APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2010, p. 370–374 0099-2240/10/$12.00 doi:10.1128/AEM.01553-09 Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Vol. 76, No. 1
Increased Glucose Utilization in Corynebacterium glutamicum by Use of Maltose, and Its Application for the Improvement of 䌤 L-Valine Productivity Felix S. Krause,1§ Alexander Henrich,2§ Bastian Blombach,1 Reinhard Kra¨mer,2 Bernhard J. Eikmanns,1 and Gerd M. Seibold2* Institute of Microbiology and Biotechnology, University of Ulm, D-89069 Ulm, Germany,1 and Institute of Biochemistry, University of Cologne, D-50674 Cologne, Germany2 Received 2 July 2009/Accepted 24 October 2009
Corynebacterium glutamicum efficiently utilizes maltose as a substrate. We show here that the presence of maltose increases glucose utilization by raising the expression of ptsG, which encodes the glucose-specific EII permease of the phosphotransferase system. Consequently, the L-valine productivity of a pyruvate dehydrogenase complex-deficient C. glutamicum strain was improved by the presence of maltose. cose formation by a 4-␣-glucanotransferase, glucose phosphorylation by glucokinase, and maltodextrin degradation via the reactions of maltodextrin phosphorylase and ␣-phosphoglucomutase, a pathway similar to that in E. coli (20). In this study, we investigated the influence of maltose on glucose and acetate utilization by C. glutamicum. The findings then were applied to improve the L-valine productivity of a pyruvate dehydrogenase complex (PDHC)-deficient L-valine producer strain. The strains used in this study were wild-type (WT) C. glutamicum (i.e., ATCC 13032 [American Type Culture Collection]) and its L-valine-producing derivative C. glutamicum ⌬aceE ⌬pqo(pJC4ilvBNCE) (5). They were cultivated as described previously (4, 20), in baffled 500-ml shake flasks in 50 ml CGC minimal medium (9) for L-valine production in CGXII medium (12). The carbon sources were used at the concentrations indicated below. Amino acid, sugar, and acetate concentrations were determined by high-performance liquid chromatography analysis as described previously (4, 20). RNA purification, slot blot experiments, densitometric detection, signal quantification, and preparation of digoxigenin (DIG)-11-dUTP-labeled antisense ptsG RNA as a probe by in vitro transcription using primers ptsG-NB-T7_for (5⬘-CAAAC TGACGACGACATC-3⬘) and ptsG-NB-T7_rev (5⬘-GGGCC CTAATACGACTCACTATAGGGTGGCAGGAAGTAGA AGAC-3⬘ [T7 promoter sequence underlined]) and of the labeled antisense 16S RNA probe were performed as described previously (17). The overexpression plasmid pBB1 carrying Ptac was constructed using plasmid pMM36 (15). For this purpose, the Ptac promoter region of plasmid pEKEx5 (16) was amplified via PCR using primers ptacfow (5⬘-CGGGATCCC GCGAATTGCAAGC-3⬘) and ptacrev (5⬘-TCCCCCGGGAA TTGGCATGCAAG-3⬘). The resulting 335-bp fragment was cut with SmaI and BamHI (restriction sites underlined) and cloned into plasmid pMM36, resulting in pBB1. Primers ptsGfor (5⬘-CCAATGCATGGCGATCCTCTTAAGTG-3⬘) and ptsGrev (5⬘-CCAATGCATCATGGATCCCAGGTTAC3⬘) were used to amplify the ptsG gene from chromosomal DNA of C. glutamicum by PCR. The 2,155-bp fragment was cut with NsiI (restriction sites underlined) and cloned into the PstI-digested vector pBB1. The resulting vector, pBB1-ptsG,
Most bacteria cultivated in media containing two or more carbon sources adapt their metabolism to the utilization of their preferred substrate. This successive utilization of substrates is mediated by regulatory mechanisms summarized as carbon catabolite repression and is often represented by biphasic growth behavior (reviewed in references 7 and 11). Such diauxic growth can be observed, e.g., in Escherichia coli cultivated with glucose plus lactose or maltose. Corynebacterium glutamicum is a Gram-positive bacterium employed for the large-scale production of various amino acids, including the branched-chain amino acid L-valine (8). It can be cultivated on a variety of single and combined carbon and energy sources, such as sugars, organic acids, and alcohols (reviewed in reference 3). On substrate mixtures, C. glutamicum cometabolizes most of these carbon sources and shows monophasic growth. Sequential utilization of substrates by C. glutamicum causing biphasic growth has only been observed for the mixtures of glucose plus glutamate, glucose plus ethanol, and acetate plus ethanol (1, 2, 13, 14). In C. glutamicum, the uptake of glucose is catalyzed by a phosphotransferase system consisting of two universal components, EI and HPr (encoded by ptsI and ptsH, respectively), and the glucose-specific EII permease EIIGlc (encoded by ptsG; reviewed in reference 18). When C. glutamicum is cultivated on a mixture of glucose plus acetate, the glucose uptake rate is reduced about twofold compared to growth on glucose as the sole carbon source, and this effect is probably due to transcriptional repression of ptsG by SugR (10, 21). On the other hand, when C. glutamicum is grown on a mixture of glucose plus maltose, ptsG expression has been shown to be about twice as high as that observed in cells grown on glucose as the sole carbon source, and this effect was independent of SugR (10). A maltose uptake system has not been identified in C. glutamicum; however, maltose utilization proceeds via a pathway involving maltodextrin and glu-
* Corresponding author. Mailing address: Institute of Biochemistry, University of Cologne, 50674 Cologne, Germany. Phone: 49 (0)221 470 6464. Fax: 49 (0)221 470 5091. E-mail:
[email protected]. § Both authors contributed equally to this work. 䌤 Published ahead of print on 30 October 2009. 370
VOL. 76, 2010
MALTOSE BOOSTS GLUCOSE UPTAKE IN C. GLUTAMICUM
371
FIG. 1. Representative shake flask cultivations of WT C. glutamicum in CGC minimal medium initially containing 2% (wt/vol) glucose (A), 2% (wt/vol) maltose (B), 2% (wt/vol) glucose plus 2% (wt/vol) maltose (C), 2% (wt/vol) glucose plus 2% (wt/vol) acetate (D), 2% (wt/vol) maltose plus 2% (wt/vol) acetate (E), or 2% (wt/vol) glucose plus 2% (wt/vol) maltose plus 2% (wt/vol) acetate (F) as a carbon source. Symbols: F, growth; , glucose; E, maltose; ‚, acetate. Each fermentation condition was prepared in triplicate, and the results for each condition were comparable.
carrying ptsG preceded by Ptac, was verified by DNA sequencing. Growth experiments with WT C. glutamicum in minimal medium with either 2% (wt/vol) glucose or 2% (wt/vol) maltose as the sole carbon source revealed no significant differences in growth and substrate utilization (Fig. 1 A and B), as is evident from the identical growth rates, final optical densities (ODs) of 25 ⫾ 2, and similar substrate consumption rates under both cultivation conditions (Table 1). However, the use
of 2% glucose and 2% maltose combined as the substrate for cultivation caused significantly accelerated growth of WT C. glutamicum until it slowed down at an OD at 600 nm (OD600) of 15, probably due to limitations in aeration. Furthermore, an increased final OD of 42 ⫾ 2 was reached, and both sugars were completely consumed at about the same time point (9 h) as when each was used individually as the sole carbon source (Fig. 1C), which is also evident from the nearly identical substrate consumption rates (Table 1). Both sugars can be con-
372
KRAUSE ET AL.
APPL. ENVIRON. MICROBIOL.
TABLE 1. Growth rates and substrate consumption rates of WT C. glutamicum in shake flask experiments Substrated
Growth rate (h⫺1)a
Glucose Maltose Glucose ⫹ maltose Glucose ⫹ acetate Maltose ⫹ acetate Glucose ⫹ maltose ⫹ acetate
0.36 ⫾ 0.04 0.36 ⫾ 0.03 0.43 ⫾ 0.05 0.38 ⫾ 0.05 0.46 ⫾ 0.06 0.44 ⫾ 0.05
Substrate consumption rate 关mmol C/(g CDW ⫻ h)兴b Acetate
Glucose
Maltose
NDc ND ND 7.10 ⫾ 0.31 6.38 ⫾ 0.22 6.57 ⫾ 0.13
10.01 ⫾ 0.72 ND 11.53 ⫾ 0.43 4.31 ⫾ 0.27 ND 7.86 ⫾ 0.83
ND 10.12 ⫾ 1.13 9.21 ⫾ 1.22 ND 9.54 ⫾ 0.53 8.52 ⫾ 0.42
a Growth rate was calculated for the exponential phase for the first 6 h of fermentation. b CDW was calculated from the OD600 (after 6 h) by using a ratio of 0.3 g CDW liter⫺1 per unit of OD600 (4). Substrate consumption was calculated for acetate, glucose, and maltose for the first 6 h of fermentation. c ND, not detected. d All carbon sources were used at a concentration of 2% (wt/vol).
sumed in parallel, excluding the presence of catabolite repression by glucose of maltose metabolism, as observed for E. coli (7, 11). So far, coutilization of substrates such as glucose and acetate has already been reported for C. glutamicum; however, a similar increase in growth rate, as shown in Table 1 for a mixture of glucose and maltose, so far was not observed with other substrate mixtures (3, 21). To examine the effects of maltose addition on ptsG expression in C. glutamicum, we performed RNA slot blot experiments with labeled ptsG RNA as the probe. By addition of maltose to the culture broth, ptsG expression was increased to about 125% compared to the expression level during cultivation with glucose as the sole carbon source (Fig. 2). A similar increase in ptsG expression was observed in samples from cells cultivated with maltose as the sole carbon source (about 130%). When bacteria were cultivated with acetate as the sole carbon source, ptsG expression was reduced to about 25%. However, the reduced expression of ptsG in cells grown on acetate or on glucose plus acetate (about 45% ptsG expression) could partially be relieved by the addition of maltose to the culture broth, resulting in about 75% expression. These data match the recent observations of Engels and Wendisch (10) that the expression of a ptsG-cat fusion in C. glutamicum was highest when cells were cultivated in minimal medium with maltose as the sole carbon source. As described earlier (21), we observed that the rate of glucose consumption by C. glutamicum is lower when it is cultivated with glucose plus acetate than when it is cultivated with glucose alone (Fig. 1D; Table 1). Addition of maltose to the medium containing glucose plus acetate caused accelerated glucose utilization during the early and mid-exponential growth phases but at the same time slightly decreased acetate consumption (Fig. 1F; Table 1). Moreover, the growth rate of the culture was significantly higher than that obtained by cultivation with only glucose plus acetate. Maltose utilization itself was only slightly influenced in WT C. glutamicum by the addition of acetate to the culture broth as an additional carbon source. Under these conditions, the maltose consumption rate was not significantly reduced (Fig. 1E and F; Table 1), which is also reflected by the increase in the growth rate. Taken to-
gether, our results show that maltose is cometabolized by C. glutamicum with both glucose and acetate. As maltose increases ptsG expression, it counteracts the SugR-mediated repression of ptsG in the presence of acetate and by this means probably accelerates glucose utilization. To test whether increased ptsG expression indeed improves glucose utilization in C. glutamicum, we constructed C. glutamicum(pBB1-ptsG), which constitutively overexpresses ptsG. When cultivated in minimal medium with glucose plus acetate, C. glutamicum(pBB1-ptsG) grew faster than the control, C. glutamicum(pBB1) [growth rates of 0.42 ⫾ 0.04 h⫺1 for C. glutamicum(pBB1-ptsG) and 0.36 ⫾ 0.04 h⫺1 for C. glutamicum(pBB1-ptsG)] (Fig. 3A). In accordance with the higher growth rate, the glucose consumption of C. glutamicum(pBB1-ptsG) was also higher than that of C. glutamicum(pBB1) {3.71 ⫾ 0.31 and 2.42 ⫾ 0.24 mmol C/[g cell dry weight (CDW) ⫻ h], respectively, in the first 6 h of cultivation}, whereas the acetate consumption of both strains was nearly the same [5.71 ⫾ 0.42 and 5.73 ⫾ 0.17 mmol C/(g CDW ⫻ h)] (Fig. 3A). However, the increase in the glucose consumption rate of C. glutamicum(pBB1-ptsG) in comparison to that of C. glutamicum(pBB1) was smaller than the increase in ptsG expression (Fig. 3B), and also the effect of maltose addition on the glucose consumption rate was significantly larger than that on ptsG overexpression (Table 1). Therefore, we conclude that maltose, in addition to its effect on ptsG expression, positively affects glucose utilization in C. glutamicum. SugR-mediated repression of ptsG is responsible for the decoupling of L-valine production from growth in PDHCdeficient C. glutamicum L-valine production strains (6). Due to their PDHC deficiency, these strains require acetate for growth but depend on glucose for L-valine formation. We tested the application of the described positive effects of maltose on glucose uptake in WT C. glutamicum for the improvement of L-valine production with C. glutamicum
FIG. 2. RNA hybridization experiments with RNA isolated from WT C. glutamicum cultivated in minimal medium with the indicated carbon sources. The samples shown are from three independent cultures for each condition tested. ptsG and 16S RNA levels were monitored with DIG-labeled antisense RNA probes.
VOL. 76, 2010
MALTOSE BOOSTS GLUCOSE UPTAKE IN C. GLUTAMICUM
373
FIG. 3. Growth and substrate utilization during representative shake flask cultivations of C. glutamicum(pBB1) (filled symbols) and C. glutamicum(pBB1-ptsG) (open symbols) in CGC minimal medium initially containing 1.6% (wt/vol) glucose plus 1.4% (wt/vol) acetate (A). circles, growth; triangles, acetate; diamonds, glucose. Each fermentation condition was prepared in triplicate, and the results for each condition were comparable. RNA hybridization experiments with RNAs isolated from samples of C. glutamicum(pBB1) and C. glutamicum(pBB1-ptsG) grown in 1.6% (wt/vol) glucose plus 1.4% (wt/vol) acetate. The samples shown are from three independent cultures for each condition tested. ptsG and 16S RNA levels were monitored with DIG-labeled antisense RNA probes.
⌬aceE ⌬pqo(pJC4ilvBNCE). As shown in Fig. 4A, this strain did not produce L-valine during the exponential growth phase when cultivated with glucose plus acetate, since only minor amounts of this sugar are metabolized in this phase (Table 2). As shown by the findings on the maltose utilization of WT C. glutamicum in the presence of acetate, C. glutamicum ⌬aceE ⌬pqo(pJC4ilvBNCE) cometabolized acetate and maltose during the exponential growth phase (Table 2), resulting in efficient L-valine production during the exponential growth phase (Fig. 4B). To enable L-valine production by C. glutamicum ⌬aceE ⌬pqo(pJC4ilvBNCE) during the exponential growth phase when cultivated with mixtures of glucose and acetate, we added various concentrations of maltose to the culture broth. As shown in Fig. 4C, the addition of 0.5% (wt/vol) maltose led to efficient glucose utilization in the presence of acetate and, in fact, also to effective L-valine production during growth, with a slight decrease in the substrate specific yield (YP/S) but a significant increase in productivity (Table 2). Higher concentrations of maltose did not lead to an additional increase in productivity. A reduction to 0.1% (wt/vol) maltose in the culture broth and analysis of substrate consumption revealed that the positive effect of maltose on glucose consumption in the presence of acetate is only observable as long as maltose is present in the medium (data not shown). These results demonstrate that the application of a combination of the substrates glucose, acetate, and maltose significantly increases the productivity of a C. glutamicum L-valine
FIG. 4. L-Valine accumulation during representative shake flask fermentations of C. glutamicum ⌬aceE ⌬pqo(pJC4ilvBNCE) in CGXII minimal medium initially containing 4.5% (wt/vol) glucose plus 2% (wt/vol) acetate (A), 4.5% (wt/vol) maltose plus 2% (wt/vol) acetate (B), or 4% (wt/vol) glucose plus 0.5% (wt/vol) maltose plus 2% (wt/vol) acetate (C) as a carbon source. Symbols: F, growth; , glucose; E, maltose; ‚, acetate; 䡺, L-valine. Each fermentation condition was prepared in triplicate, and the results for each condition were comparable.
producer strain. The addition of maltose to the culture broth of C. glutamicum might also be favorable for the production of further amino acids such as L-glutamate or L-lysine. In fact, the growth rate of a recombinant L-lysine-producing strain cultivated with the substrates starch and glucose was significantly
374
KRAUSE ET AL.
APPL. ENVIRON. MICROBIOL.
TABLE 2. Growth rates, substrate consumption rates, final L-valine concentrations, and productivity of C. glutamicum ⌬aceE ⌬pqo(pJC4ilvBNCE) in shake flask fermentations Growth rate (h⫺1)b
Substrate (concn 关%兴)a
Glucose (4.5) ⫹ acetate (2) Maltose (4.5) ⫹ acetate (2) Glucose (4) ⫹ maltose (0.5) ⫹ acetate (2) Glucose (3.5) ⫹ maltose (1) ⫹ acetate (2)
Substrate consumption rate 关mmol C/ (g CDW ⫻ h)兴c
L-Valine
YP/S (g C/g C)e
Productivity 关mmol/ (g CDW ⫻ h)兴f
Acetate
Glucose
Maltose
concn (mM)d
0.20 ⫾ 0.02 0.27 ⫾ 0.01 0.27 ⫾ 0.01
5.09 ⫾ 0.08 2.25 ⫾ 0.41 2.80 ⫾ 0.22
0.13 ⫾ 0.18 ND 3.78 ⫾ 1.10
NDg 3.53 ⫾ 0.93 1.72 ⫾ 0.15
86 ⫾ 2 71 ⫾ 4 102 ⫾ 2
0.23 ⫾ 0.01 0.19 ⫾ 0.03 0.21 ⫾ 0.01
0.17 ⫾ 0.01 0.17 ⫾ 0.01 0.27 ⫾ 0.02
0.28 ⫾ 0.02
1.97 ⫾ 0.17
3.25 ⫾ 0.50
2.92 ⫾ 0.25
94 ⫾ 5
0.17 ⫾ 0.02
0.26 ⫾ 0.01
a
All percentages are in wt/vol. Growth rate was calculated for the exponential phase for the first 12 h of fermentation. CDW was calculated from the OD600 (after 12 h) by using a ratio of 0.3 g CDW liter⫺1 per unit of OD600 (4). Substrate consumption was calculated for acetate, glucose, and maltose for the first 12 h of fermentation. d The L-valine concentrations are given for the mixture of glucose plus acetate after 48 h and for maltose plus acetate and for glucose plus maltose plus acetate after 24 h. e Substrate specific yields (YP/S) are given as grams of carbon in L-valine per gram of carbon of the consumed substrates (acetate, glucose, maltose). The yields are calculated for the same time points as the L-valine concentrations. f The productivities are given for the same time points as the L-valine concentrations. g ND, not detected. b c
increased (19), possibly caused by the presence of maltose formed in the course of starch degradation by the heterologously expressed amylase. By this means, the benefits of maltose might also be applied to boost production scale amino acid fermentation with C. glutamicum without the need for the addition of rather expensive pure maltose. The support of Evonik Degussa AG, Halle-Ku ¨nsebeck, Germany, is gratefully acknowledged. REFERENCES 1. Arndt, A., and B. J. Eikmanns. 2007. The alcohol dehydrogenase gene adh in Corynebacterium glutamicum is subject to carbon catabolite repression. J. Bacteriol. 189:7408–7416. 2. Arndt, A., M. Auchter, T. Ishige, V. F. Wendisch, and B. J. Eikmanns. 2008. Ethanol catabolism in Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 15:222–233. 3. Arndt, A., and B. J. Eikmanns. 2008. Regulation of carbon metabolism in Corynebacterium glutamicum, p. 155–182. In A. Burkovski (ed.), Corynebacteria: genomics and molecular biology. Caister Academic Press, Norfolk, United Kingdom. 4. Blombach, B., M. E. Schreiner, J. Hola ´tko, T. Bartek, M. Oldiges, and B. J. Eikmanns. 2007. L-Valine production with pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum. Appl. Environ. Microbiol. 73: 2079–2084. 5. Blombach, B., M. E. Schreiner, T. Bartek, M. Oldiges, and B. J. Eikmanns. 2008. Corynebacterium glutamicum tailored for high-yield L-valine production. Appl. Microbiol. Biotechnol. 79:471–479. 6. Blombach, B., A. Arndt, M. Auchter, and B. J. Eikmanns. 2009. L-Valine production during growth of pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum in the presence of ethanol or by inactivation of the transcriptional regulator SugR. Appl. Environ. Microbiol. 75:1197–1200. 7. Deutscher, J. 2008. The mechanisms of carbon catabolite repression in bacteria. Curr. Opin. Microbiol. 11:87–93. 8. Eggeling, L., and M. Bott. 2005. Handbook of Corynebacterium glutamicum. CRC Press, Inc., Boca Raton, FL. 9. Eikmanns, B. J., N. Thum-Schmitz, D. Reinscheid, M. Kirchner, and H. Sahm. 1991. Amplification of three threonine biosynthesis genes in Corynebacterium glutamicum and its influence on carbon flux in different strains. Appl. Microbiol. Biotechnol. 34:617–622.
10. Engels, V., and V. F. Wendisch. 2007. The DeoR-type regulator SugR represses expression of ptsG in Corynebacterium glutamicum. J. Bacteriol. 189: 2955–2966. 11. Go ¨rke, B., and J. Stu ¨lke. 2008. Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat. Rev. Microbiol. 6:613– 624. 12. Keilhauer, C., L. Eggeling, and H. Sahm. 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon. J. Bacteriol. 175:5595–5603. 13. Kotrbova-Kozak, A., P. Kotrba, M. Inui, J. Sajdok, and H. Yukawa. 2007. Transcriptionally regulated adhA gene encodes alcohol dehydrogenase required for ethanol and n-propanol utilization in Corynebacterium glutamicum R. Appl. Microbiol. Biotechnol. 76:1347–1356. 14. Kra ¨mer, R., C. Lambert, C. Hoischen, and H. Ebbinghausen. 1990. Uptake of glutamate in Corynebacterium glutamicum. 1. Kinetic properties and regulation by internal pH and potassium. Eur. J. Biochem. 194:929–935. 15. Merkamm, M., C. Chassagnole, N. D. Lindley, and A. Guyonvarch. 2003. Ketopantoate reductase activity is only encoded by ilvC in Corynebacterium glutamicum. J. Biotechnol. 104:253–260. 16. Micklinghoff, J. C., K. J. Breitinger, M. Schmidt, R. Geffers, B. J. Eikmanns, and F.-C. Bange. 2009. The role of the transcriptional repressor RamB (Rv0465c) in control of the glyoxylate cycle in Mycobacterium tuberculosis. J. Bacteriol. 191:7260–7269. 17. Mo ¨ker, N., M. Brocker, S. Schaffer, R. Kra ¨mer, S. Morbach, and M. Bott. 2004. Deletion of genes encoding the MtrA-MtrB two-component system of Corynebacterium glutamicum has a strong influence on cell morphology, antibiotics susceptibility and expression of genes involved in osmoprotection. Mol. Microbiol. 54:420–438. 18. Moon, M. W., S. Y. Park, S. K. Choi, and J. K. Lee. 2007. The phosphotransferase system of Corynebacterium glutamicum: features of sugar transport and carbon regulation. J. Mol. Microbiol. Biotechnol. 12:43–50. 19. Seibold, G., M. Auchter, S. Berens, J. Kalinowski, and B. J. Eikmanns. 2006. Utilization of soluble starch by a recombinant Corynebacterium glutamicum strain: growth and lysine production. J. Biotechnol. 124:381–391. 20. Seibold, G. M., M. Wurst, and B. J. Eikmanns. 2009. Roles of maltodextrin and glycogen phosphorylases in maltose utilization and glycogen metabolism in Corynebacterium glutamicum. Microbiology 155:347–358. 21. Wendisch, V. F., A. A. de Graf, H. Sahm, and B. J. Eikmanns. 2000. Quantitative determination of metabolic fluxes during coutilization of two carbon sources: comparative analyses with Corynebacterium glutamicum during growth on acetate and/or glucose. J. Bacteriol. 182:3088–3096.
