Invertebrate Systematics

11 downloads 0 Views 2MB Size Report
Mar 7, 2018 - X.17, Mu Chen. Paratypes. ... XI.20, Xikun Song, Junlong Zhang, Ping Ning, Xuwen Wu. ... VII.15, Wenliang Liu, Wei Jiang, Xuwen Wu.

Invertebrate Systematics - Decision on Manuscript ID IS17070.R2 Invertebrate Systematics 发给 xksong

2018-03-14 06:37 隐藏信息

发件人: Invertebrate Systematics 收件人: xksong 时间: 2018年3月14日 (周三) 06:37 大小: 4 KB

14-Mar-2018 Dear Dr Song: Thank you for sending the revised version of this paper (Incongruent cladistics reveal a new hydrozoan genus (Cnidaria: Sertularellidae) endemic to the eastern and western coasts of the North Pacific Ocean) and for dealing so thoroughly with the referees' comments. I have now had the opportunity to examine your revised manuscript and I am pleased to accept it for publication in Invertebrate Systematics. You will hear in due course from the Production Editor regarding the copyedited manuscript, page proofs, etc. From what I can see, your figure(s) are acceptable in the format you have supplied, but you may be asked for different file formats if needed. Thank you for your excellent contribution. On behalf of the Editors of Invertebrate Systematics, we look forward to your continued contributions to the Journal. Sincerely, Dr Allen Collins Associate Editor, Invertebrate Systematics [email protected] *************************************************** OPEN ACCESS: Invertebrate Systematics offers authors the option to publish your paper as Open Access on payment of an Open Access Author Fee. More information is available at: http://www.publish.csiro.au/nid/75/aid/9351.htm. The Production Editor will offer you the choice to select Open Access when she sends you proofs of your paper. Please take a moment to consider the advantages of selecting Open Access for your work.

Invertebrate Systematics

Incongruent cladistics reveal a new hydrozoan genus (Cnidaria: Sertularellidae) endemic to the eastern and western coasts of the North Pacific Ocean

Journal:

Invertebrate Systematics

Fo

Manuscript ID

Manuscript Type:

Complete List of Authors:

Research paper

rR

Date Submitted by the Author:

IS17070.R2

07-Mar-2018

iew

ev

Song, Xikun; Xiamen University, State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences; Institute of Oceanology, Chinese Academy of Sciences; University of the Chinese Academy of Sciences Gravili, Cinzia; Universita del Salento; CoNISMa, Consorzio Nazionale Interuniversitario per le Scienze del Mare Bernhard, Ruthensteiner; Zoologische Staatssammlung Munchen Lü, Mingxin; Xiamen University, State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences Wang, Jianjun; Third Institute of Oceanography, State Oceanic Administration

On

Keyword:

Cnidaria, mitochondrial DNA, molecular phyogenetics

ly

Note: The following files were submitted by the author for peer review, but cannot be converted to PDF. You must view these files (e.g. movies) online. Supplementary material 6.nxs Supplementary material 7.nxs

http://www.publish.csiro.au/journals/is

Page 1 of 77

Invertebrate Systematics

1

Incongruent cladistics reveal a new hydrozoan genus (Cnidaria: Sertularellidae)

2

endemic to the eastern and western coasts of the North Pacific Ocean

3 4

Xikun Song A, B, C, H, Cinzia Gravili D, E, Bernhard Ruthensteiner F, Mingxin Lyu

5

Wang G

6

A

7

Xiamen University, South Xiang'an Road, Xiamen 361102, China

8

B

Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

9

C

University of Chinese Academy of Sciences, Beijing 100049, China

10

D

Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Università del Salento, 73100

11

Lecce, Italy

12

E

CoNISMa, Consorzio Nazionale Interuniversitario per le Scienze del Mare, Rome, Italy

13

F

Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany

14

G

Third Institute of Oceanography, State Oceanic Administration, 178 Daxue Road, 361005 Xiamen,

15

China

16

H

17

Running title: New hydrozoan genus Xingyurella

A

and Jianjun

State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences,

iew

ev

rR

Fo

ly

On

Corresponding author. Email: [email protected]; ORCID: 0000-0002-3335-0029

18

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 2 of 77

Table of Contents (TOC) Abstract. Molecular phylogenetics sometimes is inconsistent

20

with morphological data, notably within the phylum Cnidaria. An integrative approach to a

21

case of incongruence in hydrozoans results in improved systematics with the designation of

22

a new genus with divergent origin, endemic to the eastern and western coasts of the North

23

Pacific Ocean. This suggests that incongruence in molecular and morphological inferences

24

may be of great systematic significance.

25

Abstract. Molecular phylogenetics provides objective references for zoological systematics

26

which sometimes are inconsistent with morphological data. This particularly counts for

27

some primitive phyla such as Cnidaria. The marine hydrozoan Symplectoscyphus turgidus

28

(Sertularellidae) is a recent questionable case reported to occupy an unexpected

29

phylogenetic position and suggested to be assigned to a new genus. However, its position

30

based on a single Californian specimen seemed doubtful. Here we contributed 16S, 18S and

31

28S rRNA data of another morphologically related species from the Yellow Sea, forming a

32

monophyletic clade with the Californian sample, confirming the clade stability. Further

33

integrative analyses support designating this clade as the new genus Xingyurella gen. nov.,

34

and lead to a taxonomic revision of species characterized by three hydrothecal marginal

35

teeth and strong gonothecal spines. This resulted in a new species and three new

36

combinations: Xingyurella xingyuarum sp. nov., X. gotoi comb. nov., X. pedrensis comb. nov.

37

and X. turgida comb. nov. Future investigations are required to understand the evolution and

38

speciation involved in the transoceanic distribution pattern of Xingyurella. The approach

39

used herein for dealing with non-monophylic conditions may be indicative for further

40

studies by integrating tropho- and gonosome traits for Sertularellidae and other hydrozoans.

iew

ev

rR

Fo

19

ly

On

http://www.publish.csiro.au/journals/is

Page 3 of 77

Invertebrate Systematics

41 42

Additional keywords: Cnidaria, hydroid, lectotype designation, molecular phylogenetics,

43

new species, taxonomic revision, fine systematics

44

ZooBank Registration: This article is registered in ZooBank under

45

urn:lsid:zoobank.org:pub:E99F8777-8E31-4C4B-A065-71C71371EEBC

46

iew

ev

rR

Fo ly

On http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 4 of 77

Introduction

48

As a substantial component of integrative taxonomy, molecular phylogenetics provides

49

objective references for systematics of a wide range of biological organisms. However,

50

inconsistency or incongruence of morphological characters and non-monophyly frequently

51

challenge traditional taxonomy (Padial et al. 2010; Yeates et al. 2011; Fontaneto et al. 2015;

52

Sheth and Thaker 2017). This also happens in the early diverging animal phyla such as

53

Cnidaria, with few stable morphological characters for diagnoses. For example, the family

54

Sertulariidae Lamouroux, 1812, referring to a traditional taxonomic concept adopted by

55

Cornelius (1995) and Bouillon et al. (2006), represents very common hydroid forms

56

attached to hard substrata throughout oceans. Recent molecular data indicate that the family

57

Sertulariidae Lamouroux is paraphyletic (Moura et al. 2008; Leclère et al. 2009; Peña

58

Cantero et al. 2010; Maronna et al. 2016; Song et al. 2016b). Several very large genera of

59

this family were reported to be paraphyletic (Moura et al. 2011; Song et al. 2016a).

iew

ev

rR

Fo

47

On

Although the family Sertulariidae Lamouroux is a derived group within the Medusozoa

61

tree (Cartwright and Nawrocki 2010), bearing well-developed chitinous structures

62

surrounding the trophosome and gonosome of very diversified shape (Bouillon et al. 2006),

63

its fine systematics is far from fully resolved, partially due to the lack of molecular data and

64

fine morphological generic diagnoses (Song 2016). Generally, only a few trophosome

65

characters are selected for generic diagnoses (e.g. Cornelius 1995; Bouillon et al. 2006). For

66

example, the characters of the number of hydrothecal marginal cusps and operculum valves

67

could simply distinguish the two largest genera, Sertularella Gary, 1848 (136 species) and

68

Symplectoscyphus Marktanner-Turneretscher, 1890 (105 species): Sertularella has four

ly

60

http://www.publish.csiro.au/journals/is

Page 5 of 77

Invertebrate Systematics

69

marginal cusps and four opercular valves, while the number of the latter is three (Cornelius

70

1995; Bouillon et al. 2006). It seems odd that the gonosome characters are rarely used,

71

except for the character "with gonotheca origin from within the hydrothecal cavity" listed by

72

Song et al. (2016b). Maronna et al. (2016) proposed a new concept by raising the family Sertulariidae

74

Lamouroux to a new suborder Sertulariida and raised its four monophyletic clades as new

75

families: Staurothecidae, Symplectoscyphidae, Sertularellidae, and Sertulariidae sensu

76

stricto Maronna et al. 2016. This further increases the requirements for diagnostic characters

77

for the newly proposed families (Song 2016). In the new system proposed by Maronna et al.

78

(2016), and adopted by the present study, Sertularella plus a single Symplectoscyphus

79

species, Symplectoscyphus turgidus (Trask, 1857) (as Xingyurella turgida comb. nov. in this

80

study) were restricted to the new family Sertularellidae.

iew

ev

rR

Fo

73

Obviously, the phylogenetic position of Symplectoscyphus turgidus is peculiar and

82

seems to be inconsistent with morphological data. Symplectoscyphus turgidus has three

83

hydrothecal marginal teeth and three opercular valves just like other species of the genera

84

Antarctoscyphus Peña Cantero, García Carrascosa and Vervoort, 1997 and Symplectoscyphus,

85

which were assigned to Symplectoscyphidae Maronna et al., 2016. However, it clusters with

86

the genus Sertularella instead of any genera of the Symplectoscyphidae (Leclère et al. 2009;

87

Moura et al. 2011; Maronna et al. 2016; Song et al. 2016b). Moura et al. (2011) thought that

88

S. turgidus should be moved to the genus Sertularella or even perhaps to a new genus.

89

Nevertheless, Maronna et al. (2016) and Song et al. (2016b) still provisionally treated S.

90

turgidus as a questionable taxon, because the peculiar position was only based on a single

ly

On

81

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 6 of 77

91

sequenced Californian specimen of one species. Maronna et al. (2016) addressed the need of

92

additional data of further samples to clarify the position of S. turgidus. In the present study, we contributed new 16S, 18S and 28S rRNA data of a species

94

morphologically related to Symplectoscyphus turgidus from the Yellow Sea. This turns out to

95

form a monophyletic clade with Symplectoscyphus turgidus. This confirms the stability of

96

this "unexpected" phylogenetic position. A further integrative review and additional analyses

97

provide persuasive evidence to propose this clade with peculiar morphological and

98

molecular traits as a new genus Xingyurella gen. nov., describe a new species Xingyurella

99

xingyuarum sp. nov., and make three new taxonomic combinations. Related type material

100

was examined if available. In addition, some species representing potential candidates for

101

intermediate morphological condition between Sertularella and Xingyurella are discussed.

102

iew

ev

rR

Fo

93

Material and methods

104

Specimens investigated

105

The specimens investigated were mainly collected during the First Chinese National

106

Comprehensive Oceanographic Survey (1958–1960) and recent Shared Research Cruises on

107

Yellow Sea & East China Sea supported by the National Natural Science Foundation of

108

China (NSFC, 2010–2013). These specimens were mainly stored in the Marine Biological

109

Museum of Chinese Academy of Sciences, Institute of Oceanology, CAS (used with

110

registration prefix MBM). Type material of Sertularella gotoi Stechow, 1913 (as Xingyurella

111

gotoi comb. nov. in this study) deposited in the Zoologische Staatssammlung München

112

(ZSM) was re-examined. Some related Californian and Oregon material deposited in the

ly

On

103

http://www.publish.csiro.au/journals/is

Page 7 of 77

Invertebrate Systematics

113

Muséum d'histoire naturelle de la Ville de Genève (MHNG) or the Department of

114

Invertebrate Zoology and Geology, California Academy of Sciences (CASIZ) was examined

115

with the assistance of P. Schuchert and Z. Mora Vallín, respectively. See full collecting

116

details in Supplementary material 1.

117

Morphological and molecular analyses

119

In general, morphological and molecular data were obtained and analyzed as given by Song

120

et al. (2016b). The origin of some morphological data is given in the “Integrative analyses

121

and review” (see below). The amplification and molecular cloning of the partial sequences

122

of the 16S rRNA, 18S rRNA, 28S rRNA and COI genes were conducted for all recent

123

ethanol material of Xingyurella xingyuarum sp. nov. using the primers summarized by Song

124

et al. (2016b), but only picked up nine 16S rRNA clones (631 bp) and two COI clones (899

125

bp).

126

MF135580–MF135582, MF491516–MF491518) from three specimens and two COI

127

haplotypes (MF135583–MF135584) from one specimen (Table 2, Supplementary material

128

2).

These

clones

contain

six

iew

ev

rR

Fo

118

16S

haplotypes

(Genbank

accession

numbers:

ly

On

129

Nearly the full length of the 18S and 28S rRNA genes (Genbank accession numbers:

130

MG763076–MG763080) could be successfully obtained using new primers designed in the

131

present study (Table 1). This design was inspired by the molecular examination of some

132

Mollusks (Giribet et al. 2006) amplifying shorter overlapping fragments (530–970 bp) than

133

used with the previous primer pairs (Song et al. 2016b) which result in longer fragments

134

(about 1800 bp). The new primers were picked up within the conservative regions with

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 8 of 77

135

reference to published primers (Hillis and Dixon 1991; Giribet et al. 2006; Leclère et al.

136

2009; Song et al. 2016b). These primers were successfully tested in several species of

137

Leptothecata (Sertulariidae and Campanulariidae) and Anthoathecata (Tubulariidae)

138

collected 3–7 years ago and fixed in 70%–100% ethanol. The expected length of the 18S and

139

28S rRNA after assembling is about 1700 bp and 3400 bp, respectively. These new primers

140

(Table 1) may be used as alternative primers for some difficult museum-deposited

141

hydrozoan specimens possibly due to the partial degradation of genomic DNA.

Fo

The intra- and inter-species genetic distance (Table 2, 3) of Xingyurella was calculated.

143

Maximum-likelihood phylogenetic and Bayesian analyses were conducted for the 16S rRNA

144

dataset (Fig. 1, Supplementary material 2, 6) as well as for the concatenated dataset of the

145

16S, 18S and 28S rRNA genes (Fig. 2, Supplementary material 2, 7). Some published

146

hydrozoan 16S, 18S and 28S rRNA sequences (Govindarajan et al. 2006; Cartwright et al.

147

2008; Moura et al. 2008, 2011; Leclère et al. 2009; Maronna et al. 2016; Peña Cantero et al.

148

2010; Song et al. 2016b) and some directly submitted sequences by C. W. Cunningham and

149

P. Schuchert were obtained from GenBank to conduct phylogenetic analyses

150

(Supplementary material 2). All published 16S rRNA sequences of the genus Sertularella

151

and type species or species that emerged on representative clades of related trees (Leclère et

152

al. 2009; Peña Cantero et al. 2010; Moura et al. 2011; Maronna et al. 2016) were selected

153

for the 16S rRNA tree (Fig. 1).

iew

ev

rR

142

ly

On

154

In some preliminary phylogenetic analyses (not shown), all the 16S haplotypes of

155

Xingyurella xingyuarum clustered together, so only three genetic divergent haplotypes from

156

the paratype MBM280254 were shown in the final 16S tree (Fig. 1) to compress its length.

http://www.publish.csiro.au/journals/is

Page 9 of 77

Invertebrate Systematics

157

The COI sequences were not selected for phylogenetic analyses because only few relevant

158

reference sequences were available from GenBank. Clytia hemisphaerica (Linnaeus, 1767)

159

was chosen as outgroup for both trees (Figs 1, 2). TIM2+I+G and GTR+I+G (Akaike

160

information criterion) were chosen as the optimal probabilistic evolution model for the 16S

161

tree (Fig. 1) and concatenated 16S+18S+28S tree (Fig. 2), respectively.

162

Integrative analyses and review

164

Before the integrative analyses, the accuracy of the molecular data of Xingyurella turgida and

165

X. xingyuarum and their phylogenetic positions were evaluated by the topology of the present

166

trees (Figs 1, 2) as well as other trees (Leclère et al. 2009; Moura et al. 2011; Maronna et al.

167

2016; Song 2016; Song et al. 2016b).

iew

ev

rR

Fo

163

With the guidelines of molecular data, integrative analyses were conducted to track some

169

potential morphological diagnoses to distinguish the main molecular clades in Figure 1 and

170

Figure 2. At first, the hydrothecae and gonothecae of the samples identified to species rank

171

were redrawn and visualized directly on the phylogenetic tree (Figs 1, 2). Then the

172

gonothecae of 25 species selected were redrawn and shown separately for further

173

morphological examination (Fig. 3). Most line drawings were based on specimens or original

174

data of the authors (Gravili et al. 2015; Song 2016; Song et al. 2016a, 2016b), some were

175

with reference to published data, but modified or simplified to present the interested

176

morphological structure. Additionally, 23 morphological characters of 23 related species of

177

the family Sertulariidae Lamouroux and Thyroscyphidae Stechow, 1920 were extracted from

178

published literature for comparative analyses (Supplementary material 3). For the above

ly

On

168

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 10 of 77

179

species selected (Figs 1–3, Supplementary material 3), some related species examined by the

180

authors were given priority. Some other species without molecular data but with typical or

181

divergent morphological characters of the colony or gonotheca were also included, e.g.

182

Calamphora parvula Allman, 1888, Sertularella inabai Stechow, 1913, S. mirabilis

183

Jäderholm, 1896, and S. spirifera Stechow, 1931 (Fig. 3, Supplementary material 3). Detailed

184

data resources are listed in related figure legends and Supplementary material 3. Finally, a literature survey and review of the original descriptions and illustrations of

186

nominal species of the family Sertulariidae Lamouroux listed by Bouillon et al. (2006) and

187

Schuchert (2015) were conducted to detect other potential Xingyurella species, according to

188

the potential diagnoses of the Xingyurella clade extracted in the present study. Related type

189

material or specimens from type localities were examined if available.

190

iew

ev

rR

Fo

185

Lectotype and neotype designations

192

To provide an objective standard of reference for the identity, a neotype was designated for

193

Sertularia turgida Trask, 1857 (as Xingyurella turgida in this study) deposited in MHNG,

194

lectotypes were designated in syntype material in the ZSM for Sertularella gotoi (as

195

Xingyurella gotoi in this study).

ly

On

191

196

It is doubted that any type material was designated for Sertularia turgida in 1857 (D.

197

Calder, pers. comm.). According to Stearns (1908), Trask served in the California Academy of

198

Sciences as one of the eight illustrious founders. Stearns (1908) listed all species nominated

199

by Trask (including Sertularia turgida) but did not mention any information on type material.

200

Also, no type material of this species could be found in CASIZ where it should most likely

http://www.publish.csiro.au/journals/is

Page 11 of 77

Invertebrate Systematics

201

have been located (C. Piotrowski, pers. comm.). So, we designated the only published

202

material (MHNG-INVE-29467) with molecular data (Leclère et al. 2009) as a neotype of S.

203

turgida. This fertile material was collected from Los Angeles, California, not far from its type

204

locality San Francisco, California (Supplementary material 1). Its morphology (Figs 4H–L) is

205

consistent with the original description by Trask (1857).

206

The largest fertile colony of Sertularella gotoi now deposited in ethanol was selected

207

(Fig.

208

(ZSM20050746–ZSM20050752) were selected as paralectotypes. The details of the

209

specimens are provided in the Systematic account and Supplementary material 2.

6A)

as

lectotype

(ZSM20040227),

the

remaining

slide

preparations

ev

rR

Fo

210

Results

212

Molecular phylogenetics

213

Genetic distance. The genetic distance of partial sequences of the 16S, 18S and 28S rRNA

214

genes of two species of Xingyurella is listed in Table 2 and Table 3. The genetic distance of

215

X. xingyuarum and X. turgida is 0.014–0.016 (16S), 0.052–0.053 (18S), 0.090 (28S),

216

respectively. It is much higher than the genetic distance of different haplotypes of X.

217

xingyuarum (16S, 0.002–0.003, 18S, 0.001). The distance of two clones of partial sequences

218

of the COI gene (899 bp) of X. xingyuarum is 0.003.

219

Evaluation of sequence accuracy of Xingyurella. Although only six 16S haplotypes were

220

obtained in three specimens of X. xingyuarum, sequence polymorphism, haplotype replicates

221

and shared haplotypes between specimens were detected (Table 2). Firstly, two and four

222

different 16S haplotypes were picked up in the specimens MBM280232 and MBM280254,

iew

211

ly

On

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 12 of 77

respectively. This reveals that slight sequence polymorphism exists in the single hydroid

224

fragment that was used for molecular analyses (sequence distance 0.002–0.003, Table 2).

225

Secondly, haplotype replicates were picked up in the above two specimens. Thirdly,

226

although these two specimens were collected in different years, one in November 20th, 2010,

227

the other in November 5th, 2011, with a geographic distance up to about 400 km, they shared

228

the same haplotype MF135580 (Table 2, Supplementary material 2). The 18S and 28S rRNA

229

data also reveal similar results (Table 3, Supplementary material 2). All these provide solid

230

evidence of the sequence accuracy of the molecular data of X. xingyuarum obtained by the

231

molecular clone method.

rR

Fo

223

The sequences of Xingyurella turgida and X. xingyuarum form the same monophyletic

233

clade on both ML and Bayesian analyses (Figs 1, 2). This further increases confidence in the

234

accuracy of the 16S, 18S and 28S sequences of both species that originated from both

235

Eastern and Western coasts of the North Pacific Ocean. It rules out the possibilities of DNA

236

contamination, e.g., by other Sertularella species, during molecular experiments. The COI

237

sequences of X. xingyuarum were not selected for phylogenetic analyses because only a few

238

relevant reference sequences were available from GenBank. Nevertheless, their accuracy can

239

be inferred based on their position in the unpublished COI tree with limited taxa constructed

240

by Song (2016).

241

Main molecular clades. The Bayesian analysis of the 16S rRNA results is almost the same

242

topology as the ML tree, only several sequences emerge in slightly different positions (Fig.

243

1), whereas the topology of the different analyses for the concatenated 16S+18S+28S tree is

244

exactly the same (Fig. 2). The present trees concur with the new classification proposed by

iew

ev

232

ly

On

http://www.publish.csiro.au/journals/is

Page 13 of 77

Invertebrate Systematics

245

Maronna et al. (2016). The clades on the concatenated tree are similar with the 16S tree,

246

except for the absence of some taxa. So only the related clades on the 16S rRNA tree were

247

used and analyzed in the following. Even only with 16S rRNA sequences of 14 identified Sertularella and Xingyurella

249

species, the paraphyletic clades of the Sertularellidae could be manually divided into six

250

sub-clades annotated as C1 to C6 (Fig. 1). These clades are also presented on the

251

concatenated tree except clade C3 (Fig. 2). The first clade, C1 includes Sertularella

252

mediterranea Hartlaub, 1901, S. ornata Broch, 1933, S. polyzonias (Linnaeus, 1758) (type

253

species of Sertularella), S. ellisii (Deshayes & Milne Edwards, 1836), S. africana Stechow,

254

1919 and several unidentified sequences. Then Clade 4 to Clade 6 cover several other

255

Sertularella species, including Sertularella gayi (Lamouroux, 1821), S. robusta Coughtrey,

256

1876 (C4), S. sanmatiasensis EI Beshbeeshy, 2011, S. rugosa (Linnaeus, 1758) (C5) and S.

257

diaphana (Allman, 1885) (C6).

iew

ev

rR

Fo

248

On

The Xingyurella clade (Fig. 1: C2) clusters together with Sertularella simplex (Hutton,

259

1873) (C3), but not with clades of the genera Antarctoscyphus, Fraseroscyphus Boero &

260

Bouillon, 1993 and Symplectoscyphus which also have three hydrothecal cusps and three

261

opercular valves. On the 16S tree, the non-parametric bootstrapping of ML analysis and

262

posterior probability of Bayesian analysis of this clade (C2 + C3) are 73 and 0.98,

263

respectively (Fig. 1). On the concatenated tree, the ML and Bayesian values are 95 and 1

264

(Fig. 2), respectively. Both trees show relatively high stability of the Xingyurella clade. This

265

result is generally consistent with other trees of different data sets containing Xingyurella

266

turgida (as Symplectoscyphus turgidus, Leclère et al. 2009; Moura et al. 2011; Maronna et al.

ly

258

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 14 of 77

267

2016; Song 2016; Song et al. 2016b). This suggests that Xingyurella turgida should not be

268

treated as a questionable taxon and overlooked only due to its “peculiar” position. It seems

269

appropriate to test these findings from molecular phylogenetics by integrating morphological

270

data.

271

Integrative analyses and review

273

Species with molecular data. It is striking that all species of the Sertularellidae and

274

Thyroscyphidae clades with hydrothecae bear four marginal teeth and four opercular valves

275

except for the Xingyurella clade (Fig. 1: C2). Although the Xingyurella clade and the

276

Symplectoscyphidae clade occupy distant phylogenetic positions, they share the same

277

hydrothecal characters with three marginal teeth and three opercular valves (Fig. 1).

iew

ev

rR

Fo

272

The gonothecal structures of the Sertularellidae clades are relatively complex. They

279

could be manually divided into three morphological types. The first type (Fig. 1: C1, C3, C4,

280

C5), including the type species of Sertularella, S. polyzonias, shares the following characters:

281

surface with transverse grooves, without spines, with several apical cusps (Figs 1–2,

282

Supplementary material 3). The Xingyurella clade (Fig. 1: C2) represents the second type:

283

with surface spines, and several apical cusps (Figs 1, 2H, 3, 6 and Supplementary material 3).

284

It is different from the genera of Symplectoscyphidae that do not have any gonothecal spines

285

(Figs 3X–Z). The female gonotheca of Staurotheca antarctica Hartlaub, 1904 also has

286

similar surface spines, but is distinguished from Xingyurella by two basal digitiform

287

projections (Fig. 3AB). Sertularella diaphana (Fig. 1: C6) represent the third type, with

288

several longitudinal ridges and a gonothecal operculum composed of two equal valves,

ly

On

278

http://www.publish.csiro.au/journals/is

Page 15 of 77

Invertebrate Systematics

289

without neck and apical cusps (Fig. 3N). The gonotheca of the Thyroscyphidae clade is

290

completely different from the above three types: surface smooth, without gonothecal neck or

291

apical cusps (Fig. 3W, Supplementary material 3). The different morphological types of gonothecae described above are generally in

293

accordance with different molecular clades. This indicates that the morphology of

294

gonothecae is valuable for the systematics of Sertularellidae.

295

Typical species without molecular data. The gonothecae of some other Sertularella species

296

without molecular data are much more typical and diversified. Six species of them should be

297

noticed (Fig. 3): Sertularella acutidentata Billard, 1919 and S. quadridens (Bale, 1884) are

298

similar with S. diaphana, but have different numbers of apical cusps and gonothecal

299

opercular valves (Figs 3O, T); Sertularella albida Kirchenpauer, 1884 and S. mirabilis do

300

not have apical cusps (Figs 3P, S); Sertularella inabai is similar with Xingyurella, but have

301

several longitudinal ribs (Figs 3Q–R); Sertularella spirifera has several spines around the

302

gonothecal neck, but does not have apical cusps (Fig. 3U).

303

Integrative analyses for taxonomic diagnoses. Further comparative analyses of 23

304

morphological characters of 23 related species of the family Sertulariidae Lamouroux and

305

Thyroscyphidae are listed in Supplementary material 3. Some family or generic diagnoses

306

could be easily extracted, e.g. Thyroscyphidae is characteristic of pedicellate hydrothecae

307

(Supplementary material 3: column D1), Calamphora parvula has unique stolonal colonies

308

(A1), Sertularella mirabilis forms net-like colonies (A2).

iew

ev

rR

Fo

292

ly

On

309

Moreover, the gonothecal characters listed in the Supplementary material 3 seem to be

310

relatively stable and permit the recognition of some main clades in Sertularellidae (see

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 16 of 77

above). This does not yet count for the presence or absence of the gonothecal acrocyst

312

(Supplementary material 3: column E8) because little acrocyst data are available at present.

313

Some hydrothecal characters, such as hydrothecal arrangement pattern on hydrocladium

314

(D2), hydrotheca free or partially adnate (D3), hydrothecal surface smooth or with grooves

315

(D4), and the numbers of hydrothecal internal teeth (D7), also contribute little valuable

316

information for generic diagnoses. The characters related to branching pattern, e.g.

317

hydrocladium with or without branching apophysis (C2), with or without the axillary

318

hydrotheca (C3), with or without repeated dichotomously branchlets (C4) might be useful

319

for diagnoses at genera or species level. However, it is difficult to judge their taxonomic

320

values at present because they were usually ignored by earlier taxonomists.

321

Proposal for the new genus. The systematics of the Sertularellidae becomes much more

322

complicated if species without molecular sequences are included. Nevertheless, Xingyurella

323

is the most reasonable and persuasive monophyletic clade to be proposed as a new genus at

324

least according to its unique hydrothecal and gonothecal characters. These characters include

325

hydrothecae with three marginal teeth and three opercular valves, as well as gonothecal

326

surface with strong spines.

327

Integrative review and revision. A subsequent review of the nominal species of the family

328

Sertulariidae Lamouroux supports the assignment of Sertularella gotoi and Sertularella

329

pedrensis Torrey, 1904 to Xingyurella according to similar morphological characters. All

330

these lead us to propose three new taxonomic combinations including Xingyurella gotoi, X.

331

pedrensis and X. turgida, and a new species Xingyurella xingyuarum sp. nov. See detailed

332

descriptions and diagnoses in the Systematic account.

iew

ev

rR

Fo

311

ly

On

http://www.publish.csiro.au/journals/is

Page 17 of 77

Invertebrate Systematics

333 334

Systematics Class Hydrozoa Owen, 1843

336

Subclass Hydroidolina Collins, 2000

337

Superorder Leptothecata Cornelius, 1992

338

Order Macrocolonia Leclère, Schuchert, Cruaud, Couloux & Manuel, 2009

339

Suborder Sertulariida Maronna, Miranda, Peña Cantero, Barbeitos & Marques, 2016

340

Family Sertularellidae Maronna, Miranda, Peña Cantero, Barbeitos & Marques, 2016

rR

Fo

335

341

Genus Xingyurella gen. nov.

Etymology. xingyu is derived from two Chinese characters in the given names of the first

343

author’s wife “xing” and daughter “yu”, meaning "meteor shower" in Chinese. Its gender is

344

feminine.

345

Type species. Xingyurella xingyuarum sp. nov.

346

Diagnosis. Colony with or without distinct hydrocauli. When hydrocauli branched, with

347

axillary hydrotheca, the axillary apophysis absent; the basal internode of each branchlet is

348

discernibly longer than other internodes, sometimes with a pedicle at the base. Hydrocauli

349

and hydrocladia with regular and oblique internodes, each internode bearing a hydrotheca.

350

Hydrothecae alternately arranged in two longitudinal rows in one plane; hydrotheca tubular,

351

partly adnate, smooth or with grooves, with three marginal cusps, one adcauline and two

352

lateral abcauline, and three opercular valves forming a pyramid, with or without internal

353

tooth; retracted hydranth with abcauline caecum. Gonotheca ovate, growing directly from

354

hydrocaulus or hydrocladium, pedicellate, with strong spines partly or entirely covering the

iew

ev

342

ly

On

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 18 of 77

355

surface

356

mastigophores.

357

Remarks. When branched, the absence of an axillary apophysis is characteristic in

358

Xingyurella. Generally, an axillary apophysis is present in the genera Antarctoscyphus and

359

Symplectoscyphus (Song et al. 2016b). The basal internode of the hydrocladium in

360

Xingyurella is distinctly longer and thinner than other internodes growing towards the distal

361

end. Sometimes a basal pedicle is present on this internode. This kind of pedicle is observed

362

in X. turgida (Fig. 4E) where the hydrocladium arises. The pedicle in Xingyurella is fairly

363

similar but still differs from the axillary apophysis in the genera Antarctoscyphus and

364

Symplectoscyphus, which belongs to one of the two extended processes of the hydrocaulus.

of

gonotheca.

Nematocyst

capsule

spindle-shaped,

possibly

microbasic

ev

rR

Fo

Gonothecal spines also exist in some other genera of the family Sertulariidae

366

Lamouroux, but they are mostly located in different positions or arranged in different

367

patterns. Some species of the genus Sertularia (including the type species, Sertularia

368

argentea Linnaeus, 1758) have only several apical spines or horns. Some species of the

369

genus Diphasia L. Agassiz, 1862, Staurotheca Allman, 1888 (Figs 3AA–AB) and

370

Tamarisca Kudelin, 1914, also have a lot of spines like Xingyurella, but they are arranged

371

and positioned in different arrays, with the exception of Diphasia digitalis Busk, 1852.

372

Diphasia digitalis also has spines throughout the gonothecal surface, but it does not have

373

apical cusps (Nutting 1904; Song 2016). Molecular data suggest that Diphasia, Sertularia

374

and Staurotheca occupy different phylogentic positions remote to Xingyurella (Figs 1, 2).

375

The position of Tamarisca is still unknown; nevertheless, it seems to have little

376

morphological affinity with Xingyurella.

iew

365

ly

On

http://www.publish.csiro.au/journals/is

Page 19 of 77

Invertebrate Systematics

377

A key (see below) and a comparative table (Table 5) for the morphology of Xingyurella

378

and the doubtful species Sertularella nodulosa Calkins, 1899 are given in the present study.

379

See discussion of S. nodulosa in the Remarks of X. turgida.

380

Key to species of Xingyurella and the doubtful species Sertularella nodulosa

382

1 Matured gonotheca with spines only on the upper part of the surface ................................ 2

383

– Matured gonotheca with spines throughout the surface ...................................................... 3

384

2 Hydrotheca turgid, hydrocaulus not branched, if rarely abnormally branched, without an

385

axillary hydrotheca .................................................................................................... X. turgida

386

– Hydrotheca not turgid, hydrocaulus branched, an axillary hydrotheca present at the

387

branching place..................................................................................... Sertularella nodulosa

388

3 Hydrotheca much more tapering towards the distal end, surface almost smooth, with

389

hydrothecal internal teeth ..............................................................................................X. gotoi

390

– Hydrotheca slightly tapering towards the distal end, surface with obvious transverse

391

grooves, without internal teeth ............................................................................................... 4

392

4 Colony stout, hydrocaulus not branched or rarely branched, hydrotheca 1/3–1/2 adnate,

393

grooves only located on the middle part of hydrothecal surface ........................... X. pedrensis

394

– Colony slender, hydrocaulus always branched, branches with repeatedly dichotomous

395

ramifications, hydrotheca almost free, strong grooves throughout the hydrothecal surface .. X.

396

xingyuarum

iew

ev

rR

Fo

381

ly

On

397 398

Xingyurella turgida (Trask, 1857) comb. nov.

399

(Figs 4, 8)

400

Sertularia turgida Trask, 1857: 113, pl. 4, fig. 1.

401

Sertularella turgida – Clark, 1877: 259–260, pl. 38, figs 4–5; Hartlaub, 1901a: 360, pl. 21,

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 20 of 77

402

figs 5–6; Hartlaub, 1901b: 67, pl. 2, fig. 30, pl. 3, figs 21–22; Torrey, 1902: 64–65, pl. 7,

403

figs 59–62, pl. 8, figs 63–69; Nutting, 1904: 95, pl. 22, figs 2–5.

404

Symplectoscyphus turgidus – Stechow, 1923b: 173.

405

Not Sertularella turgida – Calkins, 1899: 359–360, pl.4, figs 22, 22A–B [ = Sertularella

406

conica Allman, 1877]; 360–361, pl.5, figs 29, 29A [ = Sertularella nodulosa Calkins,

407

1899].

408

Fo

409

? Sertularella turgida – Fraser, 1911: 71; 1914: 193; 1935: 145; 1936: 126; 1937: 160, pl. 36, figs 192a–b; Stechow, 1913b: 133, fig. 105.

rR

? Diphasia sp. – Inaba, 1890: 296, figs 32–33.

411

? Symplectoscyphus turgidus – Stechow, 1923c: 12; Yamada, 1959: 58; Hirohito, 1983: 56,

412

414

fig. 26; 1995: 225–228, figs 77a–c; Park, 1998: 63, fig.3.

iew

413

ev

410

Type locality. Bay of San Francisco, Monterey, Tomales Point, attached on mollusca and algae (Trask 1857).

On

Type material. The type material of this species could not be found in the invertebrate

416

collections of the Department of Invertebrate Zoology and Geology, California Academy of

417

Sciences (CASIZ).

418

Neotype. MHNG-INVE-29467 (Figs 4H–L), with 16S, 18S and 28S rRNA data (Leclère et

419

al. 2009; Supplementary material 2). See collecting information in Supplementary material 1

420

and measurements in Table 4.

ly

415

421 422

Description. Trophosome. Colony erect, unbranched (Figs 4A–C) or rarely branched (Fig.

423

4E, I); rare abnormal branchlets only emerging on the upper part of hydrocauli, without the

http://www.publish.csiro.au/journals/is

Page 21 of 77

Invertebrate Systematics

axillary hydrotheca and the axillary apophysis; the basal internode of every branchlet with a

425

relatively long pedicle (Fig. 4E). With regular and oblique internodes, contracted at both

426

ends of each internode; each internode bearing a hydrotheca. Hydrothecae arranging tightly,

427

alternately in two longitudinal rows in one plane; hydrotheca turgid, half of the adcauline

428

part adnate, becoming shrunk and narrow towards the distal end (Figs 4E, J), margin with

429

three cusps, one adcauline and two lateral abcauline, three intrathecal teeth observed (Figs

430

4J–K); operculum composed of three valves forming a pyramid, retracted hydranth with

431

poorly developed abcauline caecum (Fig. 4J).

rR

Fo

424

Gonosome. Gonotheca ovate, pedicellate, growing directly from lower part of

433

hydrocaulus (Figs 4H–I). The upper part of the gonothecal surface with upward strong

434

spines, the lower part with transverse grooves (Figs 4D, F–G, L).

435

Distribution. Coast of California, USA (Fig. 8), shallow waters no more than 30 m deep.

436

Remarks. Hartlaub (1901b) treated Sertularella conica Allman, 1877 and Sertularella

437

nodulosa as synonyms of X. turgida (as Sertularella turgida), which was accepted by Torrey

438

(1902), Nutting (1904) and Hirohito (1995). However, after a review of the original

439

descriptions of S. conica and S. nodulosa, we find that they are different species than X.

440

turgida. Nutting (1904) mentioned that Sertularella conica has four marginal cusps. This

441

means that it belongs to the genus Sertularella, but it differs from X. turgida. The other

442

nominal species, S. nodulosa exhibits characters of hydrotheca (with three marginal cusps)

443

and gonotheca (with strong spines) that are typical for the newly proposed genus Xingyurella.

444

This suggests that S. nodulosa may be an additional species that could be moved to

445

Xingyurella. Sertularella nodulosa is different from X. turgida by its well-developed

iew

ev

432

ly

On

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 22 of 77

446

branching pattern (with secondary branchlets and an axillary hydrotheca present, Table 5). It

447

is also different from other Xingyurella species (X. gotoi, X. pedrensis and X. xingyuarum)

448

by the coverage rate of gonothecal spines (Table 5). Its gonothecal spines only cover the

449

distal half of the gonothecal surface (Calkins 1899), while the spines of the above three

450

Xingyurella species cover the entire gonothecal surface (Table 5). Diphasia sp. recorded by Inaba (1890) from Japan is very similar to X. turgida

452

according to the illustrations. It shares the same simple branching pattern, the same coverage

453

rate of spines on gonothecal surface, and the same number and arrangement pattern of

454

hydrotheca internal teeth (Table 5). Three main differences could be found from the

455

illustration Figure 33 (Inaba 1890: 296): the hydrotheca is much longer, its surface is smooth,

456

and it does not suddenly shrink towards the distal end (Table 5).

iew

ev

rR

Fo

451

The records of Symplectoscyphus turgidus by Hirohito (1983, 1995) from Sagami Bay

458

and Park (1998) from Jeju Island are doubtful. These records represent a morphological type

459

that differs from X. turgida, X. gotoi and X. xingyuarum. The latter species are simply

460

branched, similar to X. turgida. However, the hydrotheca is much narrower and longer, its

461

surface is smooth, and the spines are covering the entire gonothecal surface (Hirohito 1983,

462

1995; Park 1998). Hirohito (1983, 1995) noticed the morphological differences of X. turgida

463

(as Symplectoscyphus turgidus) and X. gotoi (as Sertularella gotoi), but he still treated

464

Sertularella gotoi as a synonym of Symplectoscyphus turgidus. He mentioned that both

465

nominal species may be very variable in the morphological characters of hydrotheca and

466

gonotheca, but he thought the differences of these characters had no importance for

467

identification (Hirohito 1995). He mentioned that he found intermediate forms in the

ly

On

457

http://www.publish.csiro.au/journals/is

Page 23 of 77

Invertebrate Systematics

developmental degree of spines of gonothecae in the Sagami Bay samples of S. turgidus

469

(Hirohito 1983), but he did not clearly describe in the text or draw convincing illustrations

470

showing the intermediate gonothecal form that are typical in the Californian records of X.

471

turgida. In his illustrations, spines are completely absent (Hirohito 1988: Fig. 26a) or

472

entirely covering the gonothecal surface (Hirohito 1988: Figs 26b–f; 1995: Figs 77a, c). The

473

samples of Hirohito (1983, 1995) were collected from water depths ranging from 4 m to 150

474

m. It seems possible that the material he attributed to S. turgidus included several species

475

and, therefore, should be re-examined.

rR

Fo

468

476

Xingyurella pedrensis (Torrey, 1904) comb. nov.

478

(Figs 5, 8)

iew

ev

477

Sertularella conica – Torrey, 1902:60.

480

Setularella pedrensis Torrey, 1904: 27, figs 19–21.

481

Not Setularella pedrensis – Park & Rho, 1986: 17–18, figs 4e–g, pl.1, fig. f [ =Xingyurella xingyuarum sp. nov.].

ly

482

On

479

483

Type locality. San Pedro, Los Angeles, California, USA.

484

Type material. USNM43716, 110 m, 1901.VIII.01, Torrey H.B., not examined in the present

485

study.

486

Specimens examined. CASIZ material, see collecting information in Supplementary material

487

1 and measurements in Table 4.

488

Description. Trophosome. Colony erect, hydrocaulus unbranched or rarely branched, if

489

branched, with an axillary hydrotheca, without axillary apophysis, the basal internode of

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 24 of 77

each branchlet is longer than other internodes, without pedicle at the base (Fig. 5E).

491

Hydrocaulus and hydrocladium with regular and oblique internodes, slightly contracted at

492

both ends of each internode; each internode bearing a hydrotheca. Hydrothecae arranging

493

alternately in two longitudinal rows in one plane; hydrotheca tubular, the upper part with

494

three to four transverse grooves which are stronger on the adcauline side (Figs 5D, F), half

495

of the adcauline part adnate, becoming narrow towards the distal end, margin with three

496

cusps, one adcauline and two lateral abcauline, no intrathecal teeth observed; operculum

497

composed of three valves forming a pyramid, retracted hydranth with poorly developed

498

abcauline caecum (Fig. 5F).

rR

Gonosome. Gonotheca absent in examined material. A gonotheca (Fig. 3H) was

ev

499

Fo

490

redrawn with reference to Torrey (1904).

501

Distribution. Coasts of California (Torrey 1902, 1904) and Oregon, USA (Fig. 8), water

502

depth 77–110 m.

503

Remarks. Torrey (1902) overlooked the gonotheca material, mentioned “the gonosome still

504

remains unknown”, and then he discovered two gonothecae in the same San Pedro colonies

505

(Torrey 1904). According to the online registration platform hosted by NMNH (National

506

Museum of Natural History, USA), the registered information of the type material of

507

Sertularella pedrensis was consistent with Torrey (1902, 1904). Although we have not

508

re-exanimated the type material, the original descriptions and illustrations of hydrotheca and

509

gonotheca by Torrey (1902, 1904) are sufficient to assign this species to the genus

510

Xingyurella.

ly

On

511

iew

500

For the CASIZ specimens examined in this study, the morphological characters of

http://www.publish.csiro.au/journals/is

Page 25 of 77

Invertebrate Systematics

512

branching patterns and hydrotheca, as well as the collecting locality and water depth are

513

consistent with the original description of Sertularella pedrensis. Even without available

514

gonotheca material, it differs from Antarctoscyphus and Symplectoscyphus species by the

515

presence of a basal internode of the branchlet that is much longer than other internodes, as

516

well as the absence of an axillary apophysis (Fig. 5E). Similar structures are also present in

517

Xingyurella xingyuarum (Fig. 7B).

518

Xingyurella gotoi (Stechow, 1913) comb. nov.

rR

520

Fo

519

(Figs 6, 8)

Sertularella gotoi Stechow, 1913a: 142; 1913b: 132, fig. 104.

522

Symplectoscyphus gotoi – Stechow, 1923c, 12; Yamada, 1959: 59.

523

? Sertularella turgida – Nutting, 1904: 95, pl. 22, figs 2–5.

524

Type locality. Sagami Bay, Japan.

525

Lectotype. ZSM20040227, the largest fertile colony in type material (Fig. 6A). Paralectotype,

526

ZSM20050746–20050752 (Figs 6B–G). See collecting information in Supplementary

527

material 1 and measurements in Table 4.

528

Description. Trophosome. Colonies arising from irregular stolons creeping on the

529

hydrocaulus of another hydroid species (Fig. 6A), hydrocaulus rarely branched at the angle

530

of 60–100°, with an axillary hydrotheca, without axillary apophysis, the basal internode of

531

each branchlet is longer than other internodes, without a pedicle at the base (Figs 6B–C),

532

secondary hydrocladium not observed. Hydrocaulus and hydrocladium with regular and

533

oblique internodes, contracted at both ends of each internode; each internode bearing a

iew

ev

521

ly

On

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 26 of 77

534

hydrotheca. Hydrothecae sparsely arranged (Figs 6B–E), alternately in two longitudinal

535

rows forming one plane; hydrotheca tubular, surface almost smooth, one to two fine

536

transverse grooves observed in the adcauline side of several hydrothecae (Fig. 6E); a third of

537

the adcauline part adnate, becoming narrow towards the distal end (Figs 6E–F), margin with

538

three cusps, one adcauline and two lateral abcauline, two intrathecal teeth observed in

539

several hydrothecae (Figs 6E–F); operculum composed of three valves, retracted hydranth

540

with poorly developed abcauline caecum (Fig. 6F).

Fo

Gonosome. Gonotheca oval, pedicellate, growing directly from lower part of

542

hydrocaulus, gonothecal surface with upward strong spines throughout (Figs 6A, C–D, G),

543

sex unknown.

544

Distribution. Sagami Bay, Japan (Fig. 8), water depth 600 m.

545

Remarks. Xingyurella gotoi is the only known species of the genus Xingyurella recorded in

546

the deep-sea (600 m). It resembles X. pedrensis and X. xingyuarum, which are distributed in

547

relatively shallow (no more than a hundred meters) and cold coast waters. In its original

548

description, Stechow (1913a, 1913b) mentioned that it is very similar to X. pedrensis (as

549

Sertularella pedrensis), but distinguishes these two species by three characters, including the

550

difference of grooves (girdling racks, strong or weak) on the hydrothecal surface, the

551

branching pattern and the length of the gonothecal spines. Xingyurella xingyuarum bears the

552

characteristic feature of strong transverse grooves distributed almost throughout the

553

hydrothecal surface. These grooves are stronger than in any other known species of the

554

genus. Moreover, no hydrothecal internal teeth were observed in X. xingyuarum, while there

555

are two internal teeth in some hydrothecae of X. gotoi (Figs 6E–F, Table 5).

iew

ev

rR

541

ly

On

http://www.publish.csiro.au/journals/is

Page 27 of 77

Invertebrate Systematics

556 557

Xingyurella xingyuarum sp. nov.

558

(Figs 7–8)

559

Setularella pedrensis – Park & Rho, 1986: 17–18, figs 4e–g, pl.1, fig. f.

560

Sertularella gotoi – Rho & Chang, 1974: 142: pl.5, figs 3–5; Rho, 1977: 269, pl. 85, fig. 83;

561

Park & Rho, 1986:17; Park, 1990: 80; 1992: 291; 1995:14; 2010: 92–94, fig. 50. Etymology. The same as the genus name.

563

Type locality. Yellow Sea.

564

Specimens examined. See details in Supplementary material 1.

565

Type material. Holotype, MBM000479. Paratype, MBM280254 (with 16S, 18S and 28S

566

rRNA data, Supplementary material 2), MBM280259 (with COI, 18S and 28S rRNA data,

567

Supplementary material 2), MBM000482, MBM000483, MBM000453, MBM000484. See

568

collecting information in Supplementary material 1 and measurements in Table 4.

569

Description. Trophosome. Colonies yellowish-brown, slender, with one or several

570

hydrocauli, hydrocaulus zigzag-shaped, hydrocladium spirally, repeatedly ramified

571

dichotomously at the angle of 20–30° (Fig. 7A), with an axillary hydrotheca, without

572

axillary apophysis, the basal internode of each branchlet is much longer than other

573

internodes, without pedicle at the base (Fig. 7B); hydrocaulus and hydrocladium with

574

oblique internodes, contracted at both ends of each internode (Figs 7B–C); hydrocaulus

575

internodes irregular in length, hydrocladium internodes regular; generally each internode

576

bearing a hydrotheca, except some hydrocaulus internodes without hydrotheca (Fig. 7B).

577

Hydrothecae sparsely arranged (Figs 7B–C), alternately in two longitudinal rows forming

iew

ev

rR

Fo

562

ly

On

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 28 of 77

one plane; hydrotheca tubular, surface with five to nine strong transverse grooves throughout,

579

always stronger in the adcauline side (Figs 7B–C, E–G); hydrotheca almost totally free, only

580

an eighth to a fifth of the adcauline part adnate; hydrotheca becoming slightly narrower

581

towards the distal end, but extended at the hydrotheca mouth, margin with three cusps, one

582

adcauline and two lateral abcauline, no intrathecal teeth observed (Figs 7B–C, E–G);

583

operculum composed of three valves forming a pyramid (Figs 7E–G); retracted hydranth

584

with well-developed abcauline caecum (Fig. 7G). See also Supplementary material 4 for

585

light micrographs (raw data for drawings).

rR

Fo

578

Gonosome. Gonotheca oval, pedicellate, growing directly from hydrocaulus or

587

hydrocladium, gonothecal surface with upward strong spines throughout (Figs 7D–F). Two

588

distinct morphological types of gonothecae observed, possibly sexually dimorphic, vary in

589

the length and the density of spines. The first morphological type with long and sparse

590

spines (Fig. 7D), while the other type with dense and short spines (Figs 7E–F). Sex

591

unknown.

iew

ev

586

On

Nematocysts. Only one morphological type observed (Supplementary material 5),

593

possibly microbasic mastigophores, undischarged capsules spindle-shaped, a discharged

594

nematocyst with a well-developed long shaft, no thread observed.

595

Distribution. Korea (Park 1986), Bohai Sea, Yellow Sea, East China Sea (Fig. 8), water

596

depth 10–70 m.

597

Remarks. This new species is characterized by its slender colony, with spirally, repeatedly

598

and dichotomously branched hydrocaulus, an almost totally free hydrotheca, as well as

599

strong transverse grooves throughout the hydrotheca. See morphological comparisons with

ly

592

http://www.publish.csiro.au/journals/is

Page 29 of 77

Invertebrate Systematics

600

related species in Table 5 and the Remarks of other Xingyurella species. The Korean specimens of Sertularella pedrensis by Park and Rho (1986) resemble

602

Xingyurella xingyuarum by the morphologies of colony, hydrotheca and gonotheca. They are

603

also characterized by strong grooves on the hydrothecal surface. Some other coastal records

604

from Korea (20–30m) were identified as Sertularella gotoi by Rho and Chang (1974), Park

605

and Rho (1986) and Park (2010). The hydrothecal grooves of these specimens (Park and Rho

606

1986; Park 2010: 93) are stronger than X. gotoi, but a bit shallower than X. xingyuarum.

607

Indeed, these specimens much resemble X. xingyuarum, except for some minor differences,

608

e.g. the gonothecal spines being slightly shorter. As a result, we treated all the above Korean

609

samples as X. xingyuarum.

610

iew

ev

rR

Fo

601

Discussion

612

Fine generic diagnoses and fine systematics

613

Although only limited molecular data (Figs 1–2) are available, they are important for the

614

establishment and integrative review of the new genus Xingyurella. The morphological

615

diversity of gonothecae within the family Sertularellidae (Figs 1–3, Supplementary material

616

3) suggests a conspicuous complexity in systematics of this family. Currently we are still far

617

from conducting a comprehensive taxonomic revision of the whole family, which would

618

require many more re-descriptions of species and sequences from fresh material. It remains

619

unclear whether some morphologically related genera provisionally attributed to the family

620

Sertulariidae Lamouroux, e.g. Calamphora Allman, 1888, Papilionella Antsulevich &

621

Vervoort, 1993, Polysertularella Antsulevich, 2011, should be assigned to this recently

ly

On

611

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

622

Page 30 of 77

proposed family Sertularellidae.

623

Some morphological characters listed in Supplementary material 3 may be used as fine

624

generic diagnoses of Sertularellidae in the future, especially the diversified gonosome

625

characters (Fig. 3). In fact, some gonosome characters have been commonly used in other

626

families of the order Leptothecata (Hydrozoa), e.g., the gonothecal protecting structures that

627

are important generic characters for the families Aglaopheniidae L. Agassiz, 1862 and

628

Plumulariidae Agassiz, 1862 (Bouillon et al. 2006).

Fo

Other trophosome characters beyond hydrotheca should also be paid attention to. For

630

example, Sertularella mirabilis is characteristic with net-like colonies (Hirohito 1995; Song

631

2016). Stechow (1920) treated this character as generic diagnosis, establishing the genus

632

Serta. However, Billard (1925) and Hirohito (1995) preferred to move Serta mirabilis to

633

Sertularella. Interestingly, net-like colonies are not unique for Sertularella mirabilis: Song

634

(2016) noticed that Sertularella valdiviae Stechow, 1923 also have similar colonies after

635

re-examination of the type material deposited in the ZSM. Similar colonies were also

636

confirmed in Sertularella cervicula Choong, 2015 and S. sacciformis Choong, 2015 (H.

637

Choong, pers. comm.). Accordingly, it should be further clarified whether they should be

638

moved back to the genus Serta or not.

iew

ev

rR

629

ly

On

639 640

Possible intermediate morphological forms

641

It is intriguing that Xingyurella clusters together with Sertularella simplex (Fig. 1). In other

642

unpublished 16S and COI trees by Song (2016), the same Sertularella simplex clade also

643

contains Sertularella mirabilis and Sertularella miurensis Stechow, 1921. Nevertheless, it is

http://www.publish.csiro.au/journals/is

Page 31 of 77

Invertebrate Systematics

644

still difficult to imagine or conceive any intermediate forms between such morphologically

645

deviant clades (Fig. 1). Could Sertularella inabai and Sertularella spirifera be candidate(s)

646

for potential intermediate forms between Sertularella and Xingyurella? At least both species

647

have gonothecal spines (Figs 3Q–R, U) similar to those of X. turgida (Fig. 4L).

648

Transoceanic distribution

650

The assignment of both Xingyurella gotoi and X. pedrensis to the genus Xingyurella may

651

appear justified by significant morphological similarities. Sertularella nodulosa may

652

possibly belong to Xingyurella (see Systematics). According to biogeographic data available,

653

the genus Xingyurella (Fig. 8) and S. nodulosa (Calkins 1899) seem to be endemic to the

654

eastern and western coasts of the North Pacific Ocean. Another species of the family

655

Symplectoscyphidae, Fraseroscyphus hozawai, is also reported to have a similar

656

transoceanic distribution pattern (Song et al. 2016b).

iew

ev

rR

Fo

649

On

Several Sertularella species with net-like colonies discussed above are reported to be

658

distributed in wider regions. They are not only distributed in the shallow water of the eastern

659

(Choong 2015) and the western coasts (Jäderholm 1896; Hirohito 1995; Song 2016) of the

660

North Pacific Ocean, but also in the deep-sea of the Indian Ocean (Stechow 1923a, 1925,

661

water depth, 672 m). It is most likely that the distribution range of Xingyurella will expand

662

when more species and specimens are recorded; nevertheless, future research will be

663

valuable for understanding the evolution and speciation accompanied with the transoceanic

664

distribution pattern.

ly

657

665

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 32 of 77

Genetic relevance

667

Although Xingyurella turgida and X. xingyuarum seem to be distinct morphological species,

668

their genetic distance of the 16S rRNA (0.014–0.016) is not very divergent compared with

669

the 18S (0.052–0.053) and 28S rRNA (0.090). This still suggests high genetic relevance of

670

both species existed in the eastern and western side of the Pacific Ocean. Even higher

671

sequence similarity of some species of the genus Sertularia (Sertulariidae Lamouroux) was

672

also detected elsewhere, e.g. Sertularia plumosa (Clark, 1877) and Sertularia robusta (Clark,

673

1877) have very distinct morphological characters in hydrotheca marginal cusps and

674

opercular valves, yet their 16S rRNA similarity is 99.0% (Song et al. 2016a). This may be

675

partially attributable to the conservative nature of the 16S rRNA gene (Song et al. 2016a).

676

Xingyurella pedrensis, X. gotoi and X. xingyuarum, with similar gonothecal characters (also

677

see differences in Table 5), might also have high sequence similarity and genetic relevance

678

across the Pacific Ocean.

iew

ev

rR

Fo

666

Potential evolutionary trend

ly

680

On

679

681

The variation of branching patterns within Xingyurella seems to be heuristic. Song et al.

682

(2016b) newly introduced this character complex for generic diagnoses of three closely

683

related Symplectoscyphidae genera. They inferred that the lack of a hydrocauline apophysis

684

and an axillary hydrotheca represents the plesiomorphic condition, while the developed

685

branching pattern, emerging of the apophysis and axillary hydrotheca represents the derived

686

condition (Song et al. 2016b). Similarly, Xingyurella could be also split into two types by

687

similar morphological differences of the branching pattern. (1) Xingyurella turgida has a

http://www.publish.csiro.au/journals/is

Page 33 of 77

Invertebrate Systematics

simple branching pattern; it is unbranched or rarely abnormally branched; if branched, an

689

axillary hydrotheca is absent (Fig. 4E); it only occurs in temperate shallow waters no more

690

than 30 m deep (Trask 1857; this study). (2) Xingyurella pedrensis, Xingyurella gotoi and X.

691

xingyuarum represent the other type with a relatively complex branching pattern with an

692

axillary hydrotheca (Figs 5E, 6B–C, 7B). They are reported in deeper cold waters ranging

693

from 77 m to 110 m (Torrey 1902; this study), in the Cold Water Mass of the Yellow Sea

694

(10–70 m, this study) or in the deep-sea (600 m, Stechow 1913a, 1913b), respectively. This

695

might hint towards an evolutionary trend: Xingyurella might have evolved a complex colony

696

organization by migration from temperate shallow water to cold water and deep-sea. More

697

evaluations at the species and population levels for the genera Xingyurella and Sertularella

698

should be undertaken to test this hypothesis.

iew

ev

rR

Fo

688

As a result, the present study may serve as a research case of how inconsistent or

700

incongruent molecular and morphological inferences can be integrated to refine systematics,

701

and as a prelude to improved generic diagnoses integrating tropho- and gonosome traits for

702

Sertularellidae and other hydrozoans.

ly

703

On

699

704

Author contributions

705

XS examined the MBM material, prepared the manuscript drafts, ML and XS conducted

706

molecular analyses; XS and CG prepared the systematics; BR examined the ZSM material,

707

revised the language; JW provided partial financial support; all authors wrote the paper.

708 709

Conflicts of interest

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

710

Page 34 of 77

The authors declare no conflicts of interest.

711

Acknowledgements

713

We thank Dr Peter Schuchert (MHNG), Zyanya Mora Vallín and Christina Piotrowski

714

(CASIZ) for images, and two anonymous reviewers for constructive revisions. XS wishes to

715

express sincere thanks to Zefeng Xiao (Liaocheng University), Jinjing Chen, Lu Fang

716

(Ocean University of China), Wei Lin (XMU) and other members of his previous team. XS

717

was mainly supported by the Outstanding Postdoctoral Scholarship from the State Key

718

Laboratory of Marine Environmental Science at XMU and partially by his previous PhD

719

scholarship from UCAS and IOCAS. This is the QT scientific research report QT04.

ev

rR

Fo

712

720

iew

References

722

Allman, G. J. (1888). Report on the Hydroida dredged by H. M. S. Challenger during the

723

years 1873–76. Part II. – The Tubularinae, Corymorphinae, Campanularinae,

724

Sertularinae, and Thalamophora. The Voyage of H. M. S. Challenger, Zoology 23, 1–90.

725

Billard, A. (1925). Les hydroïdes de l'Expédition du Siboga. II. Synthecidae et Sertularidae.

727 728 729 730

ly

726

On

721

Siboga-Expeditie 7, 1–232. Bouillon, J., Gravili, C., Pages, F., Gili, J. M., Boero, F. (2006). An introduction to Hydrozoa. Memoires du Museum National D'Histoire Naturelle 194, 1–591. Calkins, G. N. (1899). Some hydroids from Puget Sound. Proceedings of the Boston Society of Natural History 28, 333–367.

http://www.publish.csiro.au/journals/is

Page 35 of 77

Invertebrate Systematics

731

Cartwright, P., Evans, N. M., Dunn, C. W., Marques, A. C., Miglietta, M. P., Schuchert, P.,

732

and Collins, A. G. (2008). Phylogenetics of Hydroidolina (Hydrozoa: Cnidaria).

733

Journal of the Marine Biological Association of the United Kingdom 88, 1663-1672.

734

doi:10.1017/S0025315408002257

735 736

Cartwright, P., and Nawrocki, A. M. (2010). Character evolution in Hydrozoa (phylum Cnidaria). Integrative and Comparative Biology 50, 456–472. doi:10.1093/icb/icq089 Choong, H. H. C. (2015). Hydroids of the genus Sertularella (Cnidaria: Hydrozoa:

738

Sertulariidae) from the Pacific coast of Canada in the collection of the Royal Ontario

739

Museum, with descriptions of four new species. Zootaxa 3925, 387–408.

740

doi:10.11646/zootaxa.3925.3.4

ev

rR

Fo

737

Clark, S. F. (1877). Report on the hydroids collected on the coast of Alaska and the Aleutian

742

Islands by W.H. Dall, U.S. Coast Survey, and party, from 1871 to 1874 inclusive.

743

Proceedings of the Academy of Natural Sciences of Philadelphia 28, 209–238.

iew

741

On

Cornelius, P. F. S. (1995). North-west European thecate hydroids and their medusae. Part 2.

745

Sertulariidae to Campanulariidae. Synopses of the British Fauna, New Series 50, 1–386.

746

Fontaneto, D., Flot, J. F., Tang, C. Q. (2015). Guidelines for DNA taxonomy, with a focus on

747

the meiofauna. Marine Biodiversity 45, 433-451. doi:10.1007/s12526-015-0319-7

748

Fraser, C. M. (1911). The hydroids of the west coast of North America. With special

749

reference to those of the Vancouver Island region. Bulletin from the Laboratories of

750

Natural History of the State University of Iowa 6, 3–91.

751 752

ly

744

Fraser, C. M. (1914). Some hydroids of the Vancouver Island region. Transactions of the Royal Society of Canada 8, 99–216.

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

753 754 755 756 757 758 759

Fraser, C. M. (1935). Some Japanese hydroids, mostly new. Transactions of the Royal Society of Canada 29, 105–112. Fraser, C. M. (1936). Hydroid distribution in the vicinity of the Queen Charlotte Islands. Canadian Field-Naturalist 50, 122–126. Fraser, C. M. (1937). Hydroids of the Pacific coast of Canada and the United States. Toronto: The University of Toronto Press. Galea, H. R., Häussermann, V., Försterra, G. (2009). New additions to the hydroids (Cnidaria:

Fo

760

Page 36 of 77

Hydrozoa) from the fjords region of southern Chile. Zootaxa 2019, 1–28.

rR

Giribet, G., Okusu, A., Lindgren, A. R., Huff, S. W., Schrödl, M., Nishiguchi, M. K. (2006).

762

Evidence for a clade composed of molluscs with serially repeated structures:

763

Monoplacophorans are related to chitons. Proceedings of the National Academy of

764

Sciences 103, 7723–7728. doi:10.1073/pnas.0602578103

iew

ev

761

Govindarajan, A. F., Boero, F., Halanych, K. M. (2006). Phylogenetic analysis with multiple

766

markers indicates repeated loss of the adult medusa stage in Campanulariidae

767

(Hydrozoa, Cnidaria). Molecular Phylogenetics and Evolution 38, 820–834.

768

doi:10.1016/j.ympev.2005.11.012

ly

On

765

769

Gravili, C., De Vito, D., Di Camillo, C. G., Martell, L., Piraino, S., Boero, F. (2015). The

770

non-Siphonophoran Hydrozoa (Cnidaria) of Salento, Italy with notes on their

771

life-cycles: an illustrated guide. Zootaxa 3908, 1–187. doi:10.11646/zootaxa.3908.1.1

772

Hartlaub, C. (1901a). Hydroiden aus dem Stillen Ocean. Ergebnisse einer Reise nach dem

773

Pacific (Schauinsland 1896–97). Zoologische Jahrbuecher, Systematik 14, 349–379.

774

Hartlaub, C. (1901b). Revision der Sertularella Arten. Abhandlungen aus dem Gebiete der

http://www.publish.csiro.au/journals/is

Page 37 of 77

Invertebrate Systematics

775 776 777 778 779 780 781

inference. The Quarterly Review of Biology 66, 411–453. Hirohito, Emperor of Japan. (1983). Hydroids from Izu Ôshima and Niijima. Publications of the Biological Laboratory, Imperial Household, Tokyo 6, 1–83. Hirohito, Emperor of Japan. (1995). The hydroids of Sagami Bay. II. Thecata. Publications of the Biological Laboratory, Imperial Household, Tokyo: 1–244. Inaba, M. (1890). Hydroida collected at Misaki, Miura, Soshu. Zoological Magazine 2,

rR

783

Hillis, D. M, Dixon, M. T. (1991) Ribosomal DNA: molecular evolution and phylogenetic

Fo

782

Naturwissenschaften, Naturwissenschaftlicher Verein in Hamburg 16, 1–143.

292–297. [in Japanese]

Jäderholm, E. (1896). Ueber aussereuropäische Hydroiden des zoologischen museums der

785

Universität Upsala. Bihang till Kongl. Svenska Vetenskaps-Akademiens Handligar 4,

786

1–20.

iew

ev

784

Leclère, L., Schuchert, P., Cruaud, C., Couloux, A., Manuel, M. (2009). Molecular

788

phylogenetics of Thecata (Hydrozoa, Cnidaria) reveals long-term maintenance of life

789

history traits despite high frequency of recent character changes. Systematic Biology 58,

790

509–526. doi:10.1093/sysbio/syp044

ly

On

787

791

Maronna, M. M., Miranda, T. P., Peña Cantero, Á. L., Barbeitos, M. S., Marques, A. C.

792

(2016). Towards a phylogenetic classification of Leptothecata (Cnidaria, Hydrozoa).

793

Scientific Reports 6, 18075. doi:10.1038/srep18075

794

Medel Soteras, M. D., García, F. J., García-Gómez, J. C. (1991). La familia Sertulariidae

795

(Cnidaria: Hydrozoa) en el Estrecho de Gibraltar y la peninsula iberica: Aspectos

796

taxonómicos y zoogeográficos. Cahiers de Biologie marine 32, 503–543.

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

797 798

Page 38 of 77

Millard, N. A. H. (1975). Monograph on the Hydroida of southern Africa. Annals of The South African Museum 68, 1–513.

799

Moura, C. J., Cunha, M. R., Porteiro, F. M., Rogers, A. D. (2011). The use of the DNA

800

barcode gene 16S mRNA for the clarification of taxonomic problems within the family

801

Sertulariidae

802

doi:10.1111/j.1463-6409.2011.00489.x

(Cnidaria,

Hydrozoa).

Zoologica

Scripta

40,

520–537.

Moura, C. J., Harris, D. J., Cunha, M. R., Rogers, A. D. (2008). DNA barcoding reveals

804

cryptic diversity in marine hydroids (Cnidaria, Hydrozoa) from coastal and deep-sea

805

environments. Zoologica Scripta 37, 93–108. doi:10.1111/j.1463-6409.2007.00312.x

809

812 813 814 815 816 817

taxonomy. Frontiers in Zoology 7, 1–14. doi:10.1186/1742-9994-7-16 Park, J. H. (1990). Systematic study on the marine hydroids (Cnidaria, Hydrozoa) in Korea I. The Korean Journal of Systematic Zoology 6, 71–86.

ly

811

Padial, J. M, Miralles, A., De la Riva, I., Vences, M. (2010). The integrative future of

On

810

United States National Museum 4, 1–151.

iew

808

Nutting, C. C. (1904). American hydroids. Part II. The Sertularidae. Proceedings of the

ev

807

rR

806

Fo

803

Park, J. H. (1992). Zoogeographical distribution of marine hydroids (Cnidaria: Hydrozoa: Hydroida) in Korea. The Korean Journal of Systematic Zoology 8, 279–299. Park J. H. (1995). Hydroids (Cnidaria: Hydrozoa: Hydroida) from Chindo Island, Korea. The Korean Journal of Systematic Zoology 11, 9–17. Park, J. H. (1998). Three new records of Thecate hydroids from Korean Waters. The Korean Journal of Systematic Zoology 14, 59–66.

http://www.publish.csiro.au/journals/is

Page 39 of 77

Invertebrate Systematics

818

Park, J. H. (2010). ´Invertebrate Fauna of Korea, Volume 4, Number 1, Thecates (Cnidaria:

819

Hydrozoa: Thecatae).´ (National Institute of Biological Resources: Incheon, Korea.)

820

Park, J. H, and Rho B. J. (1986). A systematic study on the marine hydroids in Korea. 9. The

821

Family Sertulariidae. The Korean Journal of Systematic Zoology Special Issue 1, 1–52.

822

Peña Cantero, Á. L., Sentandreu, V., Latorre, A. (2010). Phylogenetic relationships of the

823

endemic Antarctic benthic hydroids (Cnidaria, Hydrozoa): what does the mitochondrial

824

16S rRNA tell us about it? Polar Biology 33, 41–57. doi:10.1007/s00300-009-0683-5

Fo

Peña Cantero, Á. L., and Vervoort, W. (2003). Species of Staurotheca Allman, 1888

826

(Cnidaria: Hydrozoa: Sertulariidae) from US Antarctic expeditions, with the description

827

of

828

doi:10.1080/00222930210155701

species.

Journal

of

Natural

History

37,

2653–2722.

iew

830

new

ev

829

three

rR

825

Rho, B. J. (1977). ´Illustrated flora and fauna of Korea. 20. Porifera, Hydrozoa and Ascidiacea.´ (Ministry of Education: Seoul, Korea.)

On

Rho, B. J., and Chang, S. R. (1974). On the classification and the distribution of the marine

832

benthic animals in Korea. I. Hydroids. The Journal of Korean Research Institute for

833

Better Living 12, 133–158.

834 835 836

ly

831

Schuchert, P. (2001). Hydroids of Greenland and Iceland (Cnidaria, Hydrozoa). Meddelelser om Grønland, Bioscience 53, 1–184. Schuchert, P. (2015). ´Sertulariidae Lamouroux, 1812.´ In ´World Hydrozoa database.´(Ed P.

837

Schuchert). Available at

838

http://www.marinespecies.org/aphia.php?p=taxdetails&id=1614

839

Sheth, B. P., and Thaker, V. S. (2017). DNA barcoding and traditional taxonomy: an

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

840

integrated

841

doi:10.1139/gen-2015-0167

approach

for

biodiversity

Page 40 of 77

conservation.

Genome

60,

618-628.

842

Shimabukuro, V., and Marques, A. C. (2006). Morphometrical analysis, histology, and

843

taxonomy of Thyroscyphus ramosus (Cnidaria, Hydrozoa) from the coast of Brazil.

844

Zootaxa 1184, 29–42. Song, X. (2016). ´Diversity and evolution of Sertulariidae Larmouroux, 1812 (Cnidaria:

846

Hydrozoa) in China, with records from Chinese Arctic and Antarctic National Research

847

Expeditions´. PhD thesis. (University of Chinese Academy of Sciences & Institute of

848

Oceanology, Chinese Academy of Sciences: China.)

rR

Fo

845

Song, X., Gravili, C., Wang, J., Deng, Y., Wang, Y., Fang, L., Lin, H., Wang, S., Zheng, Y.,

850

Lin, J. (2016a). A new deep-sea hydroid (Cnidaria: Hydrozoa) from the Bering Sea

851

Basin reveals high genetic relevance to Arctic and adjacent shallow-water species.

852

Polar Biology 39, 461–471. doi:10.1007/s00300-015-1793-x

iew

ev

849

On

Song, X., Xiao, Z., Gravili, C., Ruthensteiner, B., Mackenzie, M., Wang, S., Chen, J., Yu, N.,

854

Wang, J. (2016b). Worldwide revision of the genus Fraseroscyphus Boero and

855

Bouillon, 1993 (Cnidaria: Hydrozoa): an integrative approach to establish new generic

856

diagnoses. Zootaxa 4168, 1–37. doi:10.11646/zootaxa.4168.1.1

857 858 859 860 861

ly

853

Stearns, R. E. C. (1908). Dr. John B. Trask, a pioneer of science on the West Coast. Science (New Series) 28, 240–243. Stechow, E. (1913a). Neue Genera thecater Hydroiden aus der Familie der Lafoeiden und neue Species von Thecaten aus Japan. Zoologischer Anzeiger 43, 137–144. Stechow, E. (1913b). Hydroidpolypen der japanischen Ostküste. II. Teil: Campanularidae,

http://www.publish.csiro.au/journals/is

Page 41 of 77

Invertebrate Systematics

862

Halecidae, Lafoeidae, Campanulinidae und Sertularidae, nebst Ergänzungen zu den

863

Athecata und Plumularidae. In ´Beiträge zur Naturgeschichte Ostasiens. Abhandlungen

864

der Königlich Bayerischen Akademie der Wissenschaften´. Supplementband zu den

865

Abhandlungen der Mathematisch-naturwissenschaftlichen Klasse, 3, (Ed F. Doflein.)

866

pp. 1–162. (Verlag der Königlichen Bayerischen Akademie der Wissenschaften,

867

München.) Stechow, E. (1920). Neue Ergebnisse auf dem Gebiete der Hydroidenforschung.

869

Sitzungsberichte der Gesellschaft für Morphologie und Physiologie, München 31, 1–30.

870

Stechow, E. (1923a). Neue hydroiden der Deutschen Tiefsee Expedition, nebst

874

anderer Gebiete. II. Teil. Zoologische Jahrbücher für Systematik 47, 29–270. Stechow, E. (1923c). Die Hydroidenfauna der Japanischen Region. Journal of the College of

On

875

Stechow, E. (1923b). Zur Kenntnis der hydroidenfauna des Mittelmeeres, Amerikas und

iew

873

Bemerkungen über einige andere Formen. Zoologischer Anzeiger 56, 1–20.

ev

872

rR

871

Fo

868

Science, Imperial University of Tokyo 44, 1–23.

Stechow, E. (1925). Hydroiden der deutschen Tiefsee-Expedition. In ´Wissenschaftliche

877

Ergebnisse der Deutschen Tiefsee-Expedition "Valdivia"´. 27, (Eds C. Chun, A. Brauer,

878

E. Vanhöffen, C. Apstein.) pp. 383–546. (Gustav Fischer Verlag, Jena.)

879 880

ly

876

Torrey, H. B. (1902). The Hydroida of the Pacific Coast of North America. University of California Publications, Zoology 1, 1–104.

881

Torrey, H. B. (1904). Contributions from the laboratory of the Marine Biological

882

Association of San Diego. I. The hydroids of the San Diego region. University of

883

California Publications, Zoology 2, 1–43.

http://www.publish.csiro.au/journals/is

Invertebrate Systematics

Page 42 of 77

884

Trask, J. B. (1857). On nine new species of zoophytes from the Bay of San Francisco and

885

adjacent localities. Proceedings of the California Academy of Natural Sciences 1,

886

112–115.

887 888 889 890

Vervoort, W., and Watson, J. E. (2003). The marine fauna of New Zealand: Leptothecata (Cnidaria: Hydrozoa) (thecate hydroids). NIWA Biodiversity Memoir 119, 1–538. Yamada, M. (1959). Hydroid fauna of Japanese and its adjacent waters. Publications from the Akkeshi Marine Biological Station 9, 1–101.

Fo

Yeates, D. K., Seago, A., Nelson, L., Cameron, S. L., Joseph, L., Trueman, J. W. H. (2011).

892

Integrative taxonomy, or iterative taxonomy? Systematic Entomology 36, 209–217.

893

doi:10.1111/j.1365-3113.2010.00558.x

iew

ev

894

rR

891

ly

On http://www.publish.csiro.au/journals/is

Page 43 of 77

Invertebrate Systematics

895 896 897

Table 1. New primers for the 18S and 28S rRNA genes designed in the present study The primers succeeded in several tested Leptothecata (Sertulariidae and Campanulariidae) and Anthoathecata (Tubulariidae) species collected 3–7 years ago, fixed in 70%-100% ethanol. Marker

Sequence of primer (5´-3´)

Fragment length

Annealing temperature

18S1

F: GCTGTATGTACTGTGAAACTGCG

~ 530 bp

40-45 ºC

~ 760 bp

45 ºC

~ 870 bp

40-45 ºC

~ 760 bp

45 ºC

~ 970 bp

45 ºC

~ 640 bp

40-45 ºC

~ 550 bp

40-45 ºC

~ 570 bp

45 ºC

~ 850 bp

40-45 ºC

R: GGAATTACCGCGGCTGCTGGCACC 18S2

F: GTTCGATTCCGGAGAGGGAGCCT

18S3

F: ACTGCGAAAGCATTTGCCAAGAGT

R: GTTTCGGCCTTGCGACTATACTT

R: CACCTACGGAAACCTTGTTACGAC 28S1

F: ACAAGGATTCCCTGAGTAACG R: AGACTCCTTGGTCCGTGTTTCAAGAC

28S2

F: CAAGTACCGTGAGGGAAAGAT

28S3

F: TCTAGTAGCTGGTTCCCTCCGAAG

Fo

R: CCGCATCGCCAGTTCTGCTTAC

R: GGAATGTTAACCCGATGCCCTTTCG F: AGTGCAGATCTTGGTGGTAGTAG

rR

28S4

R: AGAGCCAATCCTTTTCCCGAAGTT F: CGTACTCATAACCGCAGCAGGTCT

28S6

F: AAGGTAGCCAAATGCCTCGTCATCT

ev

28S5

R: CAGACTAGAGTCAAGCTCAACAGG

898

iew

R: GGATTCTGACTTAGAGGCGTTCAG

ly

On http://www.publish.csiro.au/journals/is

Invertebrate Systematics

899 900 901

Page 44 of 77

Table 2. Genetic pairwise Kimura 2-Parameter distances for partial sequences of the 16S rRNA gene (589 bp) of Xingyurella Three haplotype replicates of MF135580 were obtained in the single hydroid fragment of MBM280254 Species

Specimens

Sequences

FJ550462

-580

X. turgida

MHNG-INVE-29467

FJ550462

/

X. xingyuarum

MBM280254,

MF135580

0.006

/

-581

-582

-516

-517

-518

MBM280232 MBM280254

MF135581

0.017

0.002

/

X. xingyuarum

MBM280254

MF135582

0.014

0.002

0.003

/

X. xingyuarum

MBM280254

MF491516

0.017

0.002

0.003

0.003

/

X. xingyuarum

MBM280111

MF491517

0.017

0.002

0.003

0.003

0.003

/

X. xingyuarum

MBM280232

MF491518

0.017

0.002

0.003

0.003

0.003

0.003

iew

ev

rR

Fo

902

X. xingyuarum

ly

On http://www.publish.csiro.au/journals/is

/

Page 45 of 77

Invertebrate Systematics

903 904

Table 3. Genetic pairwise Kimura 2-Parameter distances for partial sequences of the 18S (1707 bp) and 28S (3273 bp) rRNA genes of Xingyurella Marker

Species

Specimens

MHNG-INVE-29467

18S

X. turgida

MHNG-INVE-29467

/

MBM280254

18S

X. xingyuarum

MBM280254

0.053

/

18S

X. xingyuarum

MBM280259

0.052

0.001

28S

X. turgida

MHNG-INVE-29467

/

28S

X. xingyuarum

MBM280259

0.09

905

iew

ev

rR

Fo ly

On http://www.publish.csiro.au/journals/is

MBM280259

/

Invertebrate Systematics

906 907

Page 46 of 77

Table 4. Measurements of the species of the genus Xingyurella *Gonothecal spines were not included for measurements Internode

Hydrothecal abcauline

Gonotheca (mm)

Nematocyte capsule

(mm)

length, aperture width (mm)

height, width*

length, width (µm)

X. gotoi

0.7–0.9

0.47–0.51, 0.12–0.16

1.2–1.5, 0.7–0.8



X. pedrensis

0.6–0.8

0.61–0.86, 0.22–0.24





X. turgida

0.3–0.6

0.56–0.64, 0.24–0.27

1.5–2.2, 0.9–1.1



X. xingyuarum

1.0–3.1

0.63–0.67, 0.20–0.33

1.3–1.6, 0.7–0.8

5.5–6.5, 1.4–1.8

Species

908

iew

ev

rR

Fo ly

On http://www.publish.csiro.au/journals/is

Page 47 of 77

Invertebrate Systematics

909 910 911 912 913 914 915 916 917 918

Table 5. Comparative characters for the genus Xingyurella and doubtful species References: 1, Stechow (1913a, 1913b); this study; 2, Torrey (1902, 1904); this study; 3, Trask (1857); this study; 4, as Diphasia sp., Inabai (1890); 5, as Symplectoscyphus turgidus, Hirohito (1983, 1995) and Park (1998); 6, this study; 7, Calkins (1899). * The pedicle of the basal internode of hydrocladium, present in X. turgida, is part of the hydrocladium. It is similar as but different from the axillary apophysis in some Symplectoscyphus species which belongs to one of the two extended processes of the hydrocaulus. ** The samples examined by Hirohito (1983, 1995) may consist of several species (see the Systematics).

Species

Xingyurella

Xingyurella

Xingyurella

Xingyurella

Xingyurella

Sertularella

gotoi

pedrensis

turgida

? turgida

? turgida

xingyuarum

nodulosa

References

1

2

3

4

5

6

7

Colony

Slender

Erect, stout

Erect, stout

Erect, stout

Erect, stout

Slender

Slender

Frequently

Rarely

Rarely

Rarely

Rarely

Frequently branched;

Slightly,

branched

branched

branched

branched

branched

spirally, repeatedly,

irregularly

dichotomously branched

branched

?

No

No

Branching pattern - hydrocaulus

- hydrocladium with

rR

Fo

Xingyurella

No

Yes

- axillary apophysis

No

No

- axillary hydrotheca

Yes

Yes

- turgid

No

No

Yes

- surface

Almost

Slightly

Slight

?

ev

No

a basal pedicle*

?

?

No

No

No

?

?

Yes

Yes

No

No

No

No

Smooth

Smooth

Strong grooves

Almost

throughout

smooth

Hydrotheca

waved

waved

Sparsely

Sparsely

Tightly

Sparsely

Tightly

Sparsely

Tightly

- adnation

1/3

1/3–1/2

1/2

1/2

1/3–1/2

1/8–1/5

1/3–1/2

- tapering towards

Obviously

Slightly

No

Slightly

Slightly

Slightly

Slightly

Slightly

Slightly

Obviously

Slightly

Obviously

Slightly

Slightly

2

0

3

3

3–7

0

?

Throughout

Upper part

Upper part

Upper part

Throughout

Throughout

Upper part

- surface grooves

No

No

Lower part

No

No

No

No

Water depth (m)

600

77–110

2

23 8

+ ,C

J

##' 2 . )

&

! !2U

0

2

- 1

#%'* G #2

* 2

,*

#%

1

2

,

7

- / 2 G 3 7 *,1 3

3

-

)*(

&

** 2

I

2

On

%

?

1 ** 3

2

"('( G

J

iew

* ,53

** 2

** )$)

/

I /,

** )$)

?

3

- ,

'

$C

2

:

-

5 $' * /

,

2

-

*1 'G

*

*, /

DB /* 5

2

3

*, /

G

1

- 8, , 6

1

2 < * /

4

,

2

2

10

" G # 2

http://www.publish.csiro.au/journals/is

26

3 ,

#2

* ,7

-.

3

2

; 5 '

9

,

I,

2 -

,

,*

I,

-*

8

:

2

1

5

5

3 8[

)&

? -

/@ I, /

A2

2

2

2

,)

8

G

Q

G

(

2 HH2 = *J

, * 1

'# 2 = #

2

* / 3

2

$

U2

3. G

A 1*

-

3 =2

5 %(

,

Q 4[

2 K, D

8, ,

'G

-

**123

T

>

E

- Q

3 .

1

2 HH2 = *2

)3 23

8, ,$

T

4

2

,

#

(

, @/

DB /* )3

Z H

1

6

ly

$

*

6

J

On

1

""($

2

8

2

,*

4

* / 3

I *2

.

,*

*

2 H

3

2

? 1 , ,63 !

-

7

=

9*,1,*

8

,*

iew

? -

-

I

2

2 . ,

'

* -

ev

)3 2

*

- 1

rR

2 . ,

' 7

I

2

'

2

3

3

1

/ I, D

G ! 2 )3

## 2 8

1

' '2

72 / 23 $ 2

H *

2

7 *, - 1

3 >2

)3

%

3 )

B

*

Fo

*

-

2# 3

Invertebrate Systematics

=

3

2 2

'# 2

5,

/ 2 H2 = G =

= 5*

2

!

*

2$

43

2

! < 7

-

* 5 /

/

-

8

* /

26

*

-

$

#

#

2

43 C2 *

- 1

Page 74 of 77

2Q

2

' !2 .

$" G 3 >23 I

)

>

-I

- 1

(

%

. ) K *

-

A

T G

" 2 $

2 ,

2 3 C2 2

## 2 =

1

- ,

2 %'