Hort. Environ. Biotechnol. 52(2):158-162. 2011. DOI 10.1007/s13580-011-0151-3
Research Report
Identification of S-allele Genotypes of Korean Apple Cultivars by Using Allele-specific Polymerase Chain Reaction 1
2
1
1
1
3,4*
Seong Heo , Sang Eun Han , Soon Il Kwon , Ji Hae Jun , Mok Jong Kim , and Hee Jae Lee 1 2
Apple Research Station, National Institute of Horticultural & Herbal Science, Gunwi 716-812, Korea Fruit Research Division, National Institute of Horticultural & Herbal Science, Suwon 440-706, Korea 3 Department of Horticultural Science, Seoul National University, Seoul 151-921, Korea 4 Research Institute for Agriculture & Life Sciences, Seoul National University, Seoul 151-921, Korea *Corresponding author:
[email protected]
Received July 21, 2010 / Accepted January 4, 2011 GKorean Society for Horticultural Science and Springer 2011
Abstract. By using allele-specific polymerase chain reaction, self-incompatibility (S)-genotypes of the Korean apple cultivars were analyzed to identify their self-incompatibility relationship. S-genotypes of the cultivars were determined as ‘Hongro’, ‘Saenara’, ‘Hongso’, and ‘Hongan’, S1S3; ‘Picnic’, S1S5; ‘Gamhong’, ‘Manbok’, ‘Hwarang’, ‘Yeohong’, ‘Danhong’, and ‘Hwayoung’, S1S9; ‘Seokwang’, S3S5; ‘Honggeum’ and ‘Greenball’, S3S7; ‘Sunhong’, ‘Seohong’, ‘Chukwang’, and ‘Hwahong’, S3S9; and ‘Summer Dream’, S7S9. These results will help to select compatible pollinizers and design apple orchards. Additional key words: fertilization, pollinizers, S-genotype, S-haplotype-specific F-box gene, S-RNase gene, self-incompatibility
=bhfcXiWh]cb Since most apple cultivars are self- and inter-incompatible between genetically related cultivars to refuse to be pollinated, accurate assignment of the cultivars to cross-compatible groups is crucial for the efficient fruit production and orchard management. Fruit set in apple trees is gametophytically controlled by self-incompatibility (S)-locus that presents an S-RNase gene expressing in the pistil and an S-haplotypespecific F-box gene in the pollen tube (Hegedüs, 2006). Haploid pollen is rejected when its S-haplotype is the same as either of the two S-haplotypes in the diploid pistil, but any other combinations are compatible. This mechanism prevents self-fertilization to protect the genetic diversity of apple species and influences fruit production and eventually orchard management (Donoso et al., 2009). S-genotype to a certain cultivar has been determined through manual pollinations. However, these processes are time- and labor-consuming, and sometimes the results are misleading due to environmental influences (Halász and Hegedüs, 2006). Microscopic monitoring of pollen tube growth, as an alternative method, to distinguish among compatible, semi-compatible, and incompatible crosses, has revealed 11 different S-alleles (labeled in S1 to S11) in apple with 14 diploid and 12 triploid cultivars (Hegedüs, 2006;
Kobel et al., 1939). First molecular approach for identifying S-genotype of apple cultivars was performed through two dimensional polyacrylamide gel electrophoresis analyses and defined six alleles, Sa-Sf in four diploid and three triploid cultivars (Sassa et al., 1994). Having ties with 11 alleles described by Kobel et al. (1939), Boškoviü and Tobutt (1999) revealed 14 putative S-RNases (S12-S25) by using non-equilibrium pH gel electrophoresis analyses. Overall 15 S-RNase encoding DNA fragments have been investigated using polymerase chain reaction (PCR) methods with S-allele-specific (AS) primers (Broothaerts, 2003; Janssens et al., 1995; van Nerum et al., 2001). Other S-alleles (Sg, Sh, Si, St, and Sz) have also been identified and sequenced in Japan where alphabetical annotation for S-alleles was used (Kitahara et al., 2000; Matsumoto and Kitahara, 2000). Since then, S-genotypes in apple have been identified and revealed through diverse methods, and modified and renumbered by many researchers (Broothaerts, 2003; Broothaerts et al., 2004; Matsumoto and Kitahara, 2000; van Nerum et al., 2001). Mostly, PCR methods using primers based on the sequence characteristics of S-RNase genes have been used. For example, PCR-restriction fragment length polymorphism (RFLP) has been utilized until now due to its reliability (Kim et al., 2009; Long et al., 2010). However, it requires digestion of restriction endonucleases and con-
Hort. Environ. Biotechnol. 52(2):158-162. 2011.
siderable costs. To overcome these problems, the PCR method using S-AS primers has been proposed (Janssens et al., 1995). The AS-PCR method is more convenient for obtaining the results, and requires less time and cost in comparison with the PCR-RFLP. S-alleles of many apple cultivars have been detected with the AS-PCR method (Broothaerts, 2003; Janssens et al., 1995; van Nerum et al., 2001; Verdoodt et al., 1998). In the present study, the S-genotypes of 19 Korean apple cultivars including newly released cultivars, ‘Picnic’, ‘Yeohong’, ‘Danhong’, ‘Hwayoung’, and ‘Greenball’, and widespread ‘Fuji’ released from Japan as an obvious control for Sgenotype, were identified by using S-AS-PCR.
AUhYf]U`g UbX AYh\cXg D`Ubh AUhYf]U` Korean apple cultivars and the widely grown ‘Fuji’ were used in this study. Their leaves were harvested during the growing season at the Apple Research Station, Gunwi, Korea. The parentage of the twenty cultivars and their S-genotypes were presented in Table 1.
159
8B5 9lhfUWh]cb For extracting genomic DNA, dried leaves in liquid N2 were pulverized in a Tissuelyzer apparatus (Qiagen, Hilden, Germany), using DNeasy Plant Mini Kit (Qiagen) according to manufacturer’s instruction. The isolated DNA was qualified on agarose gel and quantified by using a fluorometer (model TD360, Turner, Sunnyvale, CA, USA). The DNA samples were stored at -20.
G!5G!D7F 5bU`mg]g S-AS-PCR amplification was performed using the primers (Table 2) in a thermal cycler (model PTC-100, MJ Research, Waltham, MA, USA) according to the conditions described by Broothaerts (2003) and Long et al. (2010). The thermal cycler program was 1 min at 94, 30 cycles of 30 s at 94, 30 s at 63, and 1 min at 72, and finally 7 min at 72, followed by cooling to 4. The basic reaction mixture contained 1 × PCR buffer (Promega, Madison, WI, USA), 1.75 mM MgCl2, 200 쩋M dNTPs, 1 쩋M of each primer, 0.6 U of Taq DNA polymerase (Promega), and roughly 100 ng of genomic DNA template in 20 쩋L total volume. The annealing temperatures of the S-AS primers were slightly modified (Long et al., 2010). The PCR mixtures were run on
Table 1. S-genotypes and cross-incompatibility groups of twenty apple cultivars used in this study. No.
z
z
Parentage and their S-genotype
Cultivar
1
Hongro (S1S3)
Spur Earliblaze (S1S19) × Spur Golden Delicious (S2S3)
2
Seokwang (S3S5)
Mollie’s Delicious (S3S7) × Gala (S2S5)
3
Chukwang (S3S9)
Fuji (S1S9) × Mollie’s Delicious (S3S7)
4
Saenara (S1S3)
Spur Earliblaze (S1S19) × Spur Golden Delicious (S2S3)
5
Gamhongy (S1S9)
Spur Earliblaze (S1S19) × Spur Golden Delicious (S2S3)
6
Hwahong (S3S9)
Fuji (S1S9) × Sekaiichi (S3S9)
7
Sunhong (S3S9)
Hongro (S1S3) × Chukwang (S3S9)
8
Seohong (S3S9)
Tsugaru (S3S7) × Chukwang (S3S9)
9
Summer Dream (S7S9)
Tsugaru (S3S7) × Natsumidori (S3S9)
10
Honggeum (S3S7)
Senshu (S1S7) × Hongro (S1S3)
11
Manbok (S1S9)
Earliblaze (S1S19) × Fuji (S1S9)
12
Hongso (S1S3)
Yoko (S3S9) × Hongro (S1S3)
y
13
Hongan (S1S3)
Fuji (S1S9) × Jonathan (S7S9)
14
Picnic (S1S5)
Fuji (S1S9) × Sansa (S5S7)
15
Yeohong (S1S9)
Fuji (S1S9) × Jonathan (S7S9)
16
Danhong (S1S9)
Sport of Fuji
17
Hwayoung (S1S9)
Sport of Fuji
18
Greenball (S3S7)
Golden Delicious × Fuji (S1S9)
19
Hwarang (S1S9)
Sport of Fuji
20
x Fuji (S1S9)
Ralls Janet (S1S2) × Delicious (S9S28)
Parentage and their S-genotypes were reported by Broothaerts et al. (2004). Reported parentage conflicts with the S-genotype of cultivars from our results. x Late-maturing cultivars released from Department of Apple Research, National Institute of Fruit Tree Science, Japan in 1962. y
Seong Heo, Sang Eun Han, Soon Il Kwon, Ji Hae Jun, Mok Jong Kim, and Hee Jae Lee
160
Table 2. S-AS primers and their sequences. S-Allele S1 S2 S3 S4 S5 S7 S9 S10 S11 S19 S20 S21 S23 S24 S26 S31
Primer
Sequence (5’3’)
Reference
MdS1SpF
TGTAAGGCACCGCCATATCATAC
MdS1SpR
CAACCTCAACCAATTCAGTCAATGA
Long et al. (2010)
MdS2SpF
AACATGAATCGAAGTGAATTATTTA
MdS2SpR
TTGAGGTTTGGTTCCTTACCATG
MdS3SpF
GGCGAAAATTAAACCGGAGAAGAA
MdS3SpR
CCTCTCGTCCTATATATGGAAATCAC
MdS4SpF
ATTGCAAGACAAGGAATCGTCGGAA
MdS4SpR
AGAAATGTGCTCTGTTTTTATCG
FTC10
CAAACATGGCACCTGTGGGTCTCC
FTC11
TAATAATGGATATCATTGGTAGG
MdS7SpF
AGTAAATCAACCGTGGATGCTCAG
Long et al. (2010)
MdS7SpR
TTACAATATCTACCTGTTTCCTGGG
MdS9SpF
CCACTTTAATCCTACTCCTTGTAGA
MdS9SpR
TCAATTTCCTTCTGTGTCCTGAATT
FTC12
CCAAACGTACTCAATCGAAG
Broothaerts (2003)
MdS10SpR
TCCCGTGTCCTGAATCTCCC
Long et al. (2010)
MdS11SpF
AAATATTGCAAGGCGCCGC
MdS11SpR
TTTCAATATCTACCAGTCTCCGGC
MdS19SpF
GCCTTCAAACAAGAATGGACC
Broothaerts (2003)
MdS19SpR
TCAATATCCACCAATGACCTGTT
MdS20SpF
GTTGTGGCCTTCAGACTCG
MdS20SpR
GGCCAACTACTTTTATTTTTCATC
MdS21SpF
AAGTAATTGCCCGATAAGGAACATA
MdS21SpR
AGTTTATGAAATGTTCTCCGCTGTA
MdS23SpF
AAGAATACAACCATTACGCCTCAGC
MdS23SpR
ATTGTTGGTACTAATGCTTATGGCG
MdS24SpF
ATGGCTCCTGTGCGTCTTCCC
MdS24SpR
CGTCATCCGTGTATAGGGCAACT
MdS26SpF
TCCATCAAACGTGACTTCTCAT
MdS26SpR
ATCCTTCAGCATCCTGATTCG
MdS31SpF
TGACCCAAAATATTGCAAGGCGC
MdS31SpR
TTTCAATATCTACCAGTCTCCGGC
1.5% agarose gel with 100 bp DNA ladder (Bioneer, Daejeon, Korea) and DNA bands were stained with ethidium bromide.
FYgi`hg UbX 8]gWigg]cb The S-genotypes of eight Korean cultivars, ‘Hongro’, ‘Gamhong’, ‘Saenara’, ‘Chukwang’, ‘Hwahong’, ‘Seokwang’, ‘Sunhong’, and ‘Hwarang’, were first reported by Kim et al. (2006) using PCR amplification with consensus primers and Southern blot analysis. Since the PCR results could not differentiate between S3 and S5 allele or among S2, S7, S9, and S19, however, Southern blot analysis was required to confirm the amplified fragments with S-RNase PCR products.
Furthermore, Kim et al. (2009) developed cleaved amplified polymorphic sequences (CAPS) marker system to identify the false-negative/positive problems. This technique has several difficulties with designing primer pairs that can amplify hypervariable intron region simultaneously and equally and with selecting restriction enzymes to detect specific regions. However, the CAPS system reached the same conclusion as the AS-PCR method, since the order of S-alleles was based on that established by Broothaerts (2003). Using 16 primer sets, two S-RNase fragments were observed from each of the 20 cultivars including newly released cultivars, ‘Picnic’, ‘Yeohong’, ‘Danhong’, ‘Hwayoung’, and ‘Greenball’. To ensure that the primer pairs are specific to each S-allele,
Hort. Environ. Biotechnol. 52(2):158-162. 2011.
S-genotypes of the cultivars were analyzed through independent PCR reactions (Broothaerts, 2003; Long et al., 2010). The PCR analysis revealed that all cultivars carrying S1allele amplified a specific band of 734 bp using the primer pairs of MdS1SpF and MdS1SpR (Fig. 1A). They included ‘Fuji’, ‘Saenara’, ‘Hongro’, ‘Hwarang’, ‘Gamhong’, ‘Hongso’, ‘Hongan’, and ‘Manbok’, and newly released cultivars of ‘Picnic’, ‘Yeohong’, ‘Danhong’, and ‘Hwayoung’ (Fig. 1A). In the case of S3 allele, the PCR product was obtained with ‘Hongro’, ‘Seokwang’, ‘Sunhong’, ‘Seohong’, ‘Honggeum’, ‘Saenara’, ‘Hwahong’, ‘Chukwang’, ‘Hongso’, ‘Hongan’, and ‘Greenball’ (Fig. 1B). The S5 AS primers designed by Long et al. (2010) were not amplified. With the primers designed by Broothaerts (2003), however, the presence of the S5-allele was confirmed in the cultivars of ‘Seokwang’ and ‘Picnic’ (Fig. 1C). These results might be due to the single nucleotide polymorphism in the sequences of cultivars having S5-allele or employing erroneous annealing temperatures by Long et al. (2010). By AS-PCR, the S7-allele was successfully detected in only three cultivars of ‘Honggeum’, ‘Summer Dream’, and ‘Greenball’ (Fig. 1D). The presence of the S9- allele was confirmed in ‘Sunhong’, ‘Seohong’, ‘Gamhong’, ‘Chukwang’, ‘Hwahong’, ‘Summer Dream’, ‘Fuji’, ‘Hwarang’, and ‘Manbok’, and newly released ‘Yeohong’, ‘Danhong’, and ‘Hwayoung’ (Fig. 1E). However, S2, S4, S10, S11, S19, S20, S21, S23, S24, S26, and S31 alleles were not detected in the 20 cultivars examined (data not shown). These results revealed that S-genotype of ‘Gamhong’ (S1S9) was not originated from the cross between ‘Spur Earliblaze’ (S1S19) and ‘Spur Golden Delicious’ (S2S3). Presumably, it resulted from the other pollens like ‘Fuji’ (S1S9) or other cultivars having S9 allele which was used in 1981 when the cross combination was pollinated during breeding program in Korea, or from open pollination with unknown pollen parents. In addition, ‘Hongan’ was genotyped as S1S3, but its parents ‘Fuji’ (S1S9) and ‘Jonathan’ (S7S9) did not possess the S3 allele. With the Korean apple cultivars as well as their parents, further experiments with simple sequence repeat markers are required to determine their paternal parents in the near future. Apples are fully compatible when both of their S-loci differ from other cultivars and semi-compatible when they carry one different and one identical S-locus. If two cultivars have the same S-alleles or one cultivar is selfed, however, there is little or no fruit set. For instance, ‘Fuji’ (S1S9) selfing, ‘Fuji’ × ‘Gamhong’ (S1S9), and their reciprocal cross did not result in fruit set (data not shown). Furthermore, no significant difference was observed in fertilization between semi-compatible and fully compatible apple cultivars according to our previous results. Fruit set in semicompatible crosses might be lower than in fully compatible crosses (Sapir et al., 2008). However, no difference was
161
found between the semi- and fully compatible cultivars in the case of performing manual pollination, since fruit set should be higher with hand pollination than in open pollination from pollenizers such as crabapples. In Korea, most apple growers have performed hand pollination to increase fruit set and seed numbers and finally to increase fruit marketability.
Fig. 1. Electrophoretic separation of S-RNase fragments for the S-alleles (A, S1; B, S3; C, S5; D, S7; and E, S9) in 20 apple cultivars. M, molecular size marker; Lanes 1, ‘Hongro’; 2, ‘Seokwang’; 3, ‘Chukwang’; 4, ‘Saenara’; 5, ‘Gamhong’; 6, ‘Hwahong’; 7, ‘Sunhong’; 8, ‘Seohong’; 9, ‘Summer Dream’; 10, ‘Honggeum’; 11, ‘Manbok’; 12, ‘Hongso’; 13, ‘Hongan’; 14, ‘Hwarang’; 15, ‘Yeohong’; 16, ‘Danhong’; 17, ‘Hwayoung’; 18, ‘Greenball’; 19, ‘Picnic’; 20, ‘Fuji’. According to the primer pairs, the lengths of amplified S-RNase fragments were S1, 734 bp; S3, 292 bp; S5, 1,380 bp; S7, 397 bp; and S9, 522 bp. S2, S4, S10, S11, S19, S20, S21, S23, S24, S26, and S31 alleles were not detected in these cultivars (data not shown).
Seong Heo, Sang Eun Han, Soon Il Kwon, Ji Hae Jun, Mok Jong Kim, and Hee Jae Lee
162
Table 3. S-Genotypes of Korean apple cultivars determined by AS-PCR. S-Genotype
Cultivar
S1S3
Hongro, Saenara, Hongso, Hongan
S1S5
Picnic
S1S9
Gamhong, Manbok, Hwarang, Yeohong, Danhong, Hwayoung
S3S5
Seokwang
S3S7
Honggeum, Greenball
S3S9
Chukwang, Hwahong, Sunhong, Seohong
S7S9
Summer Dream
12
Frequency (No. of cultivars)
10
8
6
4
2
0
S1
S2
S3
S4
S5
S7
S9
Fig. 2. The frequency of S-alleles in 19 Korean apple cultivars.
The information of S-genotypes is critical to avoid crossincompatibility for apple growers and breeders. However, only five S-alleles (S1, S3, S5, S7, and S9) were found to be common in the Korean cultivars (Fig. 2 and Table 3). These results might be due to the fact that successful cultivars, such as ‘Golden Delicious’ (S2S3), ‘Tsugaru’ (S3S7), and ‘Fuji’ (S1S9), have widely been used as parents in planned breeding program in Korea. Various cultivars having non-redundant S-alleles are needed to be included in the apple breeding program, since most S-genotypes of Korean cultivars belong to prevalent S1, S3, and S9 alleles.
@]hYfUhifY 7]hYX Boškoviü, R. and K.R. Tobutt. 1999. Correlation of stylar ribonuclease isoenzymes with incompatibility alleles in apple. Euphytica 107:29-43. Broothaerts, W. 2003. New findings in apple S-genotype analysis resolve previous confusion and request the re-numbering of some S-allele. Theor. Appl. Genet. 106:703-714. Broothaerts, W., I. van Nerum, and J. Keulemans. 2004. Update on and review of the incompatibility (S-) genotypes of apple cultivars. HortScience 39:943-947. Donoso, J.M., D. Aros, C. Meneses, and R. Infante. 2009. Identification of S-alleles associated with self-incompatibility in apricots (Prunus
armeniaca L.) using molecular markers. J. Food Agr. Environ. 7: 270-273. Halász, J. and A. Hegedüs. 2006. A critical evaluation of methods used for S-genotyping: from trees to DNA level. Intl. J. Hort. Sci. 12:19-29. Hegedüs, A. 2006. Review of the self-incompatibility in apple (Malus × domestica Borkh., syn.: Malus pumila Mill.). Intl. J. Hort. Sci. 12:31-36. Janssens, G.A., I.J. Goderis, W.F. Broekaert, and W. Broothaerts. 1995. A molecular method for S-allele identification in apple based on allele-specific PCR. Theor. Appl. Genet. 91:691-698. Kim, H.T., G. Hattori, Y. Hirata, D.I. Kim, J.H. Hwang, Y.U. Shin, and I.S. Nou. 2006. Determination of self-incompatibility genotypes of Korean apple cultivars based on S-RNase PCR. J. Plant Biol. 49:448-454. Kim, H.T., H. Kakui, N. Kotoda, Y. Hirata, T. Koba, and H. Sassa. 2009. Determination of partial genomic sequences and development of a CAPS system of the S-RNase gene for the identification of 22 S haplotypes of apple (Malus × domestica Borkh.). Mol. Breed. 23:463-472. Kitahara, K., J. Soejima, H. Komatsu, H. Fukui, and S. Matsumoto. 2000. Complete sequences of the S-gene ‘Sd-’ and ‘Sh-RNase’ cDNA in apple. HortScience 35:712-715. Kobel, F., P. Steinegger, and J. Anliker. 1939. Weitere Untersuchungen uber die Befruchtungsverhaltnisse der Apfel- und Birnsorten. Landw jb Schweiz. 53:160-191. Long, S., M. Li, Z. Han, K. Wang, and T. Li. 2010. Characterization of three new S-alleles and development of an S-allele-specific PCR system for rapidly identifying the S-genotype in apple cultivars. Tree Genet. Genom. 6:161-168. Matsumoto, S. and K. Kitahara. 2000. Discovery of a new selfincompatibility allele in apple. HortScience 35:1329-1332. Sapir, G., R.A. Stern, S. Shafir, and M. Goldway. 2008. S-RNase based S-genotyping of Japanese plum (Prunus salicina Lindl.) and its implication on the assortment of cultivar-couples in the orchard. Sci. Hort. 118:8-13. Sassa, H., N. Mase, H. Hirano, and H. Ikehashi. 1994. Identification of self-incompatibility related glycoproteins in styles of apple (Malus × domestica). Theor. Appl. Genet. 89:201-205. van Nerum, I., M. Geerts, A. van Haute, J. Keulemans, and W. Broothaerts. 2001. Re-examination of the self-incompatibility genotype of apple cultivars containing putative ‘new’ S-alleles. Theor. Appl. Genet. 103:584-591. Verdoodt, L., A. van Haute, I.J. Goderis, K. de Witte, J. Keulemans, and W. Broothaerts. 1998. Use of the multi-allelic self-incompatibility gene in apple to assess homozygosity in shoots obtained through haploid induction. Theor. Appl. Genet. 96:294-300.
