In Vitro Effects of Dexamethasone on Human Corneal ... - IOVS

In Vitro Effects of Dexamethasone on Human Corneal Keratocytes Tristan Bourcier,1 Vincent Borderie,1 Patricia Forgez,2 Alain Lombet,2 William Rostene2 and Laurent Laroche1 investigate whether cultured human keratocytes express the glucocorticoid receptor (GR) and to assess the influence of dexamethasone (DEX) on these cells.

PURPOSE. TO

METHODS. Human

keratocytes were cultured in medium supplemented with various concentrations of DEX (ranging from 10~10 to 10~4 M). Cell proliferation was analyzed by 3-(4,5-dimethylthiazol2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl>2H-tetrazolium inner salt (MTS) assay at 2, 4, and 6 days of culture. Some experiments were performed in the presence of mifepristone (RU38486), an antiglucocorticoid molecule. The early phase of apoptosis was studied by means of keratocyte staining with a fluorescein conjugate of annexin V and propidium iodide, and cells were analyzed by flow cytometry. Glucocorticoid receptor mRNA was detected in keratocytes by means of reverse transcription-polymerase chain reaction (RT-PCR). Immunocytochemical staining of the cells was performed with a monoclonal anti-human GR.

RESULTS. RT-PCR

and immunocytochemistry showed the expression of GR (mRNA and protein) in cultured keratocytes. Dexamethasone significantly increased keratocyte proliferation with concentrations ranging from 10~9 to 10~5 M, with a maximum effect at 10~7 M (P < 0.005). Dexamethasone's proproliferative effect was inhibited by RU38486. However, DEX also induced apoptosis of cultured keratocytes at any concentration used. These results indicate that cultured human keratocytes express the GR and proliferate in response to DEX stimulation (10~9-10~5 M), which also induces keratocyte apoptosis. (Invest Ophthalmol Vis Set. 1999;40:1061-1070)

CONCLUSIONS.

D

examethasone (DEX) is a glucocorticoid molecule that is widely used topically after cataract surgery and penetrating keratoplasty. It is also used after photorefractive keratectomy in an attempt to reduce ocular surface inflammation and to delay corneal wound healing.1 Although use of DEX may be empiric, it has been shown to inhibit inflammation, through inhibition of phospholipase A2 activity and inhibition of transcription of metalloprotease genes. By preventing cellular divisions, glucocorticoids have been shown to decrease extracellular matrix and scar tissue formation.2 Conflicting data were reported on corneal stroma and epithelial wound healing, but most investigations have shown that steroid eye drops impair wound healing, rather than having no effect.3"7 Dexamethasone has been shown in vitro to inhibit keratocyte proliferation and other ocular cell growth under particular conditions.8"1' However, high, nonphysiological, DEX concen-

trations were tested, and the molecular bases of such effects remain unclear. In addition to their anti-inflammatory and immunosuppressive effects, another important glucocorticoid property is the ability to induce apoptotic cell death, which has been described in many cell lines (e.g., thymocyte and lymphoid).12 Keratocyte apoptosis is probably an initiating factor in woundhealing response after refractive surgical procedure. I3M The effect of DEX on keratocyte apoptosis is currently unknown. Because it is well established that glucocorticoids exert their biologic action by binding to specific intracellular receptors,15 this study was initiated to determine whether cultured human keratocytes express the glucocorticoid receptor (GR). Dexamethasone's effects on keratocyte proliferation and apoptosis were also investigated.

MATERIALS AND METHODS 2

From the 'Cornea Bank, AP-HP, Paris VI University; and lnstitut National de la Sante et de la Recherche Medicate GNSERM U339), Hopital Saint-Antoine, Paris, France. Supported by a grant from the Association Claude Bernard and INSERM (Equipe de Recherche Clinique Associee). Presented in part at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May 1998. Submitted for publication August 27, 1998; revised January 5, 1999; accepted February 2, 1999. Proprietary interest category: N. Reprint requests: Tristan Bourcier, Service d'Ophthalmologie, Hopital Saint-Antoine, 184, me du fbg Saint-Antoine, 75571 Paris Cedex 12, France. Investigative Ophthalmology & Visual Science, May 1999, Vol. 40, No. 6 Copyright © Association for Research in Vision and Ophthalmology

Human Keratocyte Culture This study was performed according to the tenets of the Declaration of Helsinki. Human keratocyte primary cultures were obtained using human donor corneas that were discarded before transplantation because of low endothelial cell counts. Stromal explants were obtained as previously described.16 Explants were cultured in medium at 37°C in 5% CO2 using six-well tissue culture plates (Costar, Cambridge, MA). The culture medium (THF) consisted of a 1:1 mixture of TC199 and Ham's F12 (Gibco Life Technology, Cergy-Pontoise, France) with 10% fetal calf serum (FCS; Gibco), 20 jug/ml insulin 1061

1062

Bourcier et al.

(Sigma-Aldrich Chimie, Saint Quentin Fallavier, France), 20 jLtg/ml i.-ascorbic acid (Sigma), 250 ng/ml heparin (Leo, Saint Quentin en Yvelines, France), 10 ng/ml acidic fibroblast growth factor (Sigma), 0.4 mg/ml sulfate chondroitin (Sigma), 2 mM L-glutamine, 100 IU/ml penicillin, 100 jag/ml streptomycin, and 0.25 iJLg/ml amphotericin. Native FCS was used or FCS desteroidized by mean of a dextran charcoal treatment to eliminate serum steroids.17 Keratocytes were allowed to migrate from the explants onto the surface of the wells. The cells reached confluence within 15 to 21 days. They were then enzymatically detached using 0.05% trypsin (Gibco) at 37°C for 3 minutes, after which TCI99 medium with 20% FCS was added to stop the trypsinization. The suspended keratocytes were then centrifuged at 400g for 10 minutes, and the supernatant was removed. The cells were resuspended in 20 ml culture medium and cultured in 75-ml cell culture flasks (Costar) at 37°C in 5% CO2 until reaching confluence. The cells were then serially trypsinized, centrifuged, resuspended, and cultured until enough cells were available for the experiments. Third-passage human keratocytes were used in all the experiments. The cells were plated at 104 cells/well using 24-well tissue culture plates. They were incubated in 1 ml of THF at 37°C (5% CO2) and were allowed to attach to the bottom of the well for 24 hours before DEX or RU38486 or both were added. Keratocytes were then cultured in THF supplemented with various concentrations of DEX (1O~10, 10~9, 10~8, 10~7, 10~6, 10"5, or 10" 4 M), and/or 10" 5 M RU38486 for 6 days. The control group consisted of keratocytes cultured in THF with 0.1% absolute ethanol and no DEX. The culture media were renewed three times a week. All the experiments were repeated six times. For each experiment (i.e., MTS assays, apoptosis assays, immunocytochemistry), all cultures were obtained from the same donor cornea. Cultured keratocytes were studied daily by means of phase-contrast microscopy. Drug Preparation and Addition Dexamethasone was purchased from Sigma-Aldrich. It was dissolved and serially diluted in absolute ethanol before addition to the culture medium. On the second day, THF was replaced by 1 ml THF containing various concentrations of DEX (10~4, 10~5, 10~6, 10~7, 10~8, 10~9, or 10" l 0 M). Dexamethasone was added to the culture medium every day at the same concentration. Mifepristone (RU38486; Roussel Uclaf, Romainville, France), an antiglucocorticoid molecule18 was dissolved in absolute ethanol. RU38486 (10~5 M) was added daily to the culture medium, alone or in combination with 10~7 M DEX, for 6 days. In all experiments, the ethanol concentration in the culture media was maintained at 0.1%. All the solutions were filter sterilized and stored at 4°C in light-protected containers. RNA Preparation Total RNA extraction was performed on keratocytes taken at the third subculture from two stromal explants. Keratocytes were not previously treated with DEX. RNA extraction was performed by the acidic phenol-chloroform guanidine thyocyanate method described by Chirgwin et al.19 Total RNAs were suspended in sterile deionized diethylpyrocarbonate (DEPC)-treated water, and aliquots were prepared and stored at -80°C. Total RNA recover)' was measured by spectrophotometric absorbance at 260 nm.

IOVS, May 1999, Vol. 40, No. 6 RT-PCR for GR Total RNA (5 jag) was reversed transcribed in a 30-/xl reaction mixture containing 20 mM Tris-HCl (pH 8.3), 50 mM KC1, 5 mM MgCl2, 10 mM dithiothreitol, 1 mM concentration of each deoxyribonucleoside triphosphate (dNTP), 1 jag oligo(dN), 1 /xg oligo(dT), 24 U RNAsin (Promega, Madison, WI), and 200 U Moloney murine leukemia virus reverse transcriptase (Gibco) at 37°C for 1 hour. The reaction was terminated by heating at 90°C for 5 minutes, and samples were quick-chilled on ice. Onefifthof the RT reaction was used for the PCR amplification of the human GR. The reaction mixture consisted of 16 mM Tris-HCl (pH 8.3), 40 mM KC1, 1 mM MgCl2, 0.2 mM concentration of each dNTP, 50 picomoles sense primer (ATGAGACCAGATGTAAGCTC), 50 picomoles of antisense primer (AATGCCATAAGAAACATCCA), and 1 U Taq polymerase (Perkin Elmer-Cetus, Norwalk, CT). The primers were synthesized by Gibco Life Technology from previously published sequences.20 The amplification profile consisted of denaturation at 94°C for 4 minutes, annealing at 55°C for 2 minutes, and extension at 72°C for 3 minutes for the first cycle, followed by denaturation at 94°C for 1 minute 30 seconds, annealing at 55°C for 2 minutes, and extension at 72°C for 3 minutes for 29 cycles after an initial denaturation step at 95°C for 5 minutes. A 30-cycle amplification was completed, followed by a final extension step at 72°C for 10 minutes. The amplification was performed in a DNA thermal cycler (model 480; Perkin Elmer-Cetus). The PCR product (588 bp) was sequenced and exhibited 100% homology with the sequence from 1262 to 1949 of the a and /3 glucocorticoid receptor, named HSGCRAR and HSGCRBR, respectively, in GenBank. PCR Product Analysis Five microliters of PCR samples were electrophoresed on 1% agarose gels in 90 mM buffer containing Tris borate and 2 mM EDTA. A 100-bp DNA ladder was routinely introduced (Gibco life Technology) as a size marker. Gels were stained with ethidium bromide and photographed under an UV lamp (665 film; Polaroid, Cambridge, MA).21 RT-PCR Control Samples A negative control was routinely introduced in all assays to confirm the absence of contamination. For these controls, RNA was omitted from the RT reaction mixture, and the reverse transcription was performed as described. PCR amplification was performed in the same conditions as the samples. Human CHP 212 neuroblastoma cells known to express the GR were used as a positive control.22 Immunocytochemistry Second- and third-passage keratocytes were studied by indirect immunoperoxidase staining. A monoclonal mouse anti-human GR was used (dilution 1:100, Serotec MCA 1390, Oxford, UK). Keratocytes were grown onto glass slides, washed two times in PBS, and fixed with methanol. Incubation with the primary anti-GR monoclonal antibody dilution was followed with the peroxidase-labeled anti-mouse antibody (PO447; Dako, Glostrup, Denmark). After three washings, the color reaction was developed (VIP; Vector, Burlingame, CA). MTS Assay 3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxy-methoxyphenyl)-2(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) and phenazine

Dexamethasone's Effects on Human Keratocytes

IOVS, May 1999, Vol. 40, No. 6

1063

humidified atmosphere with 5% CO 2 for 2 hours, 100 ju,l supernatant was diluted in 1 ml deionized water. The optical density was measured at 490 nm by means of spectrophotometry. Keratocyte growth was analyzed by means of MTS assay after 2, 4, and 6 days of culture. Keratocyte proliferation was analyzed with a hemocytometer and a cell counter (Coulter Electronics, Hialeah, FL).

Apoptosis Assay

2072

1000 600

We also looked for DEX-induced cell apoptosis. The early phase of apoptosis was studied by keratocyte staining with a fluorescein conjugate of annexin V (AV) and with propidium iodide (PI), by using an AV fluorescein isothiocyanate kit (Immunotech, Marseille, France). The procedure recommended by the manufacturer was followed, and cells were analyzed by flow cytometry (FACSCalibur, Becton Dickinson, Rungis, France). For each specimen, at least 12,000 cells were analyzed. Annexin V exhibits high, selective affinity for phosphatidylserine. In the viable cell, phosphatidylserine is localized predominantly in the membrane leaflet facing the cytosol. It appears at the cell surface during apoptosis. Annexin V fluorescein isothiocyanate stains apoptotic cells with no plasma niembrane damage and cells with disrupted plasma membrane (i.e., necrotic cells and late-phase apoptotic cells), whereas PI stains only cells with disrupted plasma membrane. The dot plot of

300

100 FIGURE 1. Electrophoretic profile of the human glucocorticoid receptor product obtained from RT-PCR. Five micrograms total RNA from cultured keratocytes were reverse-cranscribed using oligo(dN) and oligo(dT) primers. The obtained cDNA were electrophoresed on a 1% agarose gel, and the bands were visualized by ethidium bromide staining. Lanes 1 and 2: human cultured keratocytes; lane 3'- human CHP 212 neuroblastoma cells, known to express the glucocorticoid receptor (positive control); lane —: PCR negative control; lane M: 100-bp DNA ladder.

methosulfate (PMS) were obtained from Promega and Sigma, respectively. MTS is a tetrazolium salt that undergoes a color change caused by its bioreduction into a water-soluble formazan. The conversion of MTS into the aqueous-soluble formazan is accomplished by dehydrogenase enzymes found in active mitochondria and is such that the reaction occurs only in living cells. 23 The quantity of formazan product measured by the amount of 490-nm light absorbance is directly proportional to the number of living cells in culture. MTS (2 mg/ml; pH 6.5) was dissolved in PBS and filter sterilized. A 3 mM PMS solution was also prepared (in PBS) and filter sterilized. These solutions were stored at -20°C in light-protected containers. To enhance the cellular reduction of MTS, PMS was added to MTS immediately before use (MTS-to-PMS ratio, 1:20). The mixture (150 fxl) was added to each well. After incubation at 37°C in a

FIGURE 2. Immunostaining of cultured keratocytes with monoclonal anti-human glucocorticoid receptor antibody. Cultured keratocytes showed positive staining for glucocorticoid receptor (A) compared with control (B). Inverted microscopy. Bar, 30 jam.

1064

Bourcier et al.


1200 T

1000 •

o

800 -

ON ••->

a 600 -

a o

400 •

CO

H

200 •

0 -I Control

I0-I0M

I0-9M

I0-8M

I0-7M

10-6M

10-5M

I0-4M

DXM concentration FIGURE 3. Keratocyte proliferation studied by MTS assay. Human keratocytes were cultured with various concentrations of DEX diluted in 0.1% final absolute ethanol (10~ 4 , 10~ 5 , 10~ 6 , 10" 7 , 10~ 8 , 10~ 9 , and 1 0 " l 0 M; DXM, dexamethasone) for 6 days. Results of MTS assay are expressed in optical density, which was measured at 490 nm by means of spectrophotometry. Bars represent SD of the mean (« = 6 for each group). The control group consisted of keratocytes cultured in charcoal-treated THF with absolute ethanol with no DEX. After 6 days of culture with desteroidized FCS, DEX induced a dose-dependent increase in keratocyte proliferation at concentrations ranging from 10~ 9 to 10~ 5 M. The maximum proliferative effect was observed at 10~ 7 M. In the 10~ 7 M DEX group, keratocyte proliferation was three times higher than in the control group (JP < 0.005). However, lO" 4 M DEX had an inhibitory effect on cell growth (P < 0.05), whereas 1O~10 M DEX had no significant effect. Significantly different from the control group by the Wilcoxon rank sum test: *P < 0.05; "P < 0.005.

results of AV versus PI staining allows three distinct cell populations to be set apart. AV—/PI— cells were considered to be viable. AV+/PI— cells were considered to be apoptotic (early phase). AV+/PI+ cells were considered to be necrotic. Third-passage keratocytes were treated each day during 6 days with three concentrations of DEX (10~10, 10~7, and 10~4 M) before apoptosis assay. Control samples consisted of keratocytes cultured in THF medium with no ethanol and keratocytes cultured in THF with 0.1% absolute ethanol. After trypsinization, cells were processed for flow cytometry. All experiments were reproduced six times.

Statistical Analysis Data were analyzed by analysis of variance, the Wilcoxon rank sum test, and the Dunnett test. Commercial software (SPSS ver. 6.1.3; SPSS, Chicago, IL) was used for statistical analysis. RESULTS Expression of GR mRNA was detected in cultured human keratocytes. A unique PCR product of 640 nucleotides was detected with ethidium bromide after gel electrophoresis (Fig. 1). The size of this band was consistent with the expected fragment size, determined from the human GR cDNA.24 Anal-

ysis of this qualitative profile showed that GR mRNA was present in human cultured keratocytes. Specific intracellular staining of GR was observed in cultured keratocytes (Fig. 2). After 6 days of culture with desteroidized FCS, DEX induced a dose-dependent increase in keratocyte proliferation at concentrations ranging from 10~9 to 10~5 M (Fig. 3). The maximum proliferative effect was observed at 10~7 M. In the 10 M DEX group, keratocyte proliferation was three times higher compared with that in ethanol-treated control samples (P < 0.005). However, 10~4 M DEX had an inhibitory effect on cell growth (P < 0.005), whereas 1O~10 M DEX had no significant effect. There were no significant effects of DEX at days 2 and 4 (data not shown). Keratocyte proliferation was significantly higher when untreated FCS was used in culture medium compared with desteroidized FCS (P < 0.001). The maximal proliferative effect at day 6 was obtained with 10~8 M DEX in presence of untreated FCS and 10~7 M DEX when desteroidized serum was used. All the results of the MTS assay were confirmed by the cell counter and hemocytometer proliferation assays (data not shown). The addition of 10~5 M RU38486 alone to the culture medium significantly inhibited keratocyte proliferation, compared with the effect of ethanol control treatment (P = 0.0039). It also inhibited the DEX proproliferative effect (P =



1065

Group

FIGURE 4. RU38486 antagonist effect. RU38486 (mifepristone) is an 11 substituted 19-norsteroid steroid antagonist that has been shown to have antiprogesterone effects (when used at low concentrations) and antiglucocorticosteroid effects (when used at high concentrations). Human keratocytes were cultured for 6 days. Four groups were compared: 10~7 M DEX diluted in 0.1%finalabsolute ethanol (DXM, dexamethasone), 10~5 M RU38486 (RU) diluted in absolute ethanol, 10"7 M DEX + 1CT5 M RU38486 diluted in 0.1% final absolute ethanol (DXM/RU), and 0.1% absolute ethanol with no DEX and no RU38486 (Control). Results are expressed in optical density that was measured at 490 nm by means of spectrophotometry. Bars represent SD of the mean (« = 6 for each group). The proproliferative effect of 10~7 M DEX was inhibited by addition of 10"5 M RU38486 to the culture medium (P = 0.0039). The addition of 10~5 M RU38486 alone to the culture medium significantly inhibited keratocyte proliferation compared with the effect of ethanol control treatment (P = 0.0039). There was no significant difference between the ethanol-treated control group and the RU38486+DEX group (P = 0.07). 'Significantly different (P < 0.005) from the control group by the Dunnett test.

0.0039). There was no significant difference between the effect in the ethanol control group and that in the RU38486+DEX group (P = 0.07; Fig. 4). The percentage of viable cells decreased when DEX was added to the culture medium (Fig. 5A). There was no statistical difference in keratocyte viability between the THF group and the ethanol group (control group). Keratocyte apoptosis and necrosis were significantly enhanced by addition of DEX, whatever the concentration vised. More intense apoptosis was observed in the 1O~10 M DEX group (Fig. 5B). Necrotic cells, determined by flow cytometry using AV and PI, increased dose dependently with a maximal effect at 10~7 M DEX (Fig. 5Q. There were major differences in keratocyte morphology among the groups. Keratocyte density was higher in the 10~7 M DEX group and lower in the 10~4 M DEX group, compared with density in the control group (Fig. 6). Most of the keratocytes cultured in the presence of 10~7 M DEX were elongated, spindle shaped, and parallel to the bottom of the well. On the contrary, most of the keratocytes cultured in 10""' M DEX had a stellate morphologic appearance with interconnected pseudopodial processes. Keratocytes cultured in 10~U) M DEX or THF with 0.1% ethanol had both elongated and stellate morphologies. The proportion of elongated keratocytes was higher in the 10~l() M DEX group than in control-treated cells. DISCUSSION Keratocytes play a major role in the maintenance of corneal structure and integrity. Inasmuch as stromal keratocytes pro-

duce collagen and other components of the extracellular matrix, inhibition of their proliferation in corneal wound healing may seriously affect corneal integrity. However, inhibition of keratocyte proliferation could also have a beneficial role in limiting cornea scarring or refractive regression after surgical procedures. In any case, understanding the factors that control their proliferation, apoptosis, and the modulation of these effects by specific drugs is critical for successful therapeutic interventions. We observed a dose-dependent effect of DEX on keratocyte proliferation with growth stimulation at low concentrations (10~6-10~9 M) and inhibition at high concentrations (10 M). The similar dose-response curves for the hemocytometer cell count and the MTS assay provided evidence that they measured the same proliferative effect under our experimental conditions. The proliferative effect of DEX was observed in the presence of desteroidized FCS, indicating that it depended only on exogenous steroids. Keratocyte proliferation, even in the absence of DEX treatment, was lower in cultures treated with desteroidized FCS than in those treated with nondesteroidized FCS. This result was probably the consequence of dextran charcoal treatment, which eliminates serum steroids. However, we cannot exclude that dextran charcoal removes other components of the serum, such as small molecules and hormones.25 The apparent paradoxical effect of DEX on human keratocytes (i.e., proliferation after exposure to low doses of DEX and inhibition of growth after exposure to high doses) has been reported for rabbit conjunctiva! cells, dermal fibroblasts,10 and

1066

Bourcier et al.


100 -I

95 -

90 -

«n

85 •

15 80

75 -

70 -

65 -

60 THF

Control

I0-10M

10-7M

10-4M

10-7M

10-4M

Group 10

1

9-

7 -

5

6-

•is

to 5 a

©

4 -

2-

I-

THF

B

Control

10-10M

Group

FIGURE 5- Apoptosis assay. Results are expressed for viable cells (A), apoptotic cells (B), and necrotic cells (C) in percentage of cells (mean ± SD). Apoptosis was significantly enhanced by addition of 10~ 4 M (P = 0.0103), 1 0 " 7 M (P = 0.0103), and 1 0 " l 0 M (P = 0.0039) DEX to the culture medium. Keratocyte necrosis was also significantly enlianced by addition of DEX to the culture medium. There was no statistical difference in keratocyte viability between the THF group and the ethanol group (P = 0.259). Significantly different from the control group by the Wilcoxon rank sum test: *P < 0.05; **P < 0.005.

Dexamethasone's Effects on Human Keratocytes 1067

IOVS, May 1999, Vol. 40, No. 6 25 -,

20

15

10 -

5-

0THF

Control

I0-10M

10-7M

I0-4M

Group FIGURE 5.

retinal pigment epithelial cells,26 but never for keratocytes. In fact, low concentrations of DEX or other steroids have not been tested with cultured human keratocytes. Furthermore, previous studies used high DEX concentrations (10~4, 10~3 M), close to eye-drop concentrations, which had a direct, nonspecific, toxic effect, leading to the death of cultured keratocytes.8 " Thus, low doses of DEX could have a mitogenic effect on cultured human keratocytes. With several growth factors, such as tumor necrosis factor-a, the effect of the cytokine on the cell is dependent on nuclear factor (NF) KB activation.27 We could thus hypothesize that the same situation applies to stimulation of the GR. The in vitro effect of DEX could be dependent on the overall milieu of the keratocyte cell related to the activation status of NFKB. Different concentrations of DEX may be evaluated in vivo to test whether glucocorticoid could promote stromal wound healing. Experiments to test the maximal anti-inflammatory DEX concentration that would not affect corneal wound healing should also be forthcoming. Inasmuch as the effect of DEX on cultured keratocytes was dose and time dependent, we hypothesized that it was mediated through the specific intracellular GR. The GR is in fact a direct signal transducer, binding to its cognate hormonal ligand and subsequently regulating specific gene transcription. We first used RU38486 (mifepristone), an 11 substituted 19norsteroid steroid antagonist, which has shown antiprogesterone and antiglucocorticosteroid effects in humans.18 Its action mechanism involves high-affinity binding to intracellular receptors of the glucocorticosteroids (when used at high concentrations) and progesterone (at high and low concentrations). That RU38486 inhibits the DEX-induced proliferative effect provides

(Continued^)

pharmacologic evidence of the existence of GR in keratocytes. Our RT-PCR results showed that GR mRNA was present in human cultured keratocytes. Immunocytochemistry results showed the presence of receptor protein and confirmed that GR mRNA is physiologically relevant in human keratocytes. Sites for GRs have been shown by binding method in bovine and rabbit corneas and irisciliary bodies.28'29 Southren et al.3 M DEX group than in the control group. Bar, 35 /xm.

dated with corneal refractive surgery. 35 This event could be considered an initiating factor of the wound-healing response.*6 The keratocytes that die are thought to be replaced by proliferation of activated keratocytes producing large amounts

of disorganized collagen. 3 ' By increasing keratocyte apoptosis, DEX could paradoxically increase keratocyte activation and a wound-healing response. However, normal type I and IV collagens have been found to be increased after DEX treattnent of corneal alkali burns. 38 Moreover, apoptosis, which is consid-



1069

6. (Continued)

ered a controlled form of cell death, induces little or no inflammation compared with necrosis. The surrounding tissue could thus be protected from the release of degradative cytokincs, and apoptosis could constitute a way for keratocytes to regulate their own growth. Such a regulation process has been described in corneal epithelial cells36 and in other cells including hepatocytes.39'40 In any case, gluco-induced apoptosis provides further evidence for the existence of GR on keratocytes, because it is well established that normal GR function is required for gluco-induced apoptosis.3 A number of investigators have postulated that glucocorticoid treatment may trigger apoptosis by enhancing the transcription of a specific "lysis gene" or "death gene." Recently, evidence that transcriptional induction, rather than repression, mediates gluco-induced apoptosis has been provided by anal-

ysis of mutant glucocorticoid receptors that produce resistance to gluco-induced apoptosis/'1 It is also possible that glucocorticoid may induce apoptosis by inhibiting expression of as yet unidentified "survival genes" and proteins implicated in the programmed cell death process. In conclusion, we have shown the expression of the GR in cultured human keratocytes. Such a receptor is functional because DEX significantly increased keratocyte proliferation, apoptosis, and necrosis of human cultured corneal keratocytes.

Acknowledgments The authors thank Visnja Sabolic, Chnntal Martinache, and Santos Carvajal-Gonzalez for technical assistance.

1070

Bourcier et al.

References 1. Marques EF, Leite EB, Cunha-Vaz JG. Corticosteroids for reversal of myopic regression after photorefractive keratectomy. / Refract Surg. 1995;11:S3O2-S3O8. 2. Polack FM, Rosen PN. Topical steroids and tritiated thymidine uptake. Arch Ophthalmol. 1967;77:400-404. 3. Waterbury L, Kunysz EA, Beuerman R. Effects of steroidal and non-steroidal anti-inflammatory agents on corneal wound healing. / Ocul Pharmacol. 1987:3:43-54. 4. Srinivasan BD, Kulkarni PS. The effect of steroidal and nonsteroidal anti-inflammatory agents on corneal re-epithelialization. Invest Ophthalmol Vis Sci. 1981 ;20:688- 691. 5. Park SC, Kim JH. Effect of steroids and nonsteroidal anti-inflammatory agents on stromal wound healing following excimer laser keratectomy in rabbits. Ophthalmic Surg Lasers. 1996;27:481486. 6. Sugar A, Borosky JE, Meyer RF. A randomised trial of topical corticosteroids in epithelial healing after keratoplasty. Cornea. 1984;3:268-271. 7. Rask R, Koch Jensen P, Ehlers N. Healing velocity of corneal epithelium evaluated by computer. The effect of topical steroid. Ada OphthalmolScand. 1995;73:l62-l65. 8. Lu KL, Wee WR, Sakamoto T, McDonnell PJ. Comparison of in vitro antiproliferative effects of steroids and nonsteroidal antiinflammatory drugs on human keratocytes. Cornea. 1996;15:185190. 9. Blumenkranz MS, Claflin A, Hajek AS. Selection of therapeutic agents for intraocular proliferative disease: cell culture evaluation. Arch Ophthalmol. 1984;102:598-604. 10. Fiscella R, Peyman GA, Elvart J, Yue B. In vitro evaluation of cellular inhibitory potential of various antineoplastic drugs and dexamethasone. Ophthalmic Surg. 1985:16:247-249. 11. Nguyen KD, Lee DA. Effect of steroids and nonsteroidal antiinflammatory agents on human ocular fibroblast. Invest Ophthalmol Vis Sci. 1992;33:2693-2701. 12. Distelhorst CW. Glucocorticoid-induced apoptosis. Adv Pharmacol. 1991A 1:247-270. 13. Wilson SE, Kim WJ. Keratocyte apoptosis: implications on corneal wound healing, tissue organization, and disease. Invest Ophthalmol Vis Sci. 1998;39:220-226. 14. Helena MC, Baerveldt F, Kim WJ, Wilson SE. Keratocyte apoptosis after corneal surgery. Invest Ophthalmol Vis Sci. 1998:39:276283. 15. Mangelsdorf DJ, Thummel C, Beato M, et al. The nuclear receptor superfamily: the second decade. Cell. 1995;83:835-839. 16. Borderie VM, Lopez M, Lombet A, et al. Cryopreservation and culture of human corneal keratocytes. Invest Ophthalmol Vis Sci. 1998;39:1511-1519. 17. Ruedl C, Cappelletti V, Coradini D, Granata G, Di Fronzo G. Influence of culture conditions on the oestrogenic cell growth stimulation of human breast cancer cells. / Steroid Biochem Mot Biol. 1990;37:195-200. 18. Cadepond F, Ulmann A, Baulieu EE. RU486 (mifepristone): mechanisms of action and clinical uses. Anna Rev Med. 1997;48:129156. 19. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. 1979;18:5294-5299. 20. Wilson SE, Lloyd SA, He YG, McCash CS. Extended life of human corneal endothelial cells transfected with the SV40 large T antigen. Invest Ophthalmol Vis Sci. 1993:34:2112-2123. 21. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 198922. Trapp T, Rupprecht R, Castren M, Reul JM, Holsboer F. Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron. 1994;13:l457-l462.

IOVS, May 1999, Vol. 40, No. 6 23. Cell Titer 96 Aqueous Non-radioactive Cell Proliferation Assay. Technical Bulletin 169- Madison, WI: Promega Corporation, 1994. 24. Hollenberg SM, Weinberger C, Hong ES, et al. Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature. 1985;318:635-64l. 25. Boxen I, Tevaarwerk GJ. Charcoal as a phase separating agent in ligand assays: mechanism of action and the effect of dextran and various protein on the adsorption of small molecules. / Immunoassay. 1982;3:53-72. 26. He S, Wang HM, Ye J, Ogden TE, Ryan SJ, Hinton DR. Dexamethasone induced proliferation of cultured retinal pigment epithelial cells. CurrEyeRes. 1994;13:257-26l. 27. Shimoyama M, Shimmura S, Tsubota K, Oguchi Y. Suppression of nuclear factor kappa B and CD18-mediated leukocyte adhesion to the corneal endothelium by dexamethasone. Invest Ophthalmol Vis Sci. 1997:38:2427-2431. 28. Lin MT, Eiferman RA, Wittliff JL. Demonstration of specific glucocorticoid binding sites in bovine cornea. Exp Eye Res. 1984;38: 333-339. 29. Cheeks L, Green K. Distribution of a steroid antagonist in the eye following topical administration. Curr Eye Res. 1986;5:705-70930. Southren AL, Dominguez MO, Gordon GG, et al. Nuclear translocation of the cytoplasmic glucocorticoid receptor in the irisciliary body and adjacent corneoscleral tissue of the rabbit following topical administration of various glucocorticoids: a rapid screening method for glucocorticoid activity. Invest Ophthalmol Vis Sci. 1983:24:147-152. 31. Guizani L, Perrin-Wolff M, Breard J, Binetruy B, Bertoglio J. Mechanisms in interleukin-2 protection against glucocorticoid-induced apoptosis: regulation of AP-1 and glucocorticoid receptor transcriptional activities, f Interferon CytokineRes. 1996;l6:601-609. 32. Fenz Z, Marti A, Jehn B, Altermatt HJ, Chicaiza G, Jaggi R. Glucocorticoid and progesterone inhibit involution and programmed cell death in the mouse mammary gland. / Cell Biol. 1995;131: 1095-1103. 33- Yamamoto M, Fukuda K, Miura N, Suzuki R, Kido, Komatsu Y. Inhibition by dexamethasone of transforming growth factor beta 1-induced apoptosis in rat hepatoma cells: a possible association with Bcl-xL induction. Hepatology. 1998;27:959-966. 34. Wyllie AH. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activity. Nature. 1980;284: 555-556. 35- Wilson SE, He YG, Weng J, et al. Epithelial injury induces keratocyte apoptosis: hypothesized role for the interleukin-1 system in the modulation of corneal tissue organization and wound healing. Exp Eye Res. 1996;62:325-338. 36. Wilson SE. Molecular cell biology for the refractive corneal surgeon: programmed cell death and wound healing. / Refract Surg. 1997:13:171-175. 37. Hanna KD, Pouliquen YM, Waring GO III, Savoldelli M, Fames F, Thompson KP. Corneal wound healing in monkeys after repeated excimer laser photorefractive keratectomy. Arch Ophthalmol. 1992;110:1286-1291. 38. Chung JH, Park YK, Lee JS, Kim WH. Effect of 0.1% dexamethasone on expression of stromal collagen type I and IV mRNA during the repair process of corneal alkali wounds [ARVO Abstract]. Invest Ophthalmol Vis Sci. 1998;39(4):S755. Abstract nr 3482. 39. Tzung SP, Fausto N, Hockenbery DM. Expression of Bcl-2 family during liver regeneration and identification of Bcl-x as a delayed early response gene. Amf Pathol. 1997;150:1985-199540. Trautwein C, Rakemann T, Malek NP, Plumpe J, Tiegs G, Manns MP. Concanavalin A-induced liver injury triggers hepatocyte proliferation. / Clin Invest. 1998;101:1960-1969. 41. Dieken ES, Miesfeld RL. Transcriptional transactivation functions localized to the glucocorticoid receptor N terminus are necessary for steroid induction of lymphocyte apoptosis. Mol Cell Biol. 1992;12:589-597.