DEVELOPMENTAL DYNAMICS 237:3916 –3920, 2008
PATTERNS & PHENOTYPES
Identification and Expression Pattern of Zebrafish prox2 During Embryonic Development Anna Pistocchi, Silvia Bartesaghi, Franco Cotelli, and Luca Del Giacco*
Prox2, together with the previously isolated Prox1, is the vertebrate homolog of the Drosophila homeoboxcontaining gene prospero, the founder member of a family of transcription factors which have been shown to play critical roles in many developmental events. We have isolated a cDNA which encodes a putative protein that shares a high degree of homology with mammalian Prox1, Prox2, and zebrafish Prox1. Comparative genomic analysis revealed that this protein corresponds to the zebrafish Prox2 homolog being the gene syntenic with the chromosome region hosting mouse Prox2. Whole-mount in situ experiments demonstrated that prox2 is expressed, during zebrafish embryonic development, in defined structures of the central nervous system and the eye, as previously reported in mouse. Additionally, reverse transcriptasepolymerase chain reaction analysis disclosed prox2 expression in several adult organs. Finally, prox1 lossand gain-of-function assays have been carried out to search for regulative effects on prox2 expression. Developmental Dynamics 237:3916 –3920, 2008. © 2008 Wiley-Liss, Inc. Key words: prospero; homeodomain; prox1; prox2; zebrafish; whole-mount in situ hybridization; RT-PCR; embryonic development Accepted 3 October 2008
INTRODUCTION Homeodomain-containing proteins represent a class of transcription factors playing essential roles in the determination of cell fate and the establishment of the body plan during embryonic development (McGinnis and Krumlauf, 1992; Kenyon, 1994; Brunet et al., 2007). The prospero-related homeoproteins Prox1 and Prox2 are the vertebrate homologs of the Drosophila melanogaster homeodomain-containing protein Prospero. During embryonic development, prospero is expressed in neuronal precursors and determines the neuronal/glial fate of
sibling cells (Hirata et al., 1995; Spana and Doe, 1995). prospero/Prox high level of homology pinpoints possible functional conservation through evolution, suggesting Prox involvement in vertebrate cell fate determination. Two conserved Prospero domains, PD1 and PD2, are the unique feature of the Prox family. PD2, associated to the homeodomain (Ryter et al., 2002), is involved in the DNA binding activity as well as the regulation of the subcellular localization of the protein (Bi et al., 2003), whereas the function of PD1 is still unknown. Vertebrate Prox1 exerts a role in the differentiation of a variety of em-
bryonic tissue and organ, such as central nervous system (Lavado and Oliver, 2007; Pistocchi et al., 2008), lymphatic system (Wigle and Oliver, 1999; Wigle et al., 2002), lens (Wigle et al., 1999), and liver (Sosa-Pineda et al., 2000), among others. Less is known regarding the roles of Prox2 during vertebrate development. Phylogenetic analysis suggested that Prox2 is evolutionarily conserved in mouse, rat and human. Murine Prox2 expression has been detected in cranial ganglia during embryonic development and in postnatal adult eyes and testes (Nishijima and Ohtoshi, 2006). Interestingly, Prox2
Additional Supporting Information may be found in the online version of this article. Department of Biology, Universita` degli Studi di Milano, Milano, Italy *Correspondence to: Luca Del Giacco, Department of Biology, Universita` degli Studi di Milano, Via Celoria 26, 20133 Milano, Italy. E-mail:
[email protected] DOI 10.1002/dvdy.21798 Published online 26 November 2008 in Wiley InterScience (www.interscience.wiley.com).
© 2008 Wiley-Liss, Inc.
IDENTIFICATION AND EXPRESSION PATTERN OF ZEBRAFISH prox2 3917
Fig. 1. Nucleotide and deduced amino acid sequences of the zebrafish prox2 mRNA. Arrowheads show positions of introns. The asterisk indicates the stop codon at the end of the open reading frame (ORF). A dotted line marks the two partially overlapping AATAAATAAApolyadenylation sites. The wave and solid lines mark PD1 and PD2, respectively. The homeodomain is boxed. The sequence has been submitted to the GenBank/EMBL database under accession number EF517402.
knock-out mice showed no defects, suggesting that Prox2 is dispensable for retina organization and fertility (Nishijima and Ohtoshi, 2006). In the present study, we identified zebrafish prox2, and analyzed its expression in detail during early development by using reverse transcriptase-polymerase chain reaction (RTPCR) and whole-mount in situ hybridization (WISH) techniques. Additionally, by means of prox1 loss-offunction experiments, we demonstrated that prox2 transcription activity is not affected by Prox1.
plified by means of RT-PCR using forward and reverse primers spanning the regions of the presumptive start (ATG) and stop (TAA) codons, respectively. A rapid amplification of cDNA ends (RACE) approach allowed the isolation of the complete 3⬘-untranslated region (UTR), while the 5⬘UTR has been identified through blast searches performed on the GenBank expressed sequence tags (ESTs) database. The 2,435-bp cDNA sequence, encoding a putative protein of 582 amino acid residues, has been submitted to GenBank with the accession number EF517402 (Fig. 1). The protein is related to the prospero transcription factors family, being characterized by the atypical homeodomain and two prospero domains, PD1 and PD2 (Fig. 1), located to the N-terminus and C-terminus of the protein, respectively. The phylogenetic tree analysis revealed that the novel prospero-related protein might represent the ortholog of mammalian Prox2 (Fig. 2A). This evidence is supported by the conserved synteny between the chromosome 17 region hosting the gene (from now on designated as prox2), mouse (Fig. 2B), and human (data not shown) Prox2 loci. Zebrafish prox2 coding region is interrupted by three introns, and an additional one is located in the 5⬘UTR (Fig. 1), indicating that the structure of the gene has been evolutionarily conserved from zebrafish to mammals (see murine Prox2 gene ID 73422; Nishijima and Ohtoshi, 2006). The intron– exon structure of zebrafish prox2 is also identical to zebrafish, mouse, and human Prox1. Moreover, all the vertebrate Prox genes, as well as Drosophila prospero, contain the unusual U12-dependent intron located at the beginning of the homeobox (Tomarev et al., 1998; Fig. 2C).
RESULTS AND DISCUSSION prox2 cDNA Cloning and Gene Structure
Expression Pattern of Zebrafish prox2
Blast analysis of the ENSEMBL zebrafish assembly version 6 (Zv6) using zebrafish prox1 full-length cDNA returned two positive hits on chromosome 17, the first corresponding to the previously characterized prox1 gene (Glasgow and Tomarev, 1998), and the second mapping at chromosome location 48,031,746 – 48,058,263. The presumptive open reading frame has been am-
A detailed characterization of prox2 expression during embryogenesis and in adult organs has been performed by means of RT-PCR and WISH techniques. RT-PCR revealed the presence of prox2 transcript at all developmental stages analyzed, including the zygote, indicating that prox2 is also maternally expressed (Fig. 3A). Moreover, the entire set of adult organs investi-
3918 PISTOCCHI ET AL.
gated resulted positive for prox2 transcription (Fig. 3B). The spatial and temporal distribution of prox2 mRNA has been further examined through WISH standard protocols from the one- to two-cell stage to 48 hours post fertilization (hpf), with digoxigenin- and fluorescein-UTP-labeled probes (Thisse et al., 1993). To avoid cross-hybridization with prox1 transcript, the prox2-specific probe has been designed in the mRNA region encoding the N-terminus of the protein, which presents the lower level of identity with the sequence of the paralog prox1. According to RT-PCR results, WISH revealed a diffuse expression of prox2 from 1–2 cell throughout cleavage and epiboly stages (data not shown). During somitogenesis, better defined signals appeared at the level of the developing eye field and hindbrain region (Fig. 3C), where prox2 transcript localized in the fifth and sixth rhombomeres (Fig. 3D). Starting from 24 hpf prox2 mRNA was detectable in the lens (Fig. 3E,H). Histological sections performed on 24 and 36 hpf prox2-hybridized embryos showed the presence of the specific signal in all the cells of the developing lens (Fig. 3F,G), while at 48 and 72 hpf it became selectively retained in the layer of proliferating cells (Fig. 3I,J). In contrast to murine and zebrafish Prox1 (Tomarev et al., 1999; Dyer et al., 2003; Pistocchi et al., 2008), prox2 was never expressed in the nervous retina during zebrafish development. The 48 hpf stage marked the onset of prox2 expression in two bilateral clusters of cells located in the cranial ganglia region (Fig. 3K,L), according to double WISH with the ganglion marker neuroD (Korzh et al., 1998) (Fig. 3K, inset). Interestingly, previously reported data depicted strong Prox2 expression in the VIIth, IXth, and Xth ganglia in mouse embryos (Nishijima and Ohtoshi, 2006). To investigate zebrafish prox1/ prox2 possible functional interactions during development, prox2 transcript was examined by WISH in prox1 lossand gain-of-function injected embryos obtained as previously described (Pistocchi et al., 2008). From somitogenesis to 48 hpf, prox2 expression was not perturbed in injected embryos in comparison to control embryos at the same developmental stages (Supp. Fig. S1, which is available online). Al-
Fig. 2. Phylogenetic analysis and genomic organization of zebrafish prox2. A: Phylogenetic Neighbor-Joining (NJ) method tree reconstruction depicting the evolutionary relationships among members of the prospero-related proteins family. Bootstrap values, calculated from 1,000 replicate runs, are indicated at each branchpoint. B: Schematic representation of the synteny between zebrafish chromosome 17 region hosting prox2 and mouse Prox2 locus on chromosome 12. Dotted lines designate correspondent orthologs. Arrows indicate the orientation of the genes on the two chromosomes. Genes abbreviations: Prox2, prospero-related homeobox gene; Esrrb, estrogen related receptor, beta; Dlst, dihydrolipoamide S-succinyltransferase (E2 component of 2-oxoglutarate complex); HDCPA, hepatocellular carcinoma-down-regulated mitochondrial carrier homolog A; HDMCP, hepatocellular carcinoma down-regulated mitochondrial carrier homolog; Scl25a29, mitochondrial carnitine/acylcarnitine carrier protein CACL (Solute carrier family 25 member 29). C: Sequences of the exons–introns boundaries of the zebrafish prox2 gene. The unusual AT/AC splice sites characterize the intron 2 located at the 5⬘ end of the homeobox.
though further experiments will be needed to elucidate prox2 function in zebrafish, this work provides genetic evidence that prox1 is not necessary for prox2 expression. Overall, our studies have revealed that the expression of Prox2 during development is similar in zebrafish and mouse, particularly with respect
to lens and cranial ganglia, where the gene might exert important basic functions that have been conserved throughout evolution. Nevertheless, zebrafish prox2 transcript localizes in the fifth and sixth rhombomeres during somitogenesis, a pattern never reported in mouse. Additionally, as in mouse, prox2 is expressed in adult
IDENTIFICATION AND EXPRESSION PATTERN OF ZEBRAFISH prox2 3919
brain and testis, suggestive of common roles in the maintenance of cellular or regional specific identity of such organs.
EXPERIMENTAL PROCEDURES Fish and Embryos Maintenance Breeding wild-type fish of the AB strain were maintained at 28°C on a 14-hr light/10-hr dark cycle. Embryos were collected by natural spawning, staged according to Kimmel and colleagues (Kimmel et al., 1995), and raised at 28°C in fish water (Instant Ocean, 0.1% methylene blue) in Petri dishes. Embryos used in whole-mount in situ hybridization were raised in 0.003% PTU (Sigma) to prevent pigmentation. We express the embryonic ages in somites (s) and hours postfertilization (hpf).
prox2 Identification and cDNA Cloning
Fig. 3. prox2 temporal and spatial expression pattern analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) and whole-mount in situ hybridization (WISH). A: RT-PCR performed on different embryonic stages: DNA ladder (L), 1–2 cells (lane 1), 50% epiboly (lane 2), tail bud (lane 3), 5– 8 somites (lane 4), 24 hours post fertilization (hpf; lane 5), 48 hpf (lane 6), and negative control (lane 7) in the absence of cDNA. Arrowhead indicates the 199-bp prox2-specific seminested PCR product. B: RT-PCR performed on different adult organs: DNA ladder (L), testis (lane 1), ovary (lane 2), gills (lane 3), liver (lane 4), eye (lane 5), brain (lane 6), and negative control (lane 7) in the absence of cDNA. Arrowhead indicates the 199-bp prox2-specific seminested PCR product. C: Lateral view of a 5 somite (s) stage embryo, anterior to the left. prox2 signals appeared in the eye region (arrow) and in the hindbrain (arrowhead). D: Double staining of prox2 (blue) and krox20 (red) mRNAs at 5 s stage reveals that prox2 is expressed in the fifth and sixth rhombomeres. E,H: At 24 and 48 hpf prox2 mRNA was detectable only in the lens (arrows). F,G,I,J: Transverse sections through the forebrain of 24 and 36 hpf stage zebrafish embryos show the signal in the lens (arrowheads), while at 48 and 72 hpf, the signal is selectively retained in the layer of proliferating cells (arrows). K: The 48 hpf stage marked the onset of prox2 expression in bilateral clusters of cells located in the anterior cranial ganglia (arrowheads), as shown by the colocalization of the signal with the ganglion marker neuroD (arrowhead, inset). L: Transverse section through the forebrain of a 48 hpf stage embryo demonstrated that prox2 expression occurred in two distinct ganglia (arrowheads and asterisks). C,D,E,H: Lateral views are shown, anterior to the left. K: Dorsal view, anterior to the left. e, eye; r, rhombomeres. Scale bars ⫽ 100 m in C, 20 m in D, 200 m in E,H, 50 m in F,G,I,J,K,L.
Zebrafish chromosome 17 region spanning the prox2 gene was identified through in silico search of the ENSEMBL zebrafish assembly version 6 (Zv6) using zebrafish prox1 full-length cDNA as a bait. Three gene specific primers (prox2F: 5⬘-AAGATCAGCAGTTTACGGGC, prox2F1: 5⬘-CATGAATCTGAGTCCACCTG, and prox2R: 5⬘-TTACAGGTAGGAGGGAGACT) covering the presumptive start and stop codon regions have been designed and used to amplify the prox2 cDNA starting from reverse transcribed total RNA purified from 24 hpf embryos. RTPCR has been performed using prox2F and prox2R primers, then prox2F1 and prox2R oligonucleotides have been used for a seminested PCR. The 3⬘UTR have been obtained through RACE technique using four gene specific forward primers (prox2a: 5⬘-CACCAGCTCCAGCTCCAGCA, prox2b: 5⬘-CATATCGGTCAGCAGAGAGTC, prox2c: 5⬘CATGCACTACAACAAAGCCAAC, and prox2d: 5⬘-GCCGAAGTCACGCTTCAGGA), while the 5⬘UTR has been identified searching the GenBank ESTs database.
3920 PISTOCCHI ET AL.
Phylogenetic Analysis Phylogenetic analysis was carried out using MEGA version 4.1 (beta) software. Ten sequences were aligned using the ClustalW algorithm and the alignment was used for tree reconstruction using the Neighbor-Joining (NJ) method (see Fig. 2A for species names, abbreviations, gene names, and accession numbers of the sequences). Bootstrap values were inferred from 1,000 replicates.
RT-PCR Total RNA was isolated from zebrafish embryos at different developmental stages (from 2 cells to 48 hpf) or from zebrafish adult organs using Total RNA isolation kit (Ambion). Reverse transcription (RT) reaction was performed with AMV reverse transcriptase (Promega). prox2b and prox2R gene specific primers spanning intron 4 were used to amplify a 241-bp fragment by RT-PCR. prox2c and prox2R oligonucleotides were used for a seminested PCR to detect the 199-bp amplicon.
Whole-Mount In Situ Hybridization Whole-mount in situ hybridization (WISH), was carried out as described (Thisse et al., 1993) on embryos fixed for 2 hr in 4% paraformaldehyde/phosphate buffered saline, then rinsed with phosphate buffered saline (PBS) -Tween, dehydrated in 100% methanol and stored at ⫺20°C until processed for WISH (Jowett and Lettice, 1994). Digital images of all embryos were captured using digital camera (Leica). A 926-bp prox2 fragment (⫹59/⫹985 region) was cloned into pCR 2.1-TOPO vector. Plasmid was linearized by digestion with BamHI and XhoI and in vitro transcribed by T7 and SP6 RNA polymerases for sense and antisense RNA probes, respectively, in presence of modified nucleotides (i.e., digoxigenin, fluorescein, Roche). krox20 probe was synthesized
as described in Oxtoby and Jowett (1993) and neuroD probe was synthesized as described in Korzh and colleagues (1998). For histological sections, stained embryos were re-fixed in 4% paraformaldehyde, dehydrated and stored in methanol, wax embedded, and sectioned (5– 8 m).
Loss- and Gain-of-function Analysis For loss- and gain-of-function experiments, specific prox1 morpholino (MO) and capped RNA were synthesized and injected as previously described (Pistocchi et al., 2008).
ACKNOWLEDGMENTS This work was supported by grant from CARIPLO N.O.B.E.L. “Tumor Stem Cells”.
REFERENCES Bi X, Kajava AV, Jones T, Demidenko ZN, Mortin MA. 2003. The carboxy terminus of Prospero regulates its subcellular localization. Mol Cell Biol 23:1014 –1024. Brunet I, Di Nardo AA, Sonnier L, Beurdeley M, Prochiantz A. 2007. The topological role of homeoproteins in the developing central nervous system. Trends Neurosci 30:260 –267. Dyer MA, Livesey FJ, Cepko CL, Oliver G. 2003. Prox1 function controls progenitor cell proliferation and horizontal cell genesis in the mammalian retina. Nat Genet 34:53–58. Glasgow E, Tomarev SI. 1998. Restricted expression of the homeobox gene prox 1 in developing zebrafish. Mech Dev 76: 175–178. Hirata J, Nakagoshi H, Nabeshima Y, Matsuzaki F. 1995. Asymmetric segregation of the homeodomain protein Prospero during Drosophila development. Nature 377:627– 630. Jowett T, Lettice L. 1994. Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein- labelled probes. Trends Genet 10:73–74. Kenyon C. 1994. If birds can fly, why can’t we? Homeotic genes and evolution. Cell 78:175–180. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of
embryonic development of the zebrafish. Dev Dyn 203:253–310. Korzh V, Sleptsova I, Liao J, He J, Gong Z. 1998. Expression of zebrafish bHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev Dyn 213:92–104. Lavado A, Oliver G. 2007. Prox1 expression pattern in the developing and adult murine brain. Dev Dyn 236:518 –524. McGinnis W, Krumlauf R. 1992. Homeobox genes and axial patterning. Cell 68:283– 302. Nishijima I, Ohtoshi A. 2006. Characterization of a novel prospero-related homeobox gene, Prox2. Mol Genet Genomics 275:471– 478. Oxtoby E, Jowett T. 1993. Cloning of the zebrafish krox-20 gene (krx-20) e its expression during hindbrain development. Nucleic acids Res 21:1087–1095. Pistocchi A, Gaudenzi G, Carra S, Bresciani E, Del Giacco L, Cotelli F. 2008. Crucial role of zebrafish prox1 in hypothalamic catecholaminergic neurons development. BMC Dev Biol 8:27. Ryter JM, Doe CQ, Matthews BW. 2002. Structure of the DNA binding region of prospero reveals a novel homeo-prospero domain. Structure 10:1541–1549. Sosa-Pineda B, Wigle JT, Oliver G. 2000. Hepatocyte migration during liver development requires Prox1. Nat Genet 25: 254 –255. Spana EP, Doe CQ. 1995. The prospero transcription factor is asymmetrically localized to the cell cortex during neuroblast mitosis in Drosophila. Development 121:3187–3195. Thisse C, Thisse B, Schilling TF, Postlethwait JH. 1993. Structure of the zebrafish snail1 gene and its expression in wildtype, spadetail and no tail mutant embryos. Development 119:1203–1215. Tomarev SI, Zinovieva RD, Chang B, Hawes NL. 1998. Characterization of the mouse Prox1 gene. Biochem Biophys Res Commun 248:684 – 689. Tomarev SI, Sundin O, Banerjee-Basu S, Duncan MK, Yang JM, Piatigorsky J. 1999. Chicken homeobox gene Prox 1 related to Drosophila prospero is expressed in the developing lens and retina. Dev Dyn 206:354 –367. Wigle JT, Oliver G. 1999. Prox1 function is required for the development of the murine lymphatic system. Cell 98:769 –778. Wigle JT, Chowdhury K, Gruss P, Oliver G. 1999. Prox1 function is crucial for mouse lens-fibre elongation. Nat Genet 21:318 –332. Wigle JT, Harvey N, Detmar M, Lagutina I, Grosveld G, Gunn MD, Jackson DG, Oliver G. 2002. An essential role for Prox1 in the induction of the lymphatic endothelial cell phenotype. EMBO J 21: 1505–1513.
