Arch Virol (2009) 154:1101–1110 DOI 10.1007/s00705-009-0416-7
ORIGINAL ARTICLE
Influenza A virus matrix protein 1 interacts with hTFIIIC102-s, a short isoform of the polypeptide 3 subunit of human general transcription factor IIIC Shengping Huang Æ Jingjing Chen Æ Huadong Wang Æ Bing Sun Æ Hanzhong Wang Æ Zhiping Zhang Æ Xianen Zhang Æ Ze Chen
Received: 1 February 2009 / Accepted: 28 May 2009 / Published online: 12 June 2009 Ó Springer-Verlag 2009
Abstract Influenza A virus matrix protein 1 (M1) is a multifunctional protein that plays important roles during replication, assembly and budding of the virus. To search for intracellular protein components that interact with M1 protein and explore the potential roles of these interactions in the pathogenesis of influenza virus infection, 11 independent proteins, including hTFIIIC102-s protein, encoding a short isoform of the TFIIIC102 subunit of the human TFIIIC transcription factor, were screened from a human cell cDNA library using a yeast two-hybrid technique. The interaction between M1 protein and hTFIIIC102-s was studied in more
detail. Mapping assays showed that the N-terminal globular region (amino acids 1–164) of the M1 protein and the five tandem tetratricopeptide repeats (TPR1-5, amino acids 149– 362) in hTFIIIC102-s were necessary for the interaction. The interaction was confirmed by both glutathione-S-transferase (GST) pull-down assays and coimmunoprecipitation assays. In addition, coexpression of hTFIIIC102-s with M1 in HeLa cells inhibited the translocation of M1 into the nucleus. Taken together, the present data indicate that hTFIIIC102-s can interact with the structural M1 protein of the influenza virus, which provides a novel clue toward further understanding of the roles of M1 protein in the interactions between influenza virus and host cells.
S. Huang and J. Chen contributed equally to this work. S. Huang J. Chen Huadong Wang Hanzhong Wang Z. Zhang X. Zhang Z. Chen (&) State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, 430071 Wuhan, Hubei, China e-mail:
[email protected];
[email protected] Z. Chen College of Life Science, Hunan Normal University, 410081 Changsha, China Z. Chen Shanghai Institute of Biological Products, 200052 Shanghai, China B. Sun Institute Pasteur of Shanghai, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 200025 Shanghai, China S. Huang J. Chen Graduate University of Chinese Academy of Sciences, 100049 Beijing, China
Introduction The M1 protein of influenza A virus is encoded by segment 7 of the viral RNA [1]. It is the most abundant component of virions and forms a membrane matrix between ribonucleoprotein (RNP) cores and the lipid envelope [2]. M1 protein consists of N (N-terminus), M (middle) and C (C-terminus) domains [3]. The N-terminal globular region consisting of the N and M domains is linked to the C-terminal globular region consisting of the C domain by a protease-sensitive loop. During expression and purification of M1 protein, the two globular regions are frequently cleaved by proteases [4]. X-ray crystallography has revealed nine a-helices linked by eight loops in the N-terminal globular region (amino acids 1–164) of M1 protein [3–5], among which helices H1–H4 are located in the N domain and helices H6–H9 are in the M domain. It is speculated that a-helices and loops are also present in the C-terminal globular region (amino acids 165– 252) of the M1 protein, which has not been examined by X-ray diffraction tests [6].
123
1102
M1 is not only the major structural protein of influenza virions, but also a key adaptor molecule for virus–host cell interactions [7]. After entry of the virus through endosomal vesicles, the M1 protein undergoes a pH-dependent conformational change that results in the release of viral RNPs into the cytoplasm [8, 9], thereby playing an important role in regulating the transport of viral RNPs from the cytoplasm to the nucleus. In the later stages of virus infection, synthesis of all the viral mRNAs decreases markedly, and almost all of the biological activity of the polymerase complexes changes to synthesis of viral genomic RNA. This uncoupling of transcription and replication is due to the effects of M1 protein [10]. In the late stages of infection, the M1 protein mediates nuclear export of RNP complexes. The nuclear accumulation of M1 protein is a prerequisite for nuclear export of newly synthesized viral RNPs [11]. In addition to its RNP-binding properties, the M1 protein is known to associate with membranes [12, 13]. For this reason, the M1 protein is generally considered to be a key factor for mediating the transport of viral RNPs to the cytoplasmic membrane, which is a prerequisite for assembly and budding of the virus [14]. In addition, the M1 protein plays important roles in influencing the virulence of the virus [15, 16] and controlling the shape of influenza virus particles [17]. Despite this, the roles of the M1 protein in the pathogenesis of influenza H5N1 virus infection remain unclear. In the present study, we screened for cellular protein components that interact with M1 protein of the influenza H5N1 virus, which has frequently caused infections in humans in recent years, using a yeast two-hybrid technique. The identification of cellular protein components that interact with influenza H5N1 virus M1 protein will be very helpful toward understanding the pathogenic mechanism of virus infection and for rational design of antiviral drugs [18]. A total of 11 cellular proteins that specifically interact with influenza H5N1 virus M1 protein were screened in this study, and the interaction between M1 protein and hTFIIIC102-s was subjected to further analyses by both GST pull-down and coimmunoprecipitation assays. Furthermore, the domains involved in the interaction between the M1 protein and hTFIIIC102-s were identified, and the distribution of M1 protein and hTFIIIC102-s in HeLa cells was examined. The results provide a basis for further studies of the roles of M1 protein after influenza virus infection in host cells.
Materials and methods Virus, cells and cDNA library The highly pathogenic influenza A virus (A/Chicken/ Henan/12/2004(H5N1)) strain was isolated and preserved
123
S. Huang et al.
by our laboratory. All of the assays associated with the highly pathogenic avian influenza H5N1 virus were performed in a biosafety level 3 laboratory at Wuhan Institute of Virology, Chinese Academy of Sciences. 293T and HeLa cells were cultured in DMEM (Gibco) containing 10% fetal bovine serum (FBS; Gibco). A Matchmaker human kidney pretransformed cDNA library was purchased from Clontech. Plasmid construction The primers for construction of recombinant plasmids are shown in Table 1. As the bait for yeast two-hybrid screening, the ORF of M1 protein was cloned into the NdeI/SalI site of pGBKT7 (Clontech) by PCR with primers P1 and P2. Deletion mutants of the M1 protein were constructed by PCR using pGBKT7-M1 as a template. M11–89 was constructed by PCR with primers P1 and P3, M190–164 with primers P4 and P5, M1165–252 with primers P6 and P2, and M11–164 with primers P1 and P5. The ORF of hTFIIIC102-s was cloned into the NdeI/EcoRI site of pGADT7 (Clontech) by PCR with primers P7 and P8 using pACT2-hTFIIIC102-s as a template. Deletion mutants of hTFIIIC102-s were constructed by PCR using pGADT7hTFIIIC102-s as a template. hTFIIIC102-s1–362 was constructed by PCR with primers P7 and P11, hTFIIIC102-s1–148 with primers P7 and P9, and hTFIIIC102-s149–362 with primers P10 and P11. For in vitro binding assays, the ORF of M1 was cloned into the EcoRI/SalI site of pGEX-6p-1 (Pharmacia Biotech) by PCR with primers P14 and P2. Full-length hTFIIIC102-s was cut from pGADT7-hTFIIIC102-s1–362 by NdeI and EcoRI and cloned into the pET-33b (?) vector (Novagen). For coimmunoprecipitation assays, the ORF of M1 was cloned into the NheI/HindIII site of pcDNA-3.1 (Invitrogen) by PCR with primers P12 and P13. The ORF of hTFIIIC102-s was cloned into the EcoRI/BamHI site of pFlag-cmv-2 (Sigma) by PCR with primers P16 and P17. For fluorescence imaging of living cells, the ORF of M1 was cloned into the HindIII/SalI site of pECFP-C1 (Clontech) by PCR with primers P15 and P2. Full-length hTFIIIC102-s was cut from pFlag-cmv-2-hTFIIIC102-s by EcoRI and BamHI, and cloned into pEYFP-C1 (Clontech). All constructs were completely sequenced. Yeast two-hybrid screening A Matchmaker Gal4 two-hybrid system 3 was purchased from Clontech. All of the procedures for yeast growth and transformation followed the protocol provided by the manufacturer. Saccharomyces cerevisiae strain AH109 was transformed with the pGBKT7-M1 plasmid. After a selfactivation test, the human kidney pretransformed cDNA library in the yeast plasmid pACT2 was screened in yeast strain AH109. Yeast transformants were plated and
Interaction of influenza virus M1 with hTFIIIC102-s
1103
Table 1 Primers used in this study Primer
Sequence (50 to 30 )
P1
CCTCCATATGAGTCTTCTAACCGAGGTCGa
NdeI
P2
CCTCGTCGACCTTGAATCGCTGCATCTGCAC
SalI
P3
CCTCGTCGACATCTCCATTTCCATTTAGGGC
SalI
P4
CCTCCATATGCCAAATAATATGGATAGGGCAG
NdeI
P5
CCTCGTCGACCTGTCTGTGAGACCGATGCTG
SalI
P6
CCTCCATATGGCAACTATCACCAACCCAC
NdeI
P7
CCTCCATATGTCAGGGTTCAGTCCGG
NdeI
P8
CCTCGAATTC TCAAGTGCAGATCTTGTTACATACAT
EcoRI
P9
CCTCGAATTCAGCTCTGGGAAGTTTACTCCG
EcoRI
P10
CCTCCATATGCTGAGAGGTCTCATGGGTGAAG
NdeI
P11 P12
CCTCGAATTC TGAAGTTTTTTTTTCCAGCAC CCTCGCTAGCCGCCACCATGGCAATGAGTCTTCTAACCGAGGTCG
EcoRI NheI
P13
CCTCAAGCTTCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCCTTGAATCGCTGCATCTGC
HindI
P14
CCTCGAATTCATGAGTCTTCTAACCGAGGTCG
EcoRI
P15
CCTCAAGCTTCGATGAGTCTTCTAACCGAGGTCG
HindI
P16
CCTCGAATTCTATGTCAGGGTTCAGTCCGG
EcoRI
P17
CCTCGGATCCTCAAGTGCAGATCTTGTTACATACA
BamHI
a
Restriction enzyme site
The restriction endonuclease sites are underlined
selected on SD medium without leucine, tryptophan, histidine and adenine. Robust colonies of more than 2 mm in diameter were restreaked on the same agar plates and allowed to grow for 1 week. This restreaking step was repeated twice more, and plasmids were isolated and introduced into Escherichia coli strain DH5a according to the manufacturer’s instructions. Clones harboring target cDNAs were isolated. The specificity of the interaction was independently verified by retransforming the candidate cDNAs back into yeast strain AH109 along with pGBKT7M1. The cDNAs that were able to form colonies on SD plates without leucine, tryptophan, histidine and adenine were sequenced, and homology searches were carried out using the BLAST algorithm through the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST). Cell culture and transfection 293T and HeLa cells were cultured in DMEM supplemented with 10% FBS. The cells were maintained at 37°C under a humidified atmosphere containing 5% CO2. For coimmunoprecipitation assays, 3 9 105 293T cells were seeded in 60-mm dishes. After overnight growth, the cells reached 70% confluence and were transfected with 3 lg of plasmid using Lipofectamine 2000 (Invitrogen) in serum-free medium. After incubation for 5 h, the medium was replaced with fresh medium containing 10% FBS, and the cells were cultured for 48 h before collection. For fluorescence microscopy, 1.2 9 105 HeLa cells were seeded on coverslips in 35-mm dishes and transfected with 1 lg of plasmid.
Protein expression, purification and GST pull-down assays The GST and GST–M1 fusion proteins were expressed in 0.1 mmol/l IPTG-induced E. coli strain BL21 (DE3) and purified by glutathione-Sepharose 4B (Amersham-Pharmacia Biotech) chromatography. The 69 Histidine fusion proteins were expressed in 0.1 mmol/l IPTG-induced E. coli strain BL21 (DE3) and purified by Ni-NTA Agarose (Qiagen) chromatography. The GST–M1-bound glutathioneSepharose 4B beads were incubated with 20 ll of 69 HishTFIIIC102-s1–362 protein in 500 ll of NETN buffer (100 mmol/l NaCl, 1 mmol/l EDTA, 20 mmol/l Tris–HCl pH 7.0, 0.5% NP-40, 1 mmol/l PMSF) for 4 h at 4°C. GST alone was used as a negative control. The beads were washed three times with H buffer [20 mmol/l HEPES (pH 7.7), 50 mmol/l KCl, 20% glycerol, 0.1% NP-40, and 0.007% b-mercaptoethanol] and then boiled in 20 ll of loading buffer. Bound proteins were separated by SDS-PAGE, transferred to a PVDF membrane and immunoblotted with a mouse anti-His monoclonal antibody (Sigma). Coimmunoprecipitation assays 293T cells were cotransfected with pcDNA3.1-myc-M1 and pFlag-cmv-2-hTFIIIC102-s. At 48 h after transfection, the cells were harvested, washed twice with cold PBS and lysed with cell lysis buffer (Cell Signaling). The lysate supernatant was precleared with protein A/G PLUS-agarose (Santa Cruz Biotechnology) for 1 h at 4°C, followed
123
1104
S. Huang et al.
by immunoprecipitation with 1 lg of an anti-Flag monoclonal antibody (Sigma) at 4°C for 4 h. After the incubation, the samples were centrifuged for 5 min at 3,000 rpm. The pellets were washed three times with cell lysis buffer. The precipitated proteins were eluted from the beads with loading buffer, separated by 12% SDS-PAGE, transferred to a PVDF membrane and immunoblotted with a mouse anti-myc antibody (Sigma). Fluorescence confocal microscopy HeLa cells were cotransfected with pECFP-C1-M1 and pEYFP-C1-hTFIIIC102-s. At 24 h after transfection, the cells were washed with PBS, fixed with 4% paraformaldehyde (pH 7.4) for 30 min, permeabilized with 0.2% Triton X-100 in PBS for 30 min and stained with Hoechst 33258 for 30 min. Fluorescence imaging was performed using a TCS-SP2 confocal microscope (Leica, Germany) equipped with a cooled CCD camera. All measurements were obtained with a 1009 oil immersion objective (NA 1.32) and 29 zoom. Colocalization was analyzed using the software Image J (NIH).
library using a yeast two-hybrid screening system. The recombinant plasmid pGBKT7-M1 used as bait was constructed by cloning the M1 gene into the pGBKT7 vector and used to transform strain AH109 of yeast type a containing three reporter genes (ADE, HIS3 and MEL1) to obtain bait strain AH109 (pGBKT7-M1). Yeast strain Y187 (pACT2-cDNA library) was obtained by transforming strain Y187 of yeast type a with the human cell cDNA library. Cultures of the two transformed strains were mixed together overnight for mating to form diploids. Next, positive clones were screened using high-stringency medium without leucine, tryptophan, histidine and adenine. Among about 5 9 106 clones, 16 isolated positive clones were screened. Bait strain AH109 (pGBKT7-M1) was unable to grow alone in auxotrophic medium. Candidate cDNAs were isolated from the 16 positive clones, amplified in E. coli DH5a and sent to Invitrogen Corporation for sequencing. The sequencing results were analyzed using the BLAST algorithm through the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST), which proved that the 16 positive clones encoded 11 independent proteins, as shown in Table 2. Characterization of the interaction between M1 protein and hTFIIIC102-s, and determination of the domains involved in the interaction by yeast two-hybrid assays
Results Identification of cellular proteins interacting with influenza H5N1 virus M1 protein Potential cellular proteins interacting with influenza H5N1 virus M1 protein were screened from a human cell cDNA
Eleven cellular proteins, including hTFIIIC102-s, were screened from the human cell cDNA library. As a short isoform of the polypeptide 3 subunit of the human general transcription factor IIIC, hTFIIIC102-s comprises 413
Table 2 Proteins identified as cellular components interacting with influenza A virus M1 protein by yeast two-hybrid assays, numbers of cDNA clones pulled out in the two-hybrid screening and coding potentials of these clones (the numbers of amino acids in the proteins were predicted from cDNA sequencing results) Number
Name of interactor (Gene symbol)
GenBank accession no
Position of binding fragment
1 2
Protein length, aa
RAN binding protein 9 (RANBPM)
NM_005493
119–729
729
Activator of heat shock 90 kDa protein ATPase homolog 1 (yeast)(AHA1)
NM_012111
19–338
338
3
UDP-glucose dehydrogenase (UDGH)
NM_003359
1–494
494
4
Transcription factor IIIC102 short isoform (TFIIIC102-s)
AF465407
1–413
413
5a
Actinin, alpha 4 (ACTN4)
NM_004924
198–911
911
448–911
911
6
S-adenosylhomocysteine hydrolase-like 1 (AHCYL1)
NM_006621
347–530
7
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor (TAF1)
NM_138923
398–1872
8
Adenylate kinase 2 (AK2)
NM_0134111
29–232
232
9
Aldolase B, fructose-bisphosphate (ALDOB)
NM_000035
150–363
363
10
Poly(rC) binding protein 2 (PCBP2)
NM_031989
82–362
362
11
Tuberous sclerosis 1 (TSC1)
NM_000368
357–1164
a
Two different clones were identified
123
530 1,872
1,164
Interaction of influenza virus M1 with hTFIIIC102-s
1105
1. pGBKT7-P53+pGADT7-T
5 1 4
2. pGBKT7-lam C+pGADT7-T 3. pGBKT7-M1+pACT2
3
Fig. 1 Influenza A virus matrix protein 1 (M1) interacts specifically with hTFIIIC102-s in a yeast two-hybrid system. Yeast AH109 cells were cotransformed with an M1 bait construct (pGBKT7-M1) and a prey construct (pACT2-hTFIIIC102-s). A representative experiment is shown, in which the cells were selected on supplemented minimal
2
4. pGBKT7+pACT2-hTFIIIC102-s 5. pGBKT7-M1+pACT2-hTFIIIC102-s
plates in SD medium without leucine, tryptophan, histidine and adenine. 1, Positive control; 2, negative control; 3, autonomous activation of M1; 4, autonomous activation of hTFIIIC102-s; 5, specific interaction of M1 protein with hTFIIIC102-s
(A)
hTFIIIC102-s Binding
hTFIIIC102-s149-362 Binding
M1 M11-89 M190-164 M1165-252 M11-164 M1 Binding
(B)
M11-164 Binding
hTFIIIC102-s hTFIIIC102-s1-362 hTFIIIC102-s1-148 hTFIIIC102-s149-362 Fig. 2 Mapping of the domains involved in the interaction of M1 protein and hTFIIIC102-s by yeast two-hybrid assays. a Schematic drawings of M1 and its fragments encoding various bait clones used for yeast two-hybrid assays for hTFIIIC102-s and hTFIIIC102s149–362 binding activities. Yeast strain AH109 was cotransformed with GAL4-BD-M1 or its fragments plus GAL4-AD-hTFIIIC102-s or GAL4-AD-hTFIIIC102-s149–362 constructs as indicated in the schematic illustrations. The numbers refer to the amino acids of the M1 protein. Transformed yeast cells were grown on selective plates in SD medium without leucine, tryptophan, histidine and adenine, and the
specific protein–protein interactions were determined by the growth of the cells. b Schematic drawings of hTFIIIC102-s and its fragments encoding various prey clones used for yeast two-hybrid assays for M1 protein and M11–164 binding activities. Yeast strain AH109 was cotransformed with GAL4-BD-M1 or GAL4-BD-M11–164 plus the GAL4-AD-hTFIIIC102-s construct or its fragments as indicated in the schematic illustrations. The numbers refer to the amino acids of hTFIIIC102-s. The specific protein–protein interactions were determined by the growth of the cells
amino acids. As shown in Fig. 1, hTFIIIC102-s specifically interacted with influenza virus M1 protein in yeast cells. To further understand the interaction between M1 protein and hTFIIIC102-s, the essential domains for this interaction were analyzed. As shown in Fig. 2, the full-length M1 protein consists of 252 amino acids, with two globular regions at the N-terminus (amino acids 1–164) and C-terminus (amino acids 165–252). The N-terminal globular region consists of the N (amino acids 1–89) and M (amino
acids 90–164) domains, while the C-terminal globular region only consists of the C domain (amino acids 165–252). The full-length hTFIIIC102-s protein consists of 413 amino acids, of which amino acids 149–362 contain five tandem tetratricopeptide repeats (TPR1-5). According to the compositions of the domains of the two proteins, four truncated mutants of M1 protein, namely M11–89 (amino acids 1–89), M190–164 (amino acids 90–164), M1165–252 (amino acids 165–252) and M11–164 (amino acids 1–164), as well as three
123
1106
S. Huang et al.
truncated mutants of hTFIIIC102-s protein, namely hTFIIIC102-s1–362 (amino acids 1–362), hTFIIIC102-s1–148 (amino acids 1–148) and hTFIIIC102-s149–362 (amino acids 149–362), were constructed. Yeast two-hybrid assays showed that only M11–164 bound to full-length hTFIIIC102s, while M11–89, M190–164 and M1165–252 did not (Fig. 2a). Among the three mutants of hTFIIIC102-s, hTFIIIC102s1–362 and hTFIIIC102-s149–362 showed binding activities toward M1, while hTFIIIC102-s1–148 did not (Fig. 2b). M11–164 showed binding activity toward hTFIIIC102s149–362, indicating that the N-terminal globular region (M11–164) of M1 protein and the TPR1-5 domain of hTFIIIC102-s149–362 were necessary for the interaction between these two proteins. hTFIIIC102-s binds directly to influenza H5N1 virus M1 protein in vitro To confirm that the interaction between hTFIIIC102-s and M1 was due to direct binding of the two proteins, as indicated by the yeast two-hybrid assays, GST pull-down assays were performed. M1 was expressed as a fusion protein (GST–M1), and both GST–M1 and GST were purified with glutathione-Sepharose beads (Fig. 3a). The KDa 90
(A)
M
1
2
GST-M1 Coomassiestained gel
49 35
truncated hTFIIIC102-s1–362 was expressed in E. coli, purified and incubated with an equal volume of GST or GST-M1 fusion protein bound to the glutathione-Sepharose beads. After repeated washing of the beads with H buffer, the beads were boiled in loading buffer to elute the bound proteins. The eluted proteins were separated by SDSPAGE and analyzed for the presence of His-hTFIIIC102s1–362 protein by western blot analysis with an anti-His monoclonal antibody. The results showed that HishTFIIIC102-s1–362 protein bound strongly to GST-M1 but did not bind to GST protein alone (Fig. 3b). Determination of the interaction between influenza H5N1 virus M1 protein and hTFIIIC102-s protein by immunoprecipitation To examine whether hTFIIIC102-s interacts with M1 protein in mammalian cells, coimmunoprecipitation assays were performed in 293T cells. 293T cells were cotransfected with plasmids pcDNA-3.1-myc-M1 and pFlag-cmv2-hTFIIIC102-s, using cotransfection of pcDNA-3.1-myc-M1 or pFlag-cmv-2-hTFIIIC102-s and empty vector, respectively, as negative controls. The cell lysates were coimmunoprecipitated with an anti-Flag monoclonal antibody. The immunoprecipitates were separated by SDS-PAGE and analyzed by western blotting using an anti-myc antibody. As shown in Fig. 4, myc-M1 protein was coimmunoprecipitated with Flag-hTFIIIC102-s protein (lane 3), but not with Flag (lane 1), while myc was not coimmunoprecipitated with Flag-hTFIIIC102-s (lane 2). These data
GST
Anti-His blot
IP: anti-Flag
GST-M1
GST only
KDa
M
(B)
Input
19
pcDNA3.1-myc pflag-cmv-2 pcDNA-myc-M1 pflag-cmv-2-hTF C102-s M kDa 72 55
83 62 47.5
His-hTFIIIC102-s1-362
IB: anti-Flag
Flag-hTF IgH
C102-s
36 28 55
IB: anti-Myc
Fig. 3 Influenza A virus M1 protein interacts with hTFIIIC102-s directly in vitro. GST-M1 or GST alone was expressed in E. coli. Pull-down assays were performed using recombinant GST or GST-M1 fusion protein. a SDS-PAGE and Coomassie brilliant blue staining of recombinant GST or GST–M1 fusion protein. M Marker. 1 Purified GST protein. 2 purified GST–M1 protein. b Pull-down assays. Recombinant protein hTFIIIC102-s1–362 was incubated with glutathione-Sepharose 4B beads bound to GST-M1 or GST alone. After extensive washing, the bound proteins were eluted, separated by SDS-PAGE using a 10% gel and immunoblotted with an anti-His monoclonal antibody
123
IgH 36 28
Myc-M1
Fig. 4 Influenza A virus M1 protein associates with hTFIIIC102-s in 293T cells. 293T cells were transfected simultaneously with the indicated expression plasmids. Cell lysates were harvested at 48 h after transfection and immunoprecipitated (IP) with a mouse anti-Flag monoclonal antibody. The immunocomplexes were pulled down using protein A/G Sepharose, separated by SDS-PAGE using a 12% gel and analyzed by immunoblotting with anti-Flag or anti-myc antibodies
Interaction of influenza virus M1 with hTFIIIC102-s
confirmed an interaction between these two proteins in mammalian cells. Coexpression of hTFIIIC102-s with M1 in HeLa cells inhibits the translocation of M1 into the nucleus To examine the localization of hTFIIIC102-s and M1 protein in mammalian cells, ECFP-M1 and EYFPhTFIIIC102-s fusion proteins were transiently expressed and detected in HeLa cells. Initially, HeLa cells were transfected separately with pECFP-C1-M1 and pEYFP-C1hTFIIIC102-s, and the expressed ECFP-M1 and EYFPhTFIIIC 102-s fusion proteins were detected by fluorescence microscopy at 24 posttransfection. ECFP-M1 was distributed throughout the cytoplasm and nucleus but was detected predominantly in the nucleus (Fig. 5a). This
1107
pattern of distribution was similar to that of M1 in previous reports [19, 20]. In contrast, EYFP-hTFIIIC102-s was only localized in the cytoplasm (Fig. 5b). Next, HeLa cells were cotransfected with pECFP-C1-M1 and pEYFP-C1hTFIIIC102-s, and the expressed proteins were imaged at 24 h posttransfection. Interestingly, CFP-M1 was no longer largely localized in the nucleus but was detected predominantly in the cytoplasm. The merged images of CFP-M1 and YFP-hTFIIIC102-s showed that their distributions strongly overlapped in the cytoplasm (Fig. 5c). Subsequently, the colocalization of M1 and hTFIIIC102-s was analyzed using the software Image J. The overall coefficients confirmed the strong colocalization between M1 and hTFIIIC102-s (Fig. 5d). These findings indicated that coexpression of hTFIIIC102-s with M1 in HeLa cells inhibited the translocation of M1 into the nucleus.
Fig. 5 Subcellular localization of transiently expressed M1 and hTFIIIC102-s in HeLa cells. a ECFP-M1 expressed in HeLa cells. b EYFP-hTFIIIC102-s expressed in HeLa cells. c ECFP-M1 and EYFPhTFIIIC102-s coexpressed in HeLa cells. Cells were examined by fluorescence microscopy at 24 h posttransfection. ECFP-M1 fluorescence is cyan, while EYFP-hTFIIIC102-s fluorescence is yellow. Cell nuclei are pseudocolored blue, following staining with Hoechst 33258 dye. Bars 10 lm. d Coefficients obtained by colocalization analysis of M1 and hTFIIIC102-s
123
1108
Discussion In the present study, we screened for cellular protein components that specifically interacted with influenza virus M1 protein using a human cell cDNA library and a yeast two-hybrid system with M1 protein as bait. A total of 11 cellular proteins, including hTFIIIC102-s, adenylate kinase 2 (AK2), RAN-binding protein 9 (RANBP9), actinin alpha 4 (ACTN4), poly(rC)-binding protein 2 (PCBP2) and TATA box binding-associated factor (TAF1), were screened. hTFIIIC102-s is a short isoform of hTFIIIC102 protein. The 406 amino acids at its N-terminus are completely consistent with those of hTFIIIC102, while only 6 amino acids at the C-terminus are different [21]. hTFIIIC102-s may be involved in the regulation and control of RNA polymerase III activity. AK2 is isozyme 2 of the adenylate kinases. It is located in the mitochondrial intermembrane space and may be involved in the course of cell apoptosis [22]. RANBP9 is a small GTP-binding protein. It is a member of the Ras superfamily and essential for translocation of RNA and proteins through nuclear pore complexes. Influenza virus M1 protein plays a key role in mediating the transport of RNP complexes [11]. ACTN4 is one of the constituents of microfilaments in the cytoskeleton. ACTN4 only exists in non-muscle cells and serves as a bridge for interactions between microfilaments and the cell membrane [23]. In cells infected with influenza virus, M1 protein is able to bind to cytoskeletal elements, and this may be very important for assembly and budding of the influenza virus [24]. PCBP2 appears to be multifunctional. As one of the major cellular poly(rC)-binding proteins, it shows DNA-, RNA- and protein-binding activities and participates in mRNA metabolism [25]. TAF1 is one of the components of RNA polymerase II transcription complexes and plays a role in the formation of RNA polymerase II-mediated transcription initiation complexes [26]. The remaining five proteins that interacted with M1 protein were activator of heat shock 90-kDa protein ATPase homolog 1 (yeast) (AHA1), UDP-glucose dehydrogenase (UDGH), S-adenosylhomocysteine hydrolase-like 1 (AHCYL1), aldolase B, fructose-bisphosphate (ALDOB) and tuberous sclerosis 1 (TSC1), whose roles in infection of host cells with influenza H5N1 virus are still unclear. As a multifunctional protein, influenza virus M1 protein is very important for controlling the release and transport of viral RNPs and plays critical roles in viral genome transcription, virus budding, and the shape and virulence of virions. The N-terminal globular region (amino acids 1–164) contains nine alpha-helices, of which helices H1–H4 are located in the N domain and helices H6–H9 are in the M domain. The hTFIIIC102-s protein is rich in tetratricopeptide repeat domains (TPRs), and amino acids 149–362 contain five tandem TPRs. The TPR motif is a
123
S. Huang et al.
repeat sequence consisting of 34 amino acids, usually found in a tandem array and present in different numbers (usually 3–16) in various proteins. The TPR motif acts as a protein–protein interaction module in a number of functionally different proteins and facilitates specific interactions with appropriate partner proteins [27]. Five to six tandem TPR repeats generate a right-handed helical structure with an amphipathic channel that is thought to accommodate an alpha helix of the target protein [27]. The domain of hTHIIIC102-s required for the interaction with M1 protein was determined to be amino acids 149–362, containing five tandem TPRs, while the domain of M1 protein required for the interaction with hTHIIIC102-s was determined to be amino acids 1–164, containing nine alpha helices. Besides hTFIIIC102-s and AK2, M1 protein may interact specifically with cysteine aspartic-acid-specific protease 8 (caspase 8) [28]. Death effector-domain-containing proteins may interact with hTFIIIC102-s, AK2 and caspase 8 [19, 20, 26]. A comparison between the primary structures of influenza A virus M1 protein and the death effector domain of Fas-associated protein with death domain (FADD) revealed that the homology between amino acids 25–40 of the M1 protein and amino acids 44–67 of the FADD death effector domain was 35% [28]. Death effector domains play important roles in autoactivation of caspases, which is associated with cell apoptosis [29]. Further studies are needed to determine whether the N-terminal globular region of influenza H5N1 virus M1 protein has death effector domain activity and whether this region is associated with cell apoptosis. The localization of influenza H5N1 virus M1 protein and hTFIIIC102-s in HeLa cells was examined in this study. The results revealed that M1 protein was distributed in both the nucleus and cytoplasm. However, the roles of M1 protein in the nucleus and cytoplasm differed regarding the transport of vial RNPs. M1 protein in the cytoplasm restricted the transport of viral RNPs to the nucleus, while that in the nucleus promoted the transport of assembled viral RNPs to the cytoplasm [11]. The present study also examined the localization of hTFIIIC102-s and showed that coexpression of hTFIIIC102-s with M1 in HeLa cells inhibited the translocation of M1 into the nucleus. The interaction between hTFIIIC102-s and influenza virus M1 protein may influence the functions of M1 protein in the cytoplasm to a certain degree, which may interfere with the transport of viral RNPs from the nucleus to the cytoplasm and consequently influence the production of nucleocapsids. hTFIIIC102-s is a short isoform of hTFIIIC102, and the 406 amino acids at its N-terminus are completely consistent with those of hTFIIIC102, which is a key subunit of RNA polymerase III complexes [30–32]. RNA polymerase III is responsible for the transcription of various short
Interaction of influenza virus M1 with hTFIIIC102-s
genes encoding untranslated RNAs that are involved in the maturation of other RNA molecules and protein biosynthesis, and it is essential for the growth and proliferation of cells. RNA polymerase III transcription is highly regulated, with high levels in rapidly dividing cells, which need to duplicate a large number of RNA polymerase III transcripts in a limited time, and low level in resting cells, where the demand for RNA polymerase III activity is probably limited. Influenza H5N1 virus M1 protein may interact with the five tandem TPRs in hTFIIIC102-s through its N-terminal globular region, which may influence the formation of stable RNA polymerase III transcription complexes, the transcription of class III genes and the functions of host cells. In summary, we identified 11 cellular proteins that interact with influenza H5N1 virus M1 protein and further explored the interaction between M1 protein and hTFIIIC102-s. Both GST pull-down and coimmunoprecipitation assays confirmed the interaction between these two proteins. Mapping assays showed that the N-terminal globular region of the M1 protein and the five tandem TPRs (TPR1-5) of hTFIIIC102-s were necessary for the interaction. In addition, coexpression of hTFIIIC102-s with M1 in HeLa cells inhibited the translocation of M1 into the nucleus. The results of the present study will provide a novel basis for further understanding of the functions of influenza H5N1 virus M1 protein. Acknowledgments This study was supported by the following research funds: European Union Project (SP5B-CT-2006-044161); National 973 Project (2005CB523007, 2006CB933102); Chinese Academy of Sciences (KSCX1-YW-R-14); National Key Technology R&D Program of China (2006BAD06A03).
References 1. Lamb RA, Lai CJ, Choppin PW (1981) Sequences of mRNAs derived from genome RNA segment 7 of influenza virus: colinear and interrupted mRNAs code for overlapping proteins. Proc Natl Acad Sci USA 78:4170–4174 2. Yasuda J, Bucher DJ, Ishihama A (1994) Growth control of influenza A virus by M1 protein: analysis of transfectant viruses carrying the chimerical M gene. J Virol 68:8141–8146 3. Sha B, Luo M (1997) Structure of a bifunctional membrane-RNA binding protein, influenza virus matrix protein M1. Nat Struct Boil 4:239–244 4. Arzt S, Baudin F, Barge A et al (2001) Combined results from solution studies on intact influenza virus M1 protein and from a new crystal form of its N-terminal domain show that M1 is an elongated monomer. Virology 279:439–446 5. Harris A, Forouhar F, Qiu S et al (2001) The crystal structure of the influenza matrix protein M1 at neutral pH: M1–M1 protein interfaces can rotate in the oligomeric structures of M1. Virology 289:34–44 6. Shishkov AV, Goldanskii VI, Baratova LA et al (1999) The in situ spatial arrangement of the influenza A virus matrix protein
1109
7.
8.
9.
10.
11.
12.
13.
14.
15. 16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
M1 assessed by tritium bombardment. Proc Natl Acad Sci USA 96:7827–7830 Hui EK, Barman S, Tang DH et al (2006) YRKL sequence of influenza virus M1 functions as the L domain motif and interacts with VPS28 and Cdc42. J Virol 80:2291–2308 Zhirnov OP (1990) Solubilization of matrix protein M1/M from virions occurs at different pH for orthomyxo- and paramyxoviruses. Virology 176:274–279 Bui M, Whittaker G, Helenius A (1996) Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J Virol 70:8391–8401 Hankins RW, Nagata K, Kato A (1990) Mechanism of influenza virus transcription inhibition by matrix (M1) protein. Res Virol 141:305–314 Martin K, Helenius A (1991) Nuclear transport of influenza virus ribonucleoproteins: the Viral matrix protein (M1) promotes export and inhibits import. Cell 67:117–130 Kretzschmar E, Bui M, Rose JK (1996) Membrane association of influenza virus matrix protein does not require specific hydrophobic domains or the viral glycoproteins. Virology 220:37–45 Zhang J, Lamb RA (1996) Characterization of the membrane association of the influenza virus matrix protein in living cells. Virology 225:255–266 Gomez-Puertas P, Albo C, Perez-Pastrana E et al (2000) Influenza virus matrix protein is the major driving force in virus budding. J Virol 74:11538–11547 Liu T, Ye Z (2005) Attenuating mutations of the matrix gene of influenza A/WSN/33 virus. J Virol 79:1918–1923 Hui EK, Smee DF, Wong MH et al (2006) Mutations in influenza virus M1 CCHH, the putative zinc finger motif, cause attenuation in mice and protect mice against lethal influenza virus infection. J Virol 80:5697–5707 Burleigh LM, Calder LJ, Skehel JJ et al (2005) Influenza a viruses with mutations in the m1 helix six domain display a wide variety of morphological phenotypes. J Virol 79:1262–1270 Reinhardt J, Wolff T (2002) The influenza A virus M1 protein interacts with the cellular receptor of activated C kinase (RACK) 1 and can be phosphorylated by protein kinase C. Vet Microbiol 74:87–100 Sato Y, Yoshioka K, Suzuki C et al (2003) Localization of influenza virus proteins to nuclear dot 10 structures in influenza virus-infected cells. Virology 310:29–40 Bui M, Whittaker G, Helenius A (1996) Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J Virol 70:8391–8401 Zhan Y, Hegde R, Srinivasula SM et al (2002) Death effector domain-containing proteins DEDD and FLAME-3 form nuclear complexes with the TFIIIC102 subunit of human transcription factor IIIC. Cell Death Differ 9:439–447 Lee HJ, Pyo JO, Oh Y et al (2007) AK2 activates a novel apoptotic pathway through formation of a complex with FADD and caspase-10. Nat Cell Biol 9:1303–1310 Weins A, Schlondorff JS, Nakamura F et al (2007) Diseaseassociated mutant alpha-actinin-4 reveals a mechanism for regulating its F-actin-binding affinity. Proc Natl Acad Sci USA 104:16080–16085 Avalos RT, Yu Z, Nayak DP (1997) Association of influenza virus NP and M1 proteins with cellular cytoskeletal elements in influenza virus-infected cells. J Virol 71:2947–2958 Kiledjian M, Wang X, Liebhaber SA (1995) Identification of two KH domain proteins in the alpha-globin mRNP stability complex. Embo J 14:4357–4364 Ruppert S, Wang EH, Tjian R (1993) Cloning and expression of human TAFII250: a TBP-associated factor implicated in cellcycle regulation. Nature 362:175–179
123
1110 27. Blatch GL, Lassle M (1999) The tetratricopeptide repeat: a structural motif mediating protein–protein interactions. BioEssays 21:932–939 28. Zhirnov OP, Ksenofontov AL, Kuzmina SG (2002) Interaction of influenza A virus M1 matrix protein with caspases. Biochemistry (Mosc) 67:534–539 29. Martin DA, Siegel RM, Zheng L (1978) Membrane oligomerization and cleavage activates the caspase-8 (FLICE/MACHalpha1) death signal. J Biol Chem 273:4345–4349 30. Hsieh YJ, Wang Z, Kovelman R (1999) Cloning and characterization of two evolutionarily conserved subunits (TFIIIC102 and
123
S. Huang et al. TFIIIC63) of human TFIIIC and their involvement in functional interactions with TFIIIB and RNA polymerase III. Mol Cell Biol 19:4944–4952 31. Geiduschek EP, Kassavetis GA (2001) The RNA polymerase III transcription apparatus. J Mol Biol 310:1–26 32. Huang Y, Maraia RJ (2001) Comparison of the RNA polymerase III transcription machinery in Schizosaccharomyces pombe, Saccharomyces cerevisiae and human. Nucleic Acids Res 29:2675–2690
