers between rpl16 and rpl14, and between atpF and atpA, respectively. Underlines show the stop codon of the rpl16 and atpF genes. Numbers indicate the positions from the stop codon of the rpl16 or atpF gene, showing polymorphic sites between chocolate cosmos and related species. Dashes show indels (insertions or deletions).
TAGTCCTTCTACTTTAGTTTAGGCATTATTTTTGAT TTATTTGATTTATTTATATATATTTTGATTTTTCAA AAAAGAATTAAGAAATACTC TAAAAAAGAAATAGGCCTTAAAAATAGCGGGTGCAGTTTTCTT TTTTTGAACAAATAATATAATATTTCTTTTTTTCTTCGAACT TTTTATTGTAAAAAACAGATAAAAAAATGAT
C C C C A TAATA TAATA TAATA – – – – – T – T T G G G
C. atrosanguineus C. bipinnatus C. sulphureus D. pinnata B. frondosa PSID1/2 sequences* of Chocolate cosmos
*
C C C A C T T T C T
80
G T G T A
43–70 34
AGTTT AGTTT AGTTT – – C C C C G C C C T T – – – AA AA T T T T A C C C C A T T T G T
PSID 2
16–20 12 9 113–114 105 101 88 PSID 1 69 61–65 48–49 37 Species
TABLE II Variations in PSID1 and PSID2 sequences between chocolate cosmos and related species
28 bp 28 bp 28 bp 10 bp 18 bp
92
T. OKU, H. TAKAHASHI, F. YAGI, I. NAKAMURA and M. MII
325
plants and their hybrid were determined by flow cytometry using a PA flow cytometer (Partec GmbH, Münster, Germany) on isolated nuclei stained with 4’,6-diamidino-2phenylindole dihydrochloride (DAPI), according to the method of Mishiba et al. (2000). Approx. 0.25 cm2 of excised leaf segment from each plant was chopped finely in 200 µl Solution A (Plant High Resolution DNA Kit Type P; Partec GmbH). After incubating for a few minutes, 1 ml of DAPI staining solution [10 mM Tris-HCl, pH 7.5, containing 50 mM sodium citrate, 2 mM MgCl2, 1% (w/v) PVP K-30 (Wako Pure Chemicals Industry Ltd., Osaka, Japan), 0.1% (v/v) Triton X-100, and 2.5 mg l–1 DAPI] was added, to stain the nuclei.The mixture was filtered through a 40-µm pore size nylon mesh (PP40, Kyoshin Rikoh Inc., Tokyo, Japan) to remove the debris and subjected to flow cytometric analysis. DNA fingerprinting of the regenerated plant The hybrid nature of the plant regenerated from the immature embryo was checked by DNA amplification fingerprinting with arbitrary primers (RAPD; Williams et al., 1990 or ALPHA; Nakamura, 1990). Total genomic DNA was extracted from both parental plants, and the regenerated plant, by the CTAB method. PCR was carried out and each 25 µl reaction contained five arbitrary 12-mer primers (COMMONS primer: A11, A12, A16, A17, and A19; BEX Co. Tokyo, Japan). The PCR conditions were the same as described above, except 51°C was used for annealing. Electrophoresis of the amplified DNA fragments was conducted in a 1.2% (w/v) agarose gel using the TAE buffer system. Hind IIIdigested DNA was used as size markers. A plastid DNA fragment containing the PSID1 sequence in the regenerated plant was also amplified and its sequence was determined, as described above.
RESULTS AND DISCUSSION We used plastid subtype identity (PSID) sequence analysis of plastid DNA (Nakamura et al., 1997) to address the phylogenetic relationship of chocolate cosmos. Plastid DNA sequences between rpl16 and rpl14, and between atpF and atpA, were referred to as PSID1 and PSID2, respectively (Figure 1). The PSID1 and PSID2 sequences of chocolate cosmos, C. bipinnatus, C. sulphureus, B. frondosa, and D. pinnata were amplified by PCR and determined by direct DNA sequencing (Figure 1). As shown in Table II, the PSID1 sequence (116 bp) of chocolate cosmos was identical to that of C. bipinnatus, and differed from that of C. sulphureus at one base-substitution (37G). PSID2 (92 bp) of chocolate cosmos was the same as that of C. sulphureus, but differed from that of C. bipinnatus by one basesubstitution (34T). PSID1 and PSID2 of B. frondosa and D. pinnata differed from those of chocolate cosmos by having three insertion/deletion sites. These results suggest that chocolate cosmos is more closely related to C. sulphureus and C. bipinnatus than to species of Bidens and Dahlia. Crucially, we can conclude that chocolate cosmos (C. atrosanguinensis) is indeed a member of the genus Cosmos. Following these results, we made an inter-specific hybridisation between chocolate cosmos () with C. sulphureus (), which resulted in the swelling of some
326
Hybrid between chocolate and yellow cosmos TABLE III DNA content and PSID1 sequences of parental species and the hybrid plant Plant Chocolate comos Yellow cosmos Hybrid plant
DNA content* (pg cell–1)
37 (PSID1)†
1.64 0.71 1.11
T G T
* Barley (Hordeum vulgare) nuclei were used to caliburated DNA contents by flow cytometry. † As shown in Table II, the 37th nucleotide in the PSID1 sequences of chocolate cosmos and yellow cosmos T and G, respectively.
FIG. 2 Phenotypes of flowers (Panel A) and leaves (Panel B) in the parents and the hybrid plant. Right: chocolate cosmos, left: yellow cosmos, middle: hybrid plant.
ovaries in chocolate cosmos. Since these ovaries did not contain any fertile embryos at maturity, we cultured them to rescue the immature embryos on 12 MS
medium supplemented with BA and NAA. As a result, we obtained one regenerated plant, which grew vigorously in the field and subsequently produced crimson-red flowers between late August–November (Figure 2). The phenotypes of the flowers and leaves of the plant seemed to be intermediate between chocolate cosmos and C. sulphureus (Figure 2), but it had a tuberous root, like chocolate cosmos. By adopting PSID sequence analysis, chocolate cosmos was confirmed as the mother of the putative hybrid by the identity of PSID1 (Table III). The paternity of C. sulphureus was checked in the following two ways: (i) the DNA content of the putative hybrid (1.11 pg cell–1), measured by flow cytometry (Mishiba et al., 2000), was intermediate between chocolate cosmos (1.64 pg cell–1) and C. sulphureus (0.71 pg cell–1;Table III).And (ii), DNA fingerprinting (Williams et al., 1990; Nakamura, 1990) also revealed that the genetic material of C. sulphureus had been transmitted to the hybrid (Figure 3). According to these results, the hybrid nature of the plant obtained from the cross between chocolate cosmos and C. sulphureus was also confirmed by the DNA analyses. Chocolate cosmos and C. sulphureus originate from the high- and low-lands of central Mexico, respectively. Although chocolate cosmos is very sensitive to hot Summers and gray mould disease, the hybrid showed strong tolerance to these stresses. The hybrid plant obtained in this study will be useful, not only as a genetic resource to develop new cosmos varieties with new floral colours and stress tolerances, but also as research material to elucidate the origin of chocolate cosmos.
FIG. 3 Profiles of the hybrid plant by random DNA amplification fingerprinting. DNA fingerprints were produced using five 12-mer arbitrary primers (A11, A12, A16, A17, or A19). In each case, lane 1, chocolate cosmos; lane 2, hybrid plant; and lane 3, yellow cosmos. Arrows in the right and left directions indicate the bands specific to chocolate cosmos and yellow cosmos, respectively.
T. OKU, H. TAKAHASHI, F. YAGI, I. NAKAMURA and M. MII
327
REFERENCES DOYLE, J. J. and DOYLE, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin, 19, 11-15. FAY, M. (1993). SOS to return cosmos to Mexico. Plant Heritage, 3, 22. HIND, N. and FAY, M. F. (2003). Plate 461. Cosmos atrosanguineus Compositae. Curtis’s Botanical Magazine, 20, 40–48. MISHIBA, K., ANDO, T., MII, M., WATANABE, H., KOKUBUN, H., HASHIMOTO, G. and MARCHESI, E. (2000). Nuclear DNA content as an index character discriminating taxa in the genus Petunia sensu Jussieu (Solanaceae). Annals of Botany, 85, 665–673. MURASHIGE, T. and SKOOG, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, 15, 473–497.
NAKAMURA, I. (1990). New DNA fingerprinting procedure: Amplified fragment length polymorphism of hazy associations (ALPHA). Annual Report, National Institute of Genetics (Mishima, Japan). 41, 105–106. NAKAMURA, I., KAMEYA, N., KATO, Y., YAMANAKA, S-I., JOMORI, H. and SATO, Y-I. (1997). A proposal for identifying the short ID sequence which addresses the plastid subtype of higher plants. Breeding Science, 47, 385–388. SHERFF, E. E. (1932). Revision of the genus Cosmos (family Compositae). Field Museum Publication Botany, 8, 401–447. WILLIAMS, J. G. K., KUBELIK, A. R., LIVAK, K. J., RAFALSKI, J. A. and TINGEY, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, 18, 6531–6535.
