(This is a sample cover image for this issue. The actual cover is not yet available at this time.)
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the author's institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier's archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/authorsrights
Author's Personal Copy Molecular Immunology 82 (2017) 104–113
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Immunization with Leishmania donovani protein disulfide isomerase DNA construct induces Th1 and Th17 dependent immune response and protection against experimental visceral leishmaniasis in Balb/c mice Ajay Amit a , Vijayamahantesh a,c , Manas R. Dikhit a,b , Ashish Kumar Singh a,d , Vikash Kumar a , Shashi S. Suman f , Ashu Singh c , Akhilesh Kumar a , Ajit Kumar Thakur h , Vidyanand Ravi Das e , Pradeep Das g , Sanjiva Bimal a,∗ a
Division of Immunology, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India Dept. of Bioinformatics, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India Dept. of Biotechnology, National Institutes of Pharmaceutical Education and Research, Hajipur 844102, India d Dept. of Pathology, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India e Dept. of Clinical Medicine, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India f Dept. of Molecular Biochemistry, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India g Dept. of Molecular Biology, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India h Dept. of Microbiology, Rajendra Memorial Research Institute of Medical Sciences, Patna 800007, India b c
a r t i c l e
i n f o
Article history: Received 12 September 2016 Received in revised form 20 December 2016 Accepted 23 December 2016 Keywords: Protein disulfide isomerase (PDI) DNA vaccine Interleukin (IL)-17A Nitric oxide Mitogen-activated protein kinase (MAPK) Visceral leishmaniasis Interferon gamma
a b s t r a c t In the present study, the efficacy of Leishmania donovani protein disulfide isomerase (LdPDI) as a DNA vaccine was evaluated in BALB/C mice. Mice immunized with the LdPDI-DNA construct were found to be the most immuno-reactive, as the construct induced higher T-cell proliferation. The increased T-cell proliferation was associated with a substantial rise in Th1 and Th17+ CD4 cell response and triggered a higher proportion of CD8+ T cells for the release of interferon-gamma along with a reduced splenic parasite load on Days20 and 60 post challenge (PC). Furthermore, the vaccine construct triggered increased interferon (IFN)-␥, interleukin(IL)-17A, and IL-22 release accompanied by decreased extracellular signal-regulated kinases (ERK) 1/2 signaling and increased mitogen-activated protein kinase (MAPK) signaling coinciding with an increase in the amount of nitrite and reactive oxygen species (ROS)in vaccinating the splenocyts. We summarize from our data that the PDI-DNA construct of Leishmania donovani has the potential to elicit protective immunity through the pro-inflammatory cytokines of CD8+ and CD4+(Th1 and Th17) following an intervention in the downstream signaling event of ERK1/2 (probably through p38MAPK signaling). Therefore, the study suggests a new control against visceral leishmaniasis in the future. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Visceral leishmaniasis (VL) is a major public health problem affecting approximately 350 million people living in 88 tropical and subtropical countries (Santos et al., 2008). Approximately, 90% of the global disease burden is reported on the Indian subcontinent, particularly in the Bihar province of India (Desjeux, 2004; Jeronimo et al., 2004; Alvar et al., 2012). The disease spreads in
∗ Corresponding author at: Division of Immunology, Rajendra Memorial Research Institute of Medical Sciences, Indian council of Medical Research, Agamkuan, Patna 800007, India. E-mail addresses:
[email protected],
[email protected] (S. Bimal). http://dx.doi.org/10.1016/j.molimm.2016.12.022 0161-5890/© 2016 Elsevier Ltd. All rights reserved.
areas where the sandfly Phlebotomus vector bites a host and transmits the disease. Leishmania, a protozoan pathogen, is responsible for leishmaniasis, as it migrates to the cells of mononuclear cells, especially to macrophages in the internal organs of the infected host. Leishmaniasisis characterized by the appearance of fever, hepatosplenomegaly, pancytopenia, and emaciation in patients, which results in immune dysfunction and in the patient becoming immunosuppressed (Das et al., 2005; Jha, 2006). The disease becomes fatal in the absence of treatment (Bates, 2007; Gramiccia and Gradoni, 2005). Drug failure in many patients is accompanied with relapse, which occurs in one-third of cured patients. This poses a serious obstacle to VL elimination. Parasites like leishmania have been reported to resist the action of cytotoxic drugs through gene ampli-
Author's Personal Copy A. Amit et al. / Molecular Immunology 82 (2017) 104–113
fication (Mukherjee et al., 2007). Due to phenotypic and molecular alterations in the pattern of parasites after frequent and irregular drug use in patients in endemic areas, sodium stibogluconate (SAG), once considered a primary first line drug, has become drug resistant in VL affected areas in India due to the over expression of the ATP-binding cassette (ABC) transporter gene (Haimeur et al., 2000; El-Fadili et al., 2010), which is believed to efflux antimonials. Similarly, Sir2 in the L. donovani strain was recently shown to play a critical role in amphoterecine B resistance and it may be a new drug resistance marker for VL (Purkait et al., 2012). Considering that drug interventions are limited and face the problem of emerging parasite resistance, there is greater interest in the identification of appropriate antigens for vaccine development. Leishmaniasis has an immunological basis of cure because improper and inadequate host protective immune response facilitates the invasion of parasites in the spleen and liver. Subsequently, patients develop various clinical conditions such as splenomegaly, pancytopenia, anemia, and disseminated hemorrhages (Murray et al., 2005). Two distinct lineages of T-cells, namely CD4 + Th1 andCD4 + Th17, are responsible for the controlled and programmed immune response mediated against Leishmania and supported by various cytokines (such as interleukin-2 [IL-2], interferon-␥[IFN-␥], IL-6, and the tumor necrosis factor [TNF]), and chemokine(such as CXCL8 [also known as IL-8], CXCL10 [also known as IP-10], CXCL1, and CXCL6; Bhattacharya and Ali, 2013; Sanjabi et al., 2009; Gollob et al., 2008). The Th1 group of CD4+ T cells counters Leishmania infection within macrophages in an infected spleen and liver through support from IL-12, IL-2, IFN-␥, etc. New studies indicate the involvement of both CD4+ and CD8+ T cells in controlling infection by intracellular pathogens (Belkaid and Rouse, 2005; Szabo et al., 2002). Before the entrance of parasites in organs,Th17+ cells can effectively recruit neutrophils and monocytes in the skin at the inflammatory site by their ability to express homing receptors such as CCR6 and CCR4 during leishmaniasis (Acosta-Rodriguez et al., 2007a,b). Interleukin-22 is also produced by Th17 cells. In tandem with IL-22, it provides initiating immunity at the epithelium, which is equally associated with protection against leishmaniasis (Pitta et al., 2009). Therefore, in both innate responses, Th17+ and Th1+ CD4+ cells are essential to dictate resistance or susceptibility to disease (Dudeck et al., 2011; Anderson et al., 2007; Boaventura et al., 2010). Therefore, identification of immunogenic antigens evoking a Th17 and Th1+ immune response as a vaccine candidate can be beneficial for the control of VL. Padilla et al. (2003) and Amit et al. (2014) identified a unique protein disulfide isomerase (PDI) of 15 kDa in L. donovani with a direct role in the survival of L. donovani and immunopathogenicity in active VL patients. This protein has also been reported at the high molecular weight size of 55 kDa in clinical isolates of L. donovani (Kushwaha et al., 2012). The evidence for the role of PDI in the development of infection has also been documented through its presence inside THP-1 derived macrophages in L. major (Saba et al., 2007). Recent reports have shown a trend of the migration of LdPDI from the endoplasmic reticulum to the phagosome, and as such, LdPDI is recognized today for its role in the virulence and survival of Leishmania (Amit et al., 2014; Touret et al., 2005). Additionally, a recent study has straight forwardly signified its linkage to protection against VL, as evidenced by the fact that this antigen was processed and presented by a major histocompatibility complex class I (MHC-1) dependent pathway and had immuno-prophylactic potential, which can induce a CD8+ T cell protective immune response in a MHC class I dependent manner against VL (Amit et al., 2016). Therefore, in light of these recent studies, LdPDI, which is required by the parasite for numerous cell functions and cell development, could be a potential vaccine target (Amit et al., 2016). Here, we demonstrate that immunization with LdPDI-encoding DNA (LdPDI-construct) induces a sterile protective
105
cellular immune response against VL in an experimental animal model.
2. Materials and method 2.1. Mice and parasites The study was conducted in accordance with the recommendations of the Institutional Animal Ethical Committee of Rajendra Memorial Research Institute of Medical Sciences (RMRIMS) in Patna, India. Five-to eight-week-old inbred male BALB/c mice were procured from the National Centre for Laboratory Animal Sciences in Hyderabad, India. The mice were kept under sterile hygienic conditions in the Animal House at RMRIMS. The stationary phase flagellated promastigote form of L. donovani (Dd8 of L. donovani) was used for all experiments. In the study, this form of the parasite was obtained after the transformation of non-flagellated amastigotes isolated from the spleens of infected hamsters by culture at 24 ◦ C in Schneider’s insect medium (supplied by Sigma, St. Louis, MO) supplemented with 20% heat inactivated fetal calf serum (supplied by GIBCO Life Technology, India), 20 mM l-glutamine, 100 units/ml of penicillin, and 50 g/ml of gentamycin at pH 7.4.
2.2. Soluble Leishmania antigen (SLA) Cultured L. donovani promastigote (200 × 106 per ml) in 5 ml of cold sterile phosphate-buffered saline (PBS) was subjected to 5 cycles freeze and thaw in −195 ◦ C liquid nitrogen at 37 ◦ C water bath and then centrifuged at 10,000g for 20 min at 4 ◦ C (Afrin et al., 2002). Supernatant containing soluble Leishmania antigens were collected and stored at −70 ◦ C until further use. The protein concentration was measured by Lowry’s method.
2.3. r-LdPDI protein from Leishmania donovani Previously cloned, expressed, and purified 15 kDa antigen of protein disulfide isomerase of L. donovani reported earlier by our group (Amit et al., 2014) was used for all experiments. Contamination in the recombinant protein (r-LdPDI) preparation was checked by the Limulus amoebocyte lysate (LAL) test (supplied by ThermoScientific, USA). Later, polymyxin B-agarose column (supplied by Sigma) was used for the complete removal of LPS according to the manufacturer’s instructions and confirmed by the LAL test.
2.4. Western blotting Purified recombinant protein was subjected to 12% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) after 1 g/well thrombin digestion. Immunoblotting of the recombinant protein was performed as per protocol (Towbin et al., 1979; Krautz et al., 1995) with a few modifications in the western blotting (Bio-Rad Trans-Blot SD) by a semi-dry transfer cell to a PVDF (polyvinylidene difluoride) membrane (0.22 m pore size; GE Healthcare Products) at 18 V for 45 min. The membrane was then blocked with 3% powdered skim milk in PBS with 0.05% Tween-20 detergent and incubated for 1 h. Next, the membrane was washed with 0.05% Tween-20 detergent in PBS and incubated for 1 h with VL positive (patients) and negative (healthy) serum (1:500). After one more washing, the membrane was incubated with secondary horseradish peroxidase (HRP) conjugated with goat anti-human IgG (1:1000) antibody. Hydrogen peroxide (H2 O2 ) and diaminobenzidine (DAB) were used to reveal the protein bands.
Author's Personal Copy 106
A. Amit et al. / Molecular Immunology 82 (2017) 104–113
2.5. Synthesis of DNA vaccine as LdPDI-DNA-pCDNA3.1Construct The LdPDI was amplified from Leishmania donogenomic DNA (2 l) with a sense primer vani (5 GCGGAATTCGGAGATTGTCGAGCTCAACC3 ) and an antisense primer (5 CGCCTCGAGCTGCTTGTTGGCCGC3 ) containing an appropriate KOZAK sequence, where the EcoRI and XhoI-sites are underlined and the translational initiation is italicized. These primers (supplied by Sigma) were designed to clone LdPDI in the mammalian expression vector pCDNA3.Polymerase chain reaction was performed in a 50 l reaction mixture containing 0.2 mM each dNTPs, 2.0 mM MgCl2, 1.0 M each primer, 1 g L. donovani (Ag83) DNA, 1.0 pfu DNA polymerase, and 2 U Taq DNA polymerase with a Taq buffer (+NH2 SO4 ). The conditions used for the PCR were starting at 95 ◦ C for 5 min, denaturation at 95 ◦ C for 30 s, annealing at 56 ◦ C for 30 s, elongation at 72 ◦ C for 45 s, and 35 cycles with a final extension for 7 min at 72 ◦ C. A 380 bp PCR product was observed on the 1% agarose gel electrophoresis system. This PCR product was double digested with EcoRI and XhoI, purified with a gel extraction kit (supplied by Qiagen, Germany), and cloned into pcDNA3.1 (Sigma) in the same orientation as the T7 promoter confirmed by colony PCR. The ligation mixture was transformed in competent DH5 alpha cells (supplied by Novagen in India) which produced the pcDNA3.1–LdPDI DNA construct (PDI-construct). 2.6. Immunization experiments Four groups containing 20 BALB/c mice each were formed and: (i) infected control, (ii) immunized with soluble Leishmania antigen(SLA) as control 1, (iii) immunized with pcDNA3.1 vector only (iv) immunized with PDI-construct. Immunization was performed subcutaneously with 20 g of different antigens along with Freund’s Incomplete Adjuvant (FIA) dissolved in sterile saline (0.85% NaCl) on Days 1, 7, and 15. The immunized mice were then challenged intracardially by a 15 × 107 virulent strain of freshly transformed L. donovani (Dd8) early stationary phase promastigotes on the 21st day. Two time points (Day 20 PC and Day 60 PC) were selected and total 5 mice were sacrificed for the measurement of physical parameters (weight, size of spleen, and size of liver), anti-Leishmania antibody titre, T-cell function (IFN-␥, IL-10, IL-17A, and IL-22), T-cell proliferation (IL-2), downstream signaling pattern (ERK1/2 , MAPK), and reactive oxygen species and nitric oxide production. 2.7. Assessment of T-cell proliferation The proliferation of splenocytes isolated on Day 20 PC from the different immunized groups of mice (n = 5) was measured. Briefly, single cell suspensions of splenocytes from different groups of Balb/C were suspended in RPMI 1614 medium (Hi-Media, India) supplemented with 2 mM l-glutamine (Hi-media, India), 10% fetal calf serum (Life Technologies, Gaithersburg, MD), 2 mM 2-mercaptoethanol (Sigma) and 50 g/ml Gentamycin, 100 U/ml penicillin, 100 g/ml streptomycin and then adjusted to pH 7.4 with 2N NaOH. The cells were plated at a concentration of 0.1 × 106 cells in 96 well plates and were allowed to proliferate for 3 days at 37 ◦ C in a 5% CO2 incubator. Cell proliferation was determined by BrdU (5-bromo-2 deoxyuridine) incorporation. The response so obtained was antigen specific because splenoctes from all the groups were treated with recombinant LdPDI protein invitro. 2.8. Antibody response against r-LdPDI To detect the presence of anti-Leishmania antibodies in the infected mice, Whatman Paper Number 4 was used for the collec-
tion of blood spots from the mice. When air-dried circular sections of the blood-spotted regions were obtained. One circular piece was immersed in 750 l of normal saline which contained 1:50 diluted serum in a Direct Agglutination Test (DAT) plate. The DAT was performed to detect the serum antibody titre as previously described (Naidoo, 2009; Laurindo et al., 2012a,b). 2.9. Splenic parasite burden The splenic tissue smear of sacrificed mice on a different time interval included in the study was prepared and stained with Giemsa stain and counted by microscope. The result was expressed as the number of amastigotes per 1000 splenocytes (Hong and Soong, 2008; Görlach et al., 2006; Csala et al., 2010). 2.10. Preparation of splenic mononuclear cells at different time intervals PC Mice from each group were sacrificed on Days 20 and 60 PC, and their spleens were isolated. Histopaque TM (supplied by Sigma) density gradient centrifugation had been done to prepare single cell suspensions of splenocytes. Mononuclear cells were then purified by washing them in PBS(supplied by Sigma) and via subsequent centrifugation (800 × g, 15 min) over Histopaque-1077 (supplied by Sigma). The cells from the layer immediately above the Histopaque were collected and washed thrice with PBS before being used further. RPMI 1640 supplemented with 2 mM l-glutamine, 10% fetal calf serum (supplied by GIBCO Life Technology), 5 × 105 mM 2mercapthoethanol, and antibiotics 100 U ml-Penicillin, 50 g ml−1 Streptomycin (supplied by HiMedia Laboratories Pvt. Ltd., India) was used as the culture media. 2.11. Effect of differential vaccination on antileishmanial splenocytes activity in Balb/c mice Changes observed in the nitric oxide generation in the splenocyts of differentially vaccinated mice were measured by Griess reagent as described previously (Mookerjee Basu et al., 2006). The amount of nitric oxide formed was measured in Molar/106 (M/ml) cells and calculated by comparing the standard sodium nitrite concentration curve. The lower limit of the sensitivity of the nitrite assay was 0.08 M/ml. Measurement of reactive oxygen species (ROS) activity was based on flow cytometry as described previously (Haldar et al., 2009; Vale-Costa et al., 2013). The cultured and washed splenocytes of animals (100 l) from all study groups (n = 5) were triggered by LPS (100 g/ml) plus formylmethionylleucyl-phenylalanine (fMLP; 5 mg/ml) at 37 ◦ C in a water bath (10 min). A subsequent incubation of triggered cells with 2 ml of 10 m dihydrorodamine 1, 2, 3 at 37 ◦ C in a water bath (15 min) was performed to enable internalization of the latter into the cell and its conversion into a green fluorescent compound and binding to oxidative bursts produced by stimulated cells. Following incubation, the splenocytes were washed (1 X PBS, 268 g, 5 min) and resuspended in 450 l PBS containing 1% paraformaldehyde. The ROS produced by the stimulated cells was measured via mean fluorescence intensity (MFI) as detected with flow cytometry. 2.12. ELISA analysis for different cytokines levels at different time intervals PC The total level of various cytokines observed in this study was measured by ELISA kits using the culture supernatant of splenocytes according to the instructions provided by the manufacturer. The supernatants of culture from the single-cell suspension of splenocytes from different groups of mice on Days 20 and 60 PC were obtained for cytokine analysis as per the time indicated for
Author's Personal Copy A. Amit et al. / Molecular Immunology 82 (2017) 104–113
different cytokines to show their optimum activity. Cytokines such as IL-17A, IL-22, and IFN-␥ levels were measured at 120 h (20), but the IL-10 levels were determined at 48 h. The detection limit for IFN-␥ (BD Biosciences, Cat#555138) was
