identification of a naturally occurring bean common mosaic virus ...

Journal of Plant Pathology (2016), 98 (1), 129-133 Edizioni ETS Pisa, 2015 129

IDENTIFICATION OF A NATURALLY OCCURRING BEAN COMMON MOSAIC VIRUS RECOMBINANT ISOLATE INFECTING AZUKI BEAN Y. Li1†, Y. Cao2†, Z. Fan3 and P. Wan1 1 College

of Plant Science and Technology, Beijing University of Agriculture, Beijing ,China Crops Institute, Henan Academy of Agricultural Sciences, Zhengzhou, China 3 Department of Plant Pathology, China Agricultural University, Beijing, China † These authors contributed equally to this study

2 Cereal

SUMMARY

The near complete nucleotide sequence of Bean common mosaic virus (BCMV) infecting azuki bean from China was determined to be 10047 nucleotides in length excluding the 3'-terminal poly (A) sequence. The isolate was designated as BCMV-Az and caused stunting, mosaic and crumpling on leaves of azuki plants. It contains a large open reading frame (ORF) flanked by a 131 nt 5'-untranslated region (UTR) and a 253 nt 3'-UTR and the putative polyprotein encoded by this large ORF is comprised of 3220 amino acid residues. Phylogenetic analysis showed that BCMV-Az clustered with strains isolated from different hosts and geographic origins, suggesting that it is a novel strain. Recombination analyses indicated that it was a recombinant originating from isolates R (AJ312437) and US10 (KF919299). Key words: Bean common mosaic virus, recombinant, azuki bean

INTRODUCTION

Azuki bean, Vigna angularis Ohwi & Ohashi, is an important traditional grain legume and has considerable cultural importance in East Asia. It is cultivated mainly in Japan, Korea, and northern and central China (Xu et al., 2008). The cultivation area extends through southern China as far west as Nepal. Its annual production in China and Japan has been estimated as 800,000 metric tons (Han et al., 2005). Fungal and viral diseases are the main factors constraining the production of azuki bean (Wang et al., 2011; Kondo et al., 2004; Notsu et al., 2003). So far, Bean common mosaic virus (BCMV), Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV), Broad bean wilt Corresponding authors: Y. Li, P. Wan E-mail: [email protected], [email protected]

virus (BBWV) and Alfalfa mosaic virus (AMV) have been detected in azuki bean (Wang et al., 2011). Bean common mosaic virus (BCMV, genus Potyvirus) occurred nearly worldwide and historically has been responsible for serious yield losses in common bean (Phaseolus vulgaris L.). Different pathotypes of BCMV have been described according to their different combinations of pathogenicity genes (P0, P1, P12, P2, P22) and could be differentiated by their reactions on a set of different bean genotypes possessing combinations of recessive resistance gene (bc genes) and the dominant I gene. Based on these different pathotypes, multiple strains have been identiﬁed, such as NL1, NL4, NL6, NL7, NY15, PR1, RU1, and US1–US10 (Drijfhout, 1978; Morales, 1989). Accumulated serological evidence and phylogenetic studies have further demonstrated that some previously named potyvirus species, such as the Azuki bean mosaic virus, Blackeye cowpea mosaic virus and Peanut stripe virus, are all actually strains of BCMV (BCMV-AzM, BCMV-BICM and BCMV-PtS respectively) (Berger et al., 1997; Gibbs et al., 2008), thus revealing a relatively wide host range for this potyvirus species within legume crops. All known strains of BCMV are transmitted by several aphid species in a nonpersistent manner and are seedborne (Morales, 1989). Recombination appears to occur frequently in potyviruses (Chare and Holmes, 2006; Revers et al., 1996; Tomimura et al., 2004) and could affect the evolution of the BCMV population. A strain of Bean common mosaic necrosis virus (BCMNV) from Idaho which caused earlier and more severe symptoms on bean plants was found to be a recombinant between NL-3 D and RU1 of BCMV (Larsen et al., 2005). Previous analyses with 46 BCMV genomes showed 25 recombination events were identiﬁed with breakpoints distributed in different regions and 37 BCMV genomes were involved, indicating the relatively frequent recombination frequency in BCMV (Zhou et al., 2014). Recombination may result in biological changes shifting their pathotype specificity and alter the pathogenicity of BCMV. The isolate RU1M, a product of recombination, was able to induce severe whole plant necrosis below 30°C in bean cultivar Jubila that carries the I gene and a protective recessive gene bc-1, which was the first report of a BCMV isolate inducing temperature-insensitive

130

Natural recombinant isolate of BCMV

Journal of Plant Pathology (2016), 98 (1), 129-133

Table 1. Primers used in this study. Genomic position (nt)

Forward Primer

Reverse Primer

1-1747 1652-3512 3437-5235 5160-6780 6721-8920 8894-10047

AAATTAAAACAACTCATAAAGACAACAAAG TCTTTGAGCTGGGATGAGTATAGGC TCCTTTGTGAGCGAGTGCTTCACAAC CTGAATTCATAGCCACAGAAGCAGC TCACAAACATCTCAGATGGGCATTG TTTGATTATGAGATTGGGTGCGGAG

GATTTCTGAAGCTCTATGCCAGTAAG CACATGCGCGCAAAATTGAATCTTTC GTGGTGACTCCTTGTGTTGTGACAGG TGTATGAACCATAACCTATACCAA TCTCCGCACCCAATCTCATAATCA GGAACAACAAACATTGCCGTAGCTAC

necrosis in an I gene containing bean genotype (Feng et al., 2014a). In addition to help in narrowing down the genetic determinant responsible for the interaction between BCMV and the I gene, the isolate RU1M might also be helpful in narrowing down other genetic determinants of BCMV, i.e., responsible for interactions between BCMV and bc-2 and bc-22 alleles in beans. Inspection of the nucleotide sequences for BCMV RU1-OR and US10 (both pathotype VII) and three closely related sequences of BCMV (RU1-P, RU1-D, and RU1-W, all pathotype VI) revealed that RU1-OR originated through a series of recombination events between US10 and an as-yet-unidentified BCMV parental genome, resulting in changes in virus pathology (Feng et al., 2014b). A novel BCMV isolate 1755a that was able to overcome bc-2 and bc-3 alleles in common bean was found to be a recombinant between NL1, US1 (both PG-I), and a yet unknown BCMV strain (Feng et al., 2015), suggesting that the virus has evolved mechanisms to overcome multiple resistance genes available in common bean. In China, BCMV had been identified in asparagus bean (Vigna sesquipedalis) (Zheng et al., 2002), mungbean (Vigna radiata) (Cui et al., 2014) and soybean (Glycine max) (Zhou et al., 2014). Recently we isolated BCMV from azuki bean and sequenced the 3' portion of the genome (Li et al., 2014), which suggested that BCMV-Az was distinct from previously characterized isolates. In this study the near complete genome sequence of BCMV-Az was determined and sequence analyses showed it was a naturally occurring recombinant. MATERIALS AND METHODS

Plant materials. Leaves from diseased azuki bean plant with the symptom of mosaic and crumpling of leaves and stunting were collected from the experimental fields of the Beijing University of Agriculture, Changping District, Beijing, China. The presence of BCMV was confirmed by RTPCR and ELISA in our previous research (Li et al., 2014). RNA extraction and reverse transcription-polymerase chain reaction. Total RNA was extracted from 0.1 g leaf material with an RNAprep Pure Plant kit (TaKaRa, Dalian, China) according to the manufacturer’s instruction. Reverse transcription was performed at 42°C for 1 h using 1 μl of total RNA and 1 μl of oligo (dT) 18 primer (50 pmol/μl) in

a 20 μl reaction volume with Maloney murine leukaemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI) according to the manufacturer’s protocols. For the amplification of BCMV genome, primer sets (Table 1) were designed according to the nucleotide sequence of the three isolates (NL1, PV 0915 and MS1) which shared highest sequence identities with the CP and NIb region confirmed in our previous work (Li et al., 2014). Their targeted amplicons were overlapped, corresponding to the fragments nucleotides 1-1747, 1652-3512, 3437-5235, 5160-6780, 6721-8920 and 8894-10047. PCR reactions were performed in a 25 μl volume with reaction mixtures containing 2.5 μl of 10× PCR buffer, 3 μl of cDNA, 2 mM of each dNTP, 0.5 mM of each primer, one unit of LATaq DNA polymerase (TaKaRa, Dalian, China) and brought to volume with ddH 2O. The PCR reaction conditions were as follows: 94°C for 5 min, followed by 28 cycles of denaturation for 30 s at 94°C, annealing for 45 s at 56°C, extension for 2 min at 72°C, and a final extension for 10 min at 72°C. Cloning, sequencing and sequence analysis. The PCR products were gel-purified and ligated into pMD18-T vector (TaKaRa, Dalian, China). Three positive clones of each product were sequenced at Shanghai Sangon Biological Engineering & Technology and Service Co. Ltd, Shanghai, China. All the available genome sequences of BCMV strains in the GenBank database were downloaded (Table 2) and aligned with Clustal X program. Phylogenetic tree based on the genomic nucleotide sequence was performed by neighbor-joining (NJ) method using MEGA5 (Tamura et al., 2011) with the best model tested in this software and the confidence was estimated by 1000 bootstrap replicates. Recombination was detected with various recombination detection methods implemented in the software RDP4 (Martin et al., 2010) including the programs RDP, GENECONV, BOOTSCAN, MAXCHI, CHIMAERA, SISCAN and 3SEQ, performed with the default configuration, except that the options of linear sequence was selected. Only recombination events detected by at least five different methods were accepted. RESULTS AND DISCUSSION

The complete genome of BCMV-Az (GenBank accession number KP903372) is 10,047 nucleotides (nt) in


Li et al.

131

Table 2. Sequence information used in this study.

Host

GenBank acc. no.

Geographic origin

Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Soybean (Glycine max) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Common bean (Phaseolus vulgaris) Cowpea (Vigna unguiculata) Cowpea (Vigna unguiculata) Cowpea (Vigna unguiculata) Cudrania tricuspidata Mung bean (Vigna radiata) Purple bush-bean (Macroptilium atropurpureum) Hyacinth bean (Lablab purpureus) Peanut (Arachis hypogaea) Peanut (Arachis hypogaea) Peanut (Arachis hypogaea) Peanut (Arachis hypogaea) Yam bean (Pachyrhizus erosus)

KJ807799 KJ807800 KM051425 KJ807801 KM051426 KJ807802 KM051427 KM051428 KM051429 KM051430 KJ807803 KM051431 KJ807804 KJ807805 KJ807806 KJ807807 KJ807808 KJ807809 KJ807810 KJ807811 KJ807812 KJ807813 KJ807814 KJ807815 KJ807816 KJ807817 KJ807818 KJ807819 KJ807820 KJ807821 KC832501 AY112735 DQ666332 GQ219793 AY863025 HG792064 KF114860 KM023744 U19287 AY864314 KJ645793 KF919297 KF919298 KF919299 KF919300 AJ312438 AJ312437 AY575773 KM076650 KC832502 EU761198 KC478389 KF439722 AY968604 U34972 U05771 JN190431

China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Hubei China:Jiangsu China:Jiangsu China:Jiangsu China:Jiangsu China:Jiangsu China:Jiangsu China:Jiangsu China:Jiangsu China: Shandong USA:Florida Colombia USA Russian Germany India USA:Iowa USA:Michigan USA USA USA USA USA USA China:Zhejiang China:Zhejiang China:Taiwan South Korea China: Shandong Australia China:Shandong China:Shandong China:Taiwan USA USA Peru

Year of isolation

Isolate name

2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2011 NA 2006 2005 NA NA 2004 2011 NA NA 2011 2011 2011 NA NA 1998 1998 2004 2012 2011 2004 2011 2012 2004 1995 1995 2011

CD009 CD010 CD011 CD012 CD021 CD023 CD025 CD026 CD030 CD031 DXH005 DXH006 DXH008 DXH015 DXH016 DXH017 DXH020 DXH021 DXH023 DXH024 DXH025 PStV-JX014 HZZB007 HZZB011 HZZB012 NKY017 NKY019 NKY021 NKY022 CDXQ003 soybean NL1 NL4 RU1 RU-1 PV 0915 NL-1n NL1 NL-3 NL-3 K RU1M RU1-OR-B RU1-OR-C US10 RU1-P Y R Taiwan CT MB MS1 HB Laixi Ts NA blotch SR

NA: not known

length, excluding the poly(A) tail at the 3'-end. The 5' and 3' untranslated regions (UTR) consisted of 131 nt and 253 nt, respectively. A BLAST search in the GenBank database showed that the sequence of BCMV-Az shared

89%-93% nucleotide and amino acid sequence identities with the isolates NL1 (USA:Florida), NL-In, MS1 and NL1 (USA:Iowa). Phylogenetic tree constructed based on the entire genomic nucleotide sequences of different BCMV

132

Natural recombinant isolate of BCMV


Fig. 2. Diagram for the recombination breakpoints generated by at least five algorithms of the RDP4 program. The upper line showed the genome of BCMV and the lower concatenated long colored boxes represent BCMV-Az (the isolate designation is indicated above the box) and internal grey colored segments indicate recombinant regions (the beginning and ending breakpoints were also indicated); the major parent for the recombinant sequence is indicated below the isolate code (R), and the minor parent is indicated by short boxes.

Fig. 1. Neighbor-joining phylogenetic tree based on BCMV genome nucleotide sequence generated with MEGA 5 with 1000 bootstrap replicates. Nodes with bootstrap values below 70% were collapsed.

strains (Fig. 1) revealed that BCMV-Az clustered together with the strains isolated from different hosts (common bean, purple bush bean and Cudrania tricuspidata) and countries (USA, India, Germany, Australia and South Korea), indicating that BCMV-Az is distinct from other isolates from China. BCMV could be transmitted by seed and the long distance transport of BCMV-infected seeds could easily disperse this virus. The long distance transmission of BCMV may be associated with the fact that our isolate shared the highest sequence identities and clustered together with the isolates originating from different countries. BCMV strains differed in their pathogenicity and host cultivars infected. An earlier study (Vetten et al., 1992) revealed the BCMV-PStV strain PN isolated from soybean was able to infect 19 out of 27 tested soybean cultivars but only two out of nine tested peanut cultivars; while a BCMV-PStV strain isolated from peanut was able to infect all nine tested peanut cultivars but only infected

three out of 27 soybean cultivars, which demonstrated adaptive evolution of BCMV. Here we isolated a different BCMV strain from azuki bean and its pathogenicity in other plants such as soybean, common bean and peanut needs to be further investigated. By comparison with all of the BCMV genome sequences available in the GenBank database, BCMV-Az was confirmed to be a recombinant (The recombinant plot was listed in Fig. 2) originating from the cowpea isolate R (GenBank accession No. AJ312437, major parent) and common bean isolate US10 (GenBank accession No. KF919299, minor parent) by the programs RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan and 3Seq with the P-value of 5.123×10−13, 7.365×10−14, 4.837×10−7, 3.974×10−4, 2.723×10−6, 1.232×10−25 and 8.137×10−17 respectively, with the beginning breakpoint at the position 138 nt and ending breakpoint at the position 615 nt. The previously identified recombinant isolate RU1M could induce necrosis in Jubila, but neither of the parental sequences caused similar necrosis (Feng et al., 2014a), indicating that recombination enhanced the pathogenicity of BCMV and challenged the utility of resistance genes. BCMV-Az was also identified as a recombinant of the R isolate, which caused rugose and vein banding mosaic symptoms in cowpea but could not infect peanut (Zheng et al., 2002), and US10 isolate, which belonged to pathotype VII and exhibited the B serotype (Feng et al., 2014b), thus the unique pathogenicity of BCMV-Az which was different from the parental isolates needs to be further clarified. In our study the complete genome sequence of BCMV isolated from azuki bean was sequenced and the genome characterization was clarified. This isolate was a recombinant and potential new strain in China. BCMV is seed borne and efficiently transmitted by aphids in a nonpersistent manner, thus future large-scale studies will be essential to determine its biological characteristics and prevalence, pathogenicity in other hosts, screen for BCMV- resistant cultivars and shed light on the BCMV-azuki bean interactions.

Journal of Plant Pathology (2016), 98 (1), 129-133 ACKNOWLEDGEMENTS

This research was financially supported by the National Natural Science Foundation of China (Grant No.31401711) and The Comprehensive Reforming Project to promote talents training of BUA (BNRC&YX201415). REFERENCES Berger P., Wyatt S., Shiel P., Silbernagel M., Druffel K., Mink G., 1997. Phylogenetic analysis of the Potyviridae with emphasis on legume-infecting potyviruses. Archives of Virology 142: 1979-1999. Chare E., Holmes E., 2006. A phylogenetic survey of recombination frequency in plant RNA viruses. Archives of Virology 151: 933-946. Cui X.Y., Shen L., Yuan X.X., Gu H.P., Chen X., 2014. First report of Bean common mosaic virus infecting mungbean (Vigna radiata) in China. Plant Disease 98: 1590. Drijfhout E., 1978. Genetic interaction between Phaseolus vulgaris and Bean common mosaic virus with implications for strain identification and breeding for resistance. Versl. Landbouwkd. Onderz. 872: 1-89. Feng X., Poplawsky A.R., Karasev A.V., 2014a. A recombinant of Bean common mosaic virus induces temperature-insensitive necrosis in an I gene-bearing line of common bean. Phytopathology 104: 1251-1257. Feng X., Poplawsky A.R., Nikolaeva O.V., Myers J.R., Karasev A.V., 2014b. Recombinants of Bean common mosaic virus (BCMV) and genetic determinants of BCMV involved in overcoming resistance in common bean. Phytopathology 104: 786-793. Feng X., Myers J.R., Karasev A.V., 2015. A Bean common mosaic virus isolate exhibits a novel pathogenicity profile in common bean, overcoming the bc-3 resistance allele coding for the mutated eIF4E translation initiation factor. Phytopathology 105: 1487-1495. Gibbs A., Trueman J., Gibbs M., 2008. The Bean common mosaic virus lineage of potyviruses: where did it arise and when? Archives of Virology 153: 2177-2187. Han O.K., Kaga A., Isemura T., Wang X.W., Tomooka N., Vaughan D.A., 2005. A genetic linkage map for azuki bean [Vigna angularis (Willd.) Ohwi & Ohashi]. Theoretical and Applied Genetics 111: 1278-1287. Kondo N., Notsu A., Naito S., Fujita S., Shimada H., 2004. Distribution of Phytophthora vignae f. sp. Adzukicola races in Adzuki bean fields in Hokkaido, Japan. Plant Disease 88: 875-877. Larsen R.C., Miklas P.N., Druffel K., Wyatt S.D., 2005. NL-3K

Received July 8, 2015 Accepted November 23, 2015

Li et al.

133

strain is a stable and naturally occurring interspecific recombinant derived from Bean common mosaic necrosis virus and Bean common mosaic virus. Phytopathology 95: 1037-1042. Li Y.Q., Liu Z.P., Yang K., Li Y.S., Zhao B., Fan Z.F., Wan P., 2014. First report of Bean common mosaic virus infecting Adzuki bean (Vigna angularis) in China. Plant Disease 98: 1017. Martin D.P., Lemey P., Lott M., Moulton V., Posada D., Lefeuvre P., 2010. RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 26: 2462-2463. Morales F.J., 1989. Bean common mosaic virus: screening for disease resistance. Centro International de Agricultura Tropical (CIAT), Cali, Colombia. Notsu A., Kondo N., Fujita S., Murata K., Naito S., 2003. New race of Phytophthora vignae f. sp. Adzukicola, the causal agent of phytophthora stem rot of the Adzuki bean. Journal of General Plant Pathology 69: 39-41. Revers F., Le Gall O., Candresse T., Le Romancer M., Dunez J., 1996. Frequent occurrence of recombinant potyvirus isolates. Journal of General Virology 77: 1953-1965. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. Tomimura K., Špak J., Katis N., Jenner C.E., Walsh J.A., Gibbs A.J., Ohshima K., 2004. Comparisons of the genetic structure of populations of Turnip mosaic virus in West and East Eurasia. Virology 330: 408-423. Vetten H., Green S., Lesemann D.E., 1992. Characterization of Peanut stripe virus isolates from soybean in Taiwan. Journal of Phytopathology 135: 107-124. Wang Y., Tian J., Fan B.J., Liu C.Y., Cao Z.M., Zhang Z.X., Su Q.Z., 2011. Advances in the study of major diseases on adzuki bean. Acta Agriculturae Boreali-Sinica 26: S197-S201 (in Chinese). Xu H.X., Jing T., Tomooka T., Kaga A., Isemura T., Vaughan D.A., 2008. Genetic diversity of the azuki bean (Vigna angularis (Willd.) Ohwi& Ohashi) gene pool as assessed by SSR markers. Genome 51: 728-738. Zheng H.Y., Chen J., Chen J.P., Adams M.J., Hou M.S., 2002. Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5’-parts of their genomes. Archives of Virology 147: 1257-1262. Zhou G.C., Wu X.Y., Zhang Y.M., Wu P., Wu X.Z., Liu L.W., Wang Q., Hang Y.Y., Yang J.Y., Shao Z.Q., Wang B., Chen J.Q., 2014. A genomic survey of thirty soybean-infecting Bean common mosaic virus (BCMV) isolates from China pointed BCMV as a potential threat to soybean production. Virus Research 191: 125-133.