Ann Microbiol (2012) 62:533–537 DOI 10.1007/s13213-011-0287-5
ORIGINAL ARICLE
Identification of two flagellar genes required for biofilm formation in a Salmonella enterica serovar Typhimurium Mohamed Elhadidy & Ekbal Abo Hashem
Received: 11 March 2011 / Accepted: 19 May 2011 / Published online: 2 June 2011 # Springer-Verlag and the University of Milan 2011
Abstract Biofilm plays an important role in pathogenicity of Salmonella enterica serovar Typhimurium. To understand the molecular mechanism of biofilm formation by S. Typhimurium, a library of random mutagenized clones was constructed using the commercial Tn5 transposon EZ::TN™ < KAN-2 > Tnp Transposome™ (Epicentre). This library was screened for phenotypic analyses of their ability to form biofilm and 5 mutants were confirmed to be biofilm deficient. From these mutants, the insertion site flanking sequences were amplified by inverse PCR followed by sequencing. Three mutants had a transposon insertion in flgA gene encoding for flagellar basal body P-ring biosynthesis protein that is required for assembly of the flagellar basal body P-ring. Two mutants had a transposon insertion in the FlgB gene encoding for flagellar component of cellproximal portion of basal-body rod. These mutants were non-motile as confirmed by MSRV and transmission electron microscope suggesting that motility was necessary for biofilm development in S. Typhimurium. Keywords Transposome . Mutation . Biofilm . Motility . Flagella Abbreviations IPCR Inverse PCR SEM Scanning electron microscope
M. Elhadidy (*) Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt e-mail:
[email protected] E. Abo Hashem Department of Clinical Pathology, Faculty of Medicine, Mansoura University, Mansoura 35516, Egypt
TEM MSRV
Transmission electron microscope Modified Semi-solid Rappaport Vassiliadis
Introduction Bacterial biofilms are a major concern in human and veterinary medicine. Biofilms are defined as microbially derived sessile communities characterized by cells that are attached to a substratum, to an interface, or to each other. Biofilm cells are embedded in a matrix of extracellular polymeric substances (EPS) that they have produced and exhibit an altered phenotype with respect to growth rate and gene transcription (Donlan and Costerton 2002). This matrix provides a very stable environment and results in high levels of resistance to antimicrobial agents and immune evasion, leading to multidrug resistance and therapeutic failure. Such resistance is demonstrated not only towards antibiotics and antiseptics but also towards highly reactive chemicals, including isothiazolones, halogens, and quaternary ammonium compounds (Gilbert et al. 2002). This resistance can lead to a variety of economic and health problems. It has been reported by the National Institutes of Health that more than 60% of all microbial infections are caused by biofilms (Lewis 2001). Different serovars of Salmonella have long been recognized as major causes of infections to humans and animals causing a variety of clinical manifestations ranging from mild gastroenteritis to severe sepsis (D’Aoust 1991). There are ∼2,500 serovars of Salmonella enterica with varying host ranges and disease manifestations. Salmonella enterica serovar Typhimurium is one of the most common serovars associated with human and animal gastroenteritis. Within animal hosts, S. Typhimurium actively invades the intestinal epithelial layer preferentially
534
at the Peyer’s patches. Salmonella form biofilms on both biotic and abiotic surfaces. Biofilm formation plays an important role in the attachment and colonization of S. Typhimurium onto surfaces of environments and epithelial cells (Ledeboer and Jones 2005). Main contributors to biofilm formation by this serovar are flagella, curli (thin aggregative fimbriae), exopolysaccharide, and cellulose (de Rezende et al. 2005; Kim and Wei 2009; Qin and Mann 2006; Solomon et al. 2005). Salmonella Typhimurium strains have shown interstrain variation in their capabilities in forming biofilm (Kim and Wei 2007). However, little is known about the molecular functional characterization of the genes regulating biofilm formation and the development of these complex bacterial communities in S. Typhimurium. The objective of this study was to characterize the molecular mechanisms of biofilm formation by S. Typhimurium through generation of biofilmdeficient mutants using the EZ::TN™ < KAN-2 > Tnp Transposome™ (Epicentre) and identifying the associated genes by inverse PCR (IPCR) followed by sequencing.
Ann Microbiol (2012) 62:533–537
fresh LB medium and 125 μl were dispensed in triplicate to 96-well, polyvinyl chloride (PVC) microtiter wells (Beckman Coulter, Fullerton, CA, USA). The plates were incubated aerobically for 24 h at 35°C. Wells were stained with 100 μl of 0.25% crystal violet for 30 min at room temperature. The stain was discarded, and the plate was rinsed five times in standing water and allowed to dry. Stained biofilm was solubilized with 200 μl of 95% ethanol for 10 min and read according to the optical density at 570 nm. The negative control wells contained broth only. For preliminary motility detection, the biofilm-deficient mutants with the wild-type strain were screened for motility using Modified Semi-solid Rappaport Vassiliadis (MSRV) as previously described (DeSmedt and Bolderdijk 1987). Briefly, bacteria were incubated in Buffered Peptone Water at 16–20 h at 42°C and 3 drops of the pre-enrichment culture were incubated in three different spots on the surface of the MSRV medium plates (Oxoid, Lenexa, KS, USA). Plates were incubated aerobically in an upright position for no longer than 24 h at 42°C.
Transposon random mutagenesis Materials and methods Bacterial strains Salmonella strains were isolated from retail ground beef as previously described (Kim and Wei 2007). Isolates with typical cultural characteristics were further identified by biochemical test API (API-20; bioMerieux, Durham, NC, USA) to confirm Salmonella species. Serogrouping was performed with polyvalent Salmonella antiserum followed by specific O and H antiserum in the Animal Health Research Institute of the Agricultural Research Center at the Egyptian Ministry of Agriculture (Cairo, Egypt) in accordance with according to the Kauffmann-White scheme. Luria-Bertani (LB) broth and agar were used for bacterial growth, creation of mutants and biofilm assays. The strains were kept at −70°C in Luria Bertani (LB) broth (Difco) with the addition of 20% (v/v) glycerol. All strains were transferred from the stock cultures into LB broth and incubated overnight with aeration at 37°C. All strains were subsequently subcultured one more time under the same conditions. The grown cultures were used for inoculation into LB agar. Media were supplemented with 50 μg/ml kanamycin when necessary. Phenotypic analysis of transposon mutant clones Quantification of biofilm was done as previously described (Head and Yu 2004) with some modifications. Briefly, S. Typhimurium overnight culture was diluted 1:100 in sterile
Random mutagenesis of genomic DNA in S. Typhimurium was carried out by using EZ::TN™ < KAN-2 > Tnp Transposome™ (Epicentre, Madison, WI, USA) as previously described (Hoffman et al. 2000). Briefly, 1 μl of the EZ::TN™ < KAN-2 > Tnp Transposome™ was introduced into 100 μl S. Typhimurium electrocompetent cells by electroporation in a chilled 0.2-cm gap electroporation cuvette (Bio-Rad Laboratories, Hercules, CA, USA) at 2,500 V , 50 μF, and 200 ohms. Diluted electroporated cells were plated on Luria-Bertani (LB) agar (Difco) containing 50 mg/ml kanamycin.
DNA manipulations, sequencing and sequence analysis All DNA manipulations, including restriction digestions, ligations and gel electrophoresis were performed according to the established protocols (Sambrook et al. 1989). Bacterial DNA was purified using DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). Polymerase chain reactions (PCR) were performed in a final volume of 50 μl containing 0.5 μl both forward and reverse primers (50 pmol), 2 μl Qiagen dNTPs, 5 μl of 10×Buffer, 1 μl MgCl2 (25 mM), 0.25 μl Taq polymerase and 5 μg purified DNA. Distilled water was added to bring the final volume to 50 μl. The cycling conditions were as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 55°C for 45 s, 72°C for 45 s, and a final extension step at 72°C for 10 min. The sequence flanking transposon mutants were
Ann Microbiol (2012) 62:533–537
determined by inverse PCR as previously described (Martin and Mohn 1999) with some modifications. XbaI was used as a frequent cutter restriction enzyme that cuts the transposome element once. Digested DNA was self-ligated with T4 DNA ligase to circulate linear DNA fragments which were used as a template for subsequent PCR reactions using FP-1 and RP-1 oligonucleotide primers included in the TN™ < KAN-2 > Tnp Transposome™ kit (Table 1) that were designed to amplify the transposon flanking region. Restriction enzymes, T4 DNA ligase and Taq DNA polymerase were purchased from New England Biolabs, Ipswich, MA, USA. The bands were purified using the gel extraction kit (Qiagen). The product was then sequenced using The BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems,Foster City, CA, USA). Transposon insertion sites of recovered sequences were determined using BlastX at the National Center for Biotechnology Information (NCBI) for similarity search (Johnson et al. 2008).
Electron microscopy For scanning electron microscope, the lower portion of the flow cell containing the coverslip was washed with PBS three times and fixed using 2.5% glutaraldehyde in PBS for 60 min. The cover slips were then rinsed twice for 10 min each in PBS and processed for scanning electron microscopy (SEM) as previously described (Hong et al. 2007). For transmission elecrtron microscopy, bacterial pellets were fixed in 4% gluteraldehyde solution over night at 4°C for subsequent processing. Transmission electron microscopy processing was done as previously described (McCormick et al. 1995)
Results and discussion Generation of transposon random mutants and biofilm deficient mutants An average of 9×103 colonies were obtained by electroporation of 20 ng of transposome which represents a
535
transformation efficiency of 4.5×105 CFU/μl transposome. In control experiments in which sterile water was elecroporated without transposome, no colonies were observed. A total of 1,070 random transposon mutants of S. Typhimurium were obtained using the EZ::TN™ < KAN-2 > Tnp Transposome™. Transposome insertions were verified by presence of a PCR fragment of 474 bp (amplification of part of transposome element) in all mutants tested but not in the wild-type strain. The number of transposition clones obtained is highly dependent on the transformation efficiency of the host cell. The higher the transformation efficiency of the cell, the more clones will be produced. The observed transformation efficiency are sufficient for the rapid generation of saturated mutant libraries as has been reported for Pseudomonas aeruginosa (Jacobs et al. 2003) Identification of two flagellar genes responsible for biofilm formation To examine the ability the mutants to form a biofilm, the biofilm was detected by staining with crystal violet. A purple dye that stains the bacterial cells but does not stain the PVC plastic was observed. Although measurement of the crystal violet incorporated into a biofilm allows easy estimation of the bacterial biomass adherent to a surface, microscopy is required to determine biofilm architecture further. Scanning electron microscope (SEM) was used to confirm the alteration in biofilm formation in these mutants. In the biofilm deficient mutants, there were many fewer bacteria than with the wild-type, and they were widely dispersed. Using the crystal violet assay and SEM, 5 mutants (0.46%) were confirmed to be biofilm deficient. Any strains exhibiting poor growth under these screening conditions might give the same phenotype as mutants. Therefore, all the biofilm-deficient mutants were grown with wild-type strain in LB medium under the same conditions used for cultivation of wild-type strain. All the mutants grew as well as the wild-type strain but were unable to form a biofilm indicating that reduced biofilm was not a result of impaired growth.
Table 1 PCR primers used in this study Name
Sequence (5′-3′)
Kan_CHK_F Kan_CHK_F KAN-2 FP-1
TATGCCTCTTCCGACCATCAAGCA Forward PCR primer for kanamycin resistant gene amplification (474 bp) AGGCAGTTCCATAGGATGGCAAGA Reverse PCR primer for kanamycin resistant gene amplification (474 bp) ACCTACAACAAAGCTCTCATCAACC Forward primer used for DNA sequencing and determining transposon insertion sites in target genomic DNAs GCAATGTAACATCAGAGATTTTGAG Reverse primer used for DNA sequencing and determining transposon insertion sites in target genomic DNAs
KAN-2 RP-1
536
Ann Microbiol (2012) 62:533–537
Identification of the transposon insertion site was achieved using IPCR which represents a quick and easy PCR-based method that would dispense cloning procedures and could also determine the number of transposon insertions. By IPCR, the insertion sites of the biofilmdeficient mutants were determined using primers sets FP-1/ RP-1 on XbaI digested and circulized DNA. In the wildtype strain (negative control), no IPCR product was observed. DNA sequencing analyses after IPCR verified biofilm-deficient mutants containing a mutation in FlgA gene (accession number HQ585857). This gene encodes for protein of 219 amino acids possessing a potential signal sequence of 21 amino acids at its N terminus (Kutsukake et al. 1994). FlgA is synthesized as a precursor form and exported via the Sec secretory pathway into the periplasmic space where P ring formation takes place and this gene was proved to play an auxiliary role in P ring assembly (Nambu and Kutsukake 2000). Another two mutants contained a mutation in the FlgB gene (accession number HQ585858). This gene with FlgF and FlgC makes up the proximal portion of the flagellar basal body rod. Similar protein is associated with the polar flagella formation in Vibrio parahaemolyticus (Liu and Ochman 2007). In order to determine the motility behavior of these biofilmdeficient mutants, these 5 mutants were screened for motility using Modified Semi-solid Rappaport Vassiliadis (MSRV) and transmission electron microscope (TEM). The FlgA and FlgB mutants displayed non-motile or motility less phenotype on MSRV and confirmed by TEM. On the other hand, the wild-type displayed a motile phenotype (Fig. 1). The highly ordered transcriptional hierarchy controlling expression of flagella is comprised of three classes of genes and is regulated by many global signals (Apel and Surette 2008). Therefore, it is no surprise that flagella make various contributions to biofilm formation depending on the environmental conditions, such as binding substrate material, nutrient limitation, temperature, medium flow rate, and other factors (Barken et al. 2008; Merritt et al. 2007;
Fig. 1 Transmission electron micrographs of Salmonella enterica serovar Typhimurium strains wild-type (a) and typical flagellar-deficient mutant strain (b) taken at ×50,000 magnification. In wild-type strain, several peritrichous flagella were always observed. In flagellar mutants strains, no flagella were observed
a
O'Toole and Kolter 1998). It has been reported that motility is required for both biofilm formation (on biotic and abiotic surfaces) and pathogenesis (Grant et al. 1993; Montie et al. 1982; Simpson et al. 1995). Previous studies performed with S. Typhimurium fliA mutant suggested that motility was necessary for gallstone biofilm development (Prouty et al. 2002). Furthermore, previous results demonstrated that flagella play an important role in biofilm formation in E. coli (Davey and O'Toole 2000; Pratt and Kolter 1998), Vibrio cholerae (Watnick et al. 2001), and Pseudomonas aeruginosa (O'Toole and Kolter 1998). In these organisms, non-motile mutants have been shown to be severely defective in the ability to form a biofilm. Therefore, the isolation of non-motile strains helps to validate our experimental approach. Some explanations were proposed through which flagella might be required for biofilm formation. First, it is possible that flagella could be directly required for attachment to abiotic surfaces, thus facilitating the initiation of biofilm formation (e.g., as with tethered cells). Alternatively, motility could be necessary to enable a bacterium to reach the surface (e.g., to move through surface repulsion present at the medium–surface interface). Also, motility might be required for the bacteria within a developing biofilm to move along the surface, thereby facilitating growth and spread of the biofilm. Flagella have been shown to be very important in biofilm formation, especially in the early stages when microcolonies are being formed. Flagella are needed to move the bacteria to the surface for attachment and then to propel the organisms across the surface in search of other bacteria (Costerton et al. 1995; O'Toole and Kolter 1998; Pratt and Kolter 1998).
Conclusion We identified some new flagellar genes associated with Salmonella enterica serovar Typhimurium biofilm formation. These findings may help understand the regulation mechanism of biofilm formation.
b
Ann Microbiol (2012) 62:533–537
References Apel D, Surette MG (2008) Bringing order to a complex molecular machine: the assembly of the bacterial flagella. Biochim Biophys Acta 1778:1851–1858 Barken KB, Pamp SJ, Yang L, Gjermansen M, Bertrand JJ, Klausen M, Givskov M, Whitchurch CB, Engel JN, Tolker-Nielsen T (2008) Roles of type IV pili, flagellum-mediated motility and extracellular DNA in the formation of mature multicellular structures in Pseudomonas aeruginosa biofilms. Environ Microbiol 10:2331–2343 Costerton JW, Lewandowski Z, Caldwell DE, Korber DR, Lappin-Scott HM (1995) Microbial biofilms. Annu Rev Microbiol 49:711–745 D’Aoust JY (1991) Pathogenicity of food borne Salmonella. Int J Food Microbiol 12:17–40 Davey ME, O'Toole GA (2000) Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64:847–867 de Rezende CE, Anriany Y, Carr LE, Joseph SW, Weiner RM (2005) Capsular polysaccharide surrounds smooth and rugose types of Salmonella enterica serovar Typhimurium DT104. Appl Environ Microbiol 71:7345–7351 DeSmedt JM, Bolderdijk RF (1987) Dynamics of Salmonella isolation with Modified Semi-solid Rappaport-Vassiliadis medium. J Food Prot 50:658–661 Donlan RM, Costerton JW (2002) Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 15:167–193 Gilbert P, Allison DG, McBain AJ (2002) Biofilms in vitro and in vivo: do singular mechanisms imply cross-resistance? Symp Ser Soc Appl Microbiol 98S-110S Grant CC, Konkel ME, Cieplak W Jr, Tompkins LS (1993) Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect Immun 61:1764–1771 Head NE, Yu H (2004) Cross-sectional analysis of clinical and environmental isolates of Pseudomonas aeruginosa: biofilm formation, virulence, and genome diversity. Infect Immun 72:133–144 Hoffman LM, Jendrisak JJ, Meis RJ, Goryshin IY, Reznikof SW (2000) Transposome insertional mutagenesis and direct sequencing of microbial genomes. Genetica 108:19–24 Hong W, Mason K, Jurcisek J, Novotny L, Bakaletz LO, Swords WE (2007) Phosphorylcholine decreases early inflammation and promotes the establishment of stable biofilm communities of nontypeable Haemophilus influenzae strain 86-028NP in a chinchilla model of otitis media. Infect Immun 75:958–965 Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D, Olson MV, Manoil C (2003) Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci USA 100:14339–14344 Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL (2008) NCBI BLAST: a better web interface. Nucleic Acids Res 36:W5–W9 Kim SH, Wei CI (2007) Biofilm formation by multidrug-resistant Salmonella enterica serotype typhimurium phage type DT104 and other pathogens. J Food Prot 70:22–29 Kim SH, Wei CI (2009) Molecular characterization of biofilm formation and attachment of Salmonella enterica serovar typhi-
537 murium DT104 on food contact surfaces. J Food Prot 72:1841– 1847 Kutsukake K, Okada T, Yokoseki T, Iino T (1994) Sequence analysis of the flgA gene and its adjacent region in Salmonella typhimurium, and identification of another flagellar gene, flgN. Gene 143:49–54 Ledeboer NA, Jones BD (2005) Exopolysaccharide sugars contribute to biofilm formation by Salmonella enterica serovar typhimurium on HEp-2 cells and chicken intestinal epithelium. J Bacteriol 187:3214–3226 Lewis K (2001) Riddle of biofilm resistance. Antimicrob Agents Chemother 45:999–1007 Liu R, Ochman H (2007) Stepwise formation of the bacterial flagellar system. Proc Natl Acad Sci USA 104:7116–7121 Martin VJ, Mohn WW (1999) An alternative inverse PCR (IPCR) method to amplify DNA sequences flanking Tn5 transposon insertions. J Microbiol Meth 35:163–166 McCormick BA, Hofman PM, Kim J, Carnes DK, Miller SI, Madara JL (1995) Surface attachment of Salmonella typhimurium to intestinal epithelia imprints the subepithelial matrix with gradients chemotactic for neutrophils. J Cell Biol 131:1599–1608 Merritt JH, Brothers KM, Kuchma SL, O'Toole GA (2007) SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. J Bacteriol 189:8154–8164 Montie TC, Doyle-Huntzinger D, Craven RC, Holder IA (1982) Loss of virulence associated with absence of flagellum in an isogenic mutant of Pseudomonas aeruginosa in the burned-mouse model. Infect Immun 38:1296–1298 Nambu T, Kutsukake K (2000) The Salmonella FlgA protein, a putativeve periplasmic chaperone essential for flagellar P ring formation. Microbiology 146:1171–1178 O'Toole GA, Kolter R (1998) Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30:295–304 Pratt LA, Kolter R (1998) Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30:285–293 Prouty AM, Schwesinger WH, Gunn JS (2002) Biofilm formation and interaction with the surfaces of gallstones by Salmonella spp. Infect Immun 70:2640–2649 Qin A, Mann BJ (2006) Identification of transposon insertion mutants of Francisella tularensis strain Schu S4 deficient in intracellular replication in the hepatic cell line HepG2. BMC Microbiol 6:69 Sambrook J, Fritsg EF, Maniatis T (1989) Molecular cloning: a laboratory manual, Vol 2, 2nd edn. Cold Spring Harbor Laboratory Press, New York Simpson DA, Ramphal R, Lory S (1995) Characterization of Pseudomonas aeruginosa fliO, a gene involved in flagellar biosynthesis and adherence. Infect Immun 63:2950–2957 Solomon EB, Niemira BA, Sapers GM, Annous BA (2005) Biofilm formation, cellulose production, and curli biosynthesis by Salmonella originating from produce, animal, and clinical sources. J Food Prot 68:906–912 Watnick PI, Lauriano CM, Klose KE, Croal L, Kolter R (2001) The absence of a flagellum leads to altered colony morphology, biofilm development and virulence in Vibrio cholerae O139. Mol Microbiol 39:223–235
