Isolation and Characterization of a Novel Chlorpyrifos ... - Springer Link

Interdiscip Sci Comput Life Sci (2015) 7: 1–6 DOI: 10.1007/s12539-012-0207-9

Isolation and Characterization of a Novel Chlorpyrifos Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing Amareshwari P1 , Mayuri Bhatia2 , Venkatesh K1 , Roja Rani A1 , Srinivas Bandaru3 , Mukesh Yadav2 , Anuraj Nayarisseri2∗, 1

Ravi G.V.2 , Priyanka Bhakt2 , Achuthsankar S. Nair4

(University College of Sciences, Dept of Genetics, Osmania University, Hyderabad- 500007, India) 2 (In silico Research Laboratory, Eminent Biosciences, Indore – 452 010, India) 3 (Institute of Genetics and Hospital for Genetic Diseases, Osmania University, Begumpet, Hyderabad – 500 016, India) 4 (Department of Computational Biology & Bioinformatics, North Campus, Kariavattom, University of Kerala, Thiruvananthapuram, Kerala – 695 581, India)

Received 1 November 2012 / Revised 21 January 2013 / Accepted 11 February 2013

Abstract: Indiscriminate application of pesticides like chlorpyrifos, diazinon, or malathion contaminate the soil in addition has being unsafe often it has raised severe health concerns. Conversely, microorganisms like Trichoderma, Aspergillus and Bacteria like Rhizobium Bacillus, Azotobacter, Flavobacterium etc have evolved that are endowed with degradation of pesticides aforementioned to non-toxic products. The current study pitches into identification of a novel species of Flavobacterium bacteria capable to degrade the Organophosphorous pesticides. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rDNA sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel specie of Flavobacterium later named as EMBS0145, the sequence of which was deposited in in GenBank with accession number JN794045. Key words: 16S rRNA gene sequencing, flavobacterium species EMBS0145, chlorpyrifos degrading bacteria.

1 Introduction The growing biodiversity has emerged into a number of pesticide resistant pests, leading to implementation either of highly concentrated or eco-unfriendly organic chemicals. These organic chemicals in the form of pesticides accumulate in the soil and are undoubtedly hazardous for human health. Some of these organic chemicals being extensively documented lately are Chlorpyrifos, Disulfoton, Diazinon and Malathion; the organophosphorus pesticides that have been banned by US and a few European countries, however in developing countries like India, the use is still prevalent which arise major health and environment concerns. Being highly resistant, various studies have been conducted for the biological degradation and removal of these synthetic chemicals from the soil. Present study focuses mainly on the degradation of organophosphorus, Chlorpyrifos. The molecule is chemically represented as [O, O-diethyl O-(3, 5, 6-trichloro-2- pyridyl)] [1]. It is a powerful pesticide that kills fungi, nema∗

Corresponding author. E-mail: [email protected]

todes and worms with potential to accumulate in food chain and also the drinking water that may lead to serious consequences. The P – O – C linkage present readily infringes the food chain, adding to the list of sufferers. The biotic and abiotic components can help in biological deterioration of these chemicals, while abiotic components cannot be monitored but biotic components may be introduced for enhanced activity. These biotic components comprise of microorganisms, for example Pseudomonas, Flavobacterium, Alcaligenes, Rhadococcus, Gliocladium, Trichoderma and Penicillium etc. They are co-metabolically capable of utilization of the organophosphorus for fulfilling their energy requirements, ultimately leading to our whole sole purpose of degradation. Earlier the reports have been filed in this respect where another novel species, Flavobacterium sp. EMBS0145 was found to be remarkably effective [2]. Also, Flavobacterium and Spingomonas paucimobil species have been reported to degrade pesticides in 48 hours of fermentation process [3]. Thus the investigation centers to identify and characterize another novel Flavobacterium species by 16S rRNA sequencing for biological removal of Chlorpyrifos.

2

Interdiscip Sci Comput Life Sci (2015) 7: 1–6

2 Methodology 2.1

Collection of soil sample and procurement of pesticide

2.4

Estimation of Minimum inhibitory concentration (MIC)

The chlorpyrifos-degrading bacterium was isolated from a soil sample, which was collected from agricultural soil highly contaminated with organophosphorous pesticides from Guntur district (16.3008◦N 80.4428◦E), Andhra Pradesh, India. The land was investigated and was found to be supplied with pesticide containing chlorpyrifos. The soil samples were collected in sealed plastic bags in triplicates and were transferred to 4℃ within an hour [4]. Further, the commercial – grade chlorpyrifos was procured from local vendor in Guntur district of Andhra Pradesh, India.

The bacterial culture grown on LB broth was then subjected to MIC where viable cell count was checked at regular intervals. For MIC, 10% of bacterial culture was inoculated into each LB broth flask containing 100, 150, 200, 250 and 300 mg/L and was kept for incubation on shaker at 150 rpm and 37℃. 1 mL samples were taken from the incubated broth at different intervals for viable cell count at 0 hr, 2 hr, 6 hr, 12 hr, 16 hr and 24 hr. The sample in LB broth without chlorpyrifos was regarded as control. The test samples incubated were compared to this control. The viable cell count was taken using cell counter as Colony forming units/mL (CFU/mL) [7].

2.2

2.5

Media preparation

The media used for isolation contained the chemical compound which had to be degraded. For the revival of microbial diversity in the soil, nutrient broth was initially used and it was replaced by mineral salt medium later. Nutrient Broth contained (g/L): peptic digest of animal tissue 5 g, beef extract 1.5 g, yeast extract 1.5 g, sodium chloride 5 g, agar 15 g [1, 5, 6]. Mineral Salt medium comprised of (g/L): KH2 PO4 -4.8 g; K2 HPO4 -1.2 g; NH4 NO3 -1.0 g; MgSO4 .7H2 O-0.2 g; Ca (NO3 )2 .4H2 O-0.04 g; and Fe (SO4 )3 -0.001 g with pH adjusted to 7.0 [1, 5, 6]. Luria-Bertani (LB) broth (containing g/L): tryptone-10, sodium chloride-10 and yeast extract-5 with pH adjusted in the range of 7.0-7.2 [2]. The analytical grade chemicals and reagents used in this work were purchased from Hi-media (©HiMedia Laboratories.). 2.3

Isolation of a chlorpyrifos-degrading bacterium

Initially the microbial cultures present in the soil sample were isolated using nutrient broth. 2g of soil was inoculated into 100 mL of medium. The revived cultures were then subjected to enrichment medium. The enrichment medium comprised of MSM and LB broth supplemented with commercial – grade chlorpyrifos as 90 mg/L as sole carbon source. 250 mL flasks containing 100 mL of MSM were inoculated with 1% of revived NB cultures. The experiment was set up in triplicates and the inoculated sample flasks were kept for incubation at 37℃ for 48 hours in shaker at 150 rpm [2]. The grown culture was transferred to MSM agar plates to obtain pure colonies out of the mixed culture. The pure culture was done three times of the enrichment agar and the isolated colonies with chlorpyrifos resistance were subcultured on to LB broth for further characterization at same physical conditions.

Amplification of 16 s rRNA gene

The genomic DNA was isolated by phenol-chloroform method. The purified DNA later was subjected to 16S rRNA sequencing. The purified genomic DNA obtained was amplified using Universal 16S rRNA Primers: Forward Primer: 5’ AGAGTTTGATCCTGGCTCAG 3’ Reverse Primer: 5’ GGTTACCTTGTTACGACTT 3’, The standard PCR master mix contained: Reagents

Volume for 1 reaction (µL)

Water

26.5

10X buffer

(1X)5

10 mM DNTP Mix

(0.5 mM) 2.5

20 mM Forward Primer

(2 mM) 5

20 mM Reverse Primer

(2 mM) 5

Taq Polymerase

(3 Units)1

DNA sample

5 (100 ng/µL)

Total Reaction Volume

50 µL

The gradient thermal cycler was used with conditions as used in our previous study [2]. Initial denaturation step was conducted at 94℃ for 5 minutes followed by 30 cycles of denaturation at 94℃, annealing step at 52℃ and extension step of 72℃ for 1 minute. Lastly extension step was set at 72℃ for 7 minutes. The amplified product was run on agarose gel to check purity and integrity. The amplified product was then purified using 5 µL of 3M sodium acetate solution (pH=4.6) and 100 µL of absolute ethanol. The product was mixed and left for 40 min incubation at 20℃ for precipitation. The precipitate was collected by centrifugation at 10 000 rpm for 5 min and then washed


3

with 300 µL of 70% ethanol by centrifugation. The pellet was dried and stored in 10 µL of Milli Q water [9] [10].

3 Results and discussion 3.1

Minimum inhibitory concentration

The results of MIC have been portrayed in the graphical form, where it can be seen that control gave best growth results for bacterial culture but on addition of pesticide, the bacterial culture has not much deviated. In all the cases, adaptation phase or lag phase continued till 5 hours followed by log phase upto 14-16 hr and stationary phase upto 24 hrs. Though a significant deviation is seen in highest concentration i.e. at 300 ppm gave 100×107 CFU/mL viable cell counts, while it was 230 X107 CFU/mL in control. The experiment basically signifies both the efficient utilization of chlorpyrifos and suppression by chlorpyrifos. Thus, a higher concentration of the chemical suppressed the optimum conditions for hydrolases enzyme responsible for chlorpyrifos utilization. Viable cell count×107 CFU/mL

300

3.2

Control 100 150 200 250 300

250 200 150 100 50 0

Fig. 1

Minimum inhibitory concentration

0

5

10

15 20 Time (hours)

25

30

Determination of Minimum inhibitory concentration of Chlorpyrifos on bacterial species.

16s rRNA gene sequencing

The sequencing of PCR product was carried out on ABI Prism sequencer (© 2013 Life Technologies). ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems Inc., USA) was used for carrying out sequencing reactions. The sequence of novel isolate was deposited in GenBank with accession number JN794045 [11]. 3.3

Sequence anlaysis of 16S rRNA gene

The sequence obtained from the sequencing was analyzed using various bioinformatics tools. Sequence similarity searching was performed using BLASTn with a cut of e-value 0.0 against NCBI nr-nucleotide database [11] [12]. All the homolougus sequence were downloaded batch wise and multiple sequence alignment

was performed using Multiple Sequence alignment tool MEGA 5.2 [13] [14] [15]. Phylogenetic tree was constructed from 16S rRNA gene sequences of members of genus Flavobacterium by different algorithms: neighbour-joining, 13 maximum parsimony tree [16], maximum-likelihood [17] and UPGMA method [18] using MEGA5. [19]. In the neighbor joining tree, the sequences form a distinct lineage, with Chlorpyrifos degrading Flavobacterium species as the closest relatives. Phylogenetic construction of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium is shown in Fig. 2. The sequence dataset Flavobacterium EMBS0145 consisted of 1417 bp (100%) is parsimony informative. The matrix was competently and manually aligned. Coding gaps as binary characters, missing data had no affect on the topology and had affect on branch support. 3.4

Phylogenetic analysis and elucidation of rRNA secondary structure

In order to understand the significance in predicting the stability of chemical or biological molecules or entities of Flavobacterium EMBS0145; RNA secondary structure prediction has been performed [17] [18] [19]. The 16S RNA gene sequence obtained was used to deduce the secondary structure of RNA using UNAFOLD [20] on Linux Platform. The secondary structure showed helical regions which bind with proteins S1eS27, hairpin loops, bulge loops, interior loops and multi-branched loops that may bind to 23S rRNA in the larger subunit of the ribosome. The free energy of the secondary structure of rRNA was ΔG − 293.30 kcal/mol elucidated using UNAFOLD (Fig. 3). UNAFOLD results were obtained from .ct file and .reg file. Folding bases 1 to 1417 bp of Flavobacterium EMBS0145 at 37℃ shows the Gibb’s free energy, ΔG = −293.30 kcal/mol. The thermodynamics result from each base wise of the dataset shows the average of External closing pair Helix ΔG −8.80, Stack ΔG −2.50, Multi-loop ΔG −3.30, Bulge loop ΔG 0.50, Hairpin loop ΔG −4.20, Closing pair and Interior loop of ΔG −2.10 kcal/mol respectively. All rRNAs appear to be identical in function, because all are involved in the synthesis of proteins. The overall three dimensional rRNA structure that corresponds to this function shows only minor-but highly significant-variation. However, within this nearly constant overall structure, molecular sequences in most regions of the molecule are continually evolving and undergoing change at the level of its primary structure while maintaining homologous secondary and tertiary structure, which never alters molecular function.

4

Fig. 2


Phylogenetic affiliation of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium.

4 Conclusion The described results of phylogenetic distinctiveness and phenotypic disparities indicate that the strain iden-

tified was novel within Flavobacterium species, for which the name Flavobacterium EMBS0145 was proposed. The sequence obtained was deposited in GenBank database with Accession Number: JN794045.


Fig. 3

5

RNA secondary structure of Flavobacterium EMBS0145 elucidated by UNAFOLD.

References [1] Biodegradation of Chlorpyrifos by Enterobacter Strain B-14 and Its Use in Bioremediation of Contaminated Soils (ref 2). [2] Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing (2012-0068). [3] Karpouzas, D.G., Fotopoulou, A., MenkissogluSpiroudi, U., & Singh, B.K. 2005. Non-speci¯c biodegradation of the organophosphorus pesticides, cadusafos and ethoprophos, by two bacterial isolates. FEMS microbiology ecology, 53(3), 369-378. [4] Isolation and characterization of a chlorpyrifosdegrading bacterium from agricultural soil and its growth response (ref 1). [5] Karpouzas, D. G., J. A. W. Morgan, and A. Walker. 2000. Isolation and characterisation of ethoprophosdegrading bacteria. FEMS Microbiol. Ecol. 33: 209218.

[6] Karpouzas, D. G., and A. Walker. 2000. Factors influencing the ability of Pseudomonas putida strains epI and II to degrade the organophosphate ethoprophos. J. Appl. Microbiol. 89: 40-48. [7] Cullington, J. E., and A. Walker. 1999. Rapid biodegradation of diuron and other phenylurea herbicides by a soil bacterium. Soil Biol. Biochem. 31: 677-686. [8] Shetty, R.P., Endy, D., & Knight Jr, T.F. 2008. Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering, 2(1), 1-12. [9] Shah, K.P., Chandok, K.H., Rathore, P., Sharma, M.V., Yadav, M., & Anuraj Nayarisseri 2013. Screening, Isolation and Identification of Polygalacturonase Producing Bacillus tequilensis Strain EMBS083 Using 16S rRNA Gene Sequencing. European Journal of Biological Sciences, 5(1), 09-13. [10] Anuraj Nayarisseri. Sabnani M.K., Mukesh Yadav, Jyotsana, K., Deepika, S., and Rachna, C. 2012. Identification And Characterization of Proteases and

6

Interdiscip Sci Comput Life Sci (2015) 7: 1–6 Amylases Producing Bacillus licheniformis Strain EMBS026 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 231-235.

[11] Nandini Phanse, Pragya Rathore, Bhavesh Patel, Anuraj Nayarisseri. (2013). Characterization of an industrially important alkalophilic bacterium, Bacillus agaradhaerens strain nandiniphanse5. Journal of Pharmacy Research. 6(5), 543-550. [12] Shah, K. P., Chandok, K. H., Rathore, P., Sharma, M. V., Yadav, M., & Anuraj Nayarisseri (2013). Screening, Isolation and Identification of Polygalacturonase Producing Bacillus tequilensis Strain EMBS083 Using 16S rRNA Gene Sequencing. European Journal of Biological Sciences, 5(1), 09-13. [13] Acharya Nagarjun Pyde, P. Nagaraja Rao, Aditya Jain, Divya Soni, Shailesh Saket, Sheaza Ahmed, Sugunakar Vuree, Anuraj Nayarisseri.(2013). Identification and characterization of foodborne pathogen Listeria monocytogenes strain Pyde1 and Pyde2 using 16S rRNA gene sequencing. Journal of Pharmacy Research. 6(7), 736-741. [14] Anuraj Nayarisseri. Sabnani M.K. Mukesh Yadav, Jyotsana K. Deepika S and Rachna C. (2012) Identification And Characterization of Proteases and Amylases Producing Bacillus licheniformis Strain EMBS026 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 231-235.

[15] Anuraj N.S, Sheaza Ahmed, Mukesh Yadav, Sneha Singh, Meer Asif A, Mayura Maynal and Urvashi Pisal. (2012). Identification And Characterization of Neutral Protease Producing Paenibacillus Polymyxa Species EMBS024 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 236-239. [16] Tamura, K., Dudley, J., Nei, M., & Kumar, S. (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular biology and evolution, 24(8), 1596-1599. [17] Zuker, Michael, David H. Mathews, and Douglas H. Turner. “Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide.” RNA biochemistry and biotechnology. Springer Netherlands, 1999. 11-43. [18] Mathews, D. H., Sabina, J., Zuker, M., & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology, 288(5), 911-940. [19] SantaLucia, J., & Turner, D. H. (1997). Measuring the thermodynamics of RNA secondary structure formation. Biopolymers, 44(3), 309-319. [20] Markham, Nicholas R., and Michael Zuker. “UNAFold.” Bioinformatics. Humana Press, 2008. 3-31.