May 11, 1996 - 3Department of Medical Biology, University of Indonesia, Salema 6, Jakarta 10430, Indonesia. 4Department of Pedurtric Health, University of ...
HUMAN MUTATION Supplement 1:S271-S274 (1998)
MUTATION IN BRIEF
Leber's Hereditary Optic Two Families With the m 14484T>C Mutations
ropathy in Indonesia:
11778G>A and
Herawati Sud~yo,"~ Mulia Sitepu,*Safarina Malik,' Hardiono D. Poesponegoro? and Sangkot Mar&'* 'Eijkman Institute for Molecular Biology, Jakarta 10430, Indonesia 'Department of Ophthalmology, A m Jaya University, Jakarta 14450, Indonesia 3Department of Medical Biology, University of Indonesia, Salema 6, Jakarta 10430, Indonesia 4Department of Pedurtric Health, University of Indonesia, Salem 6, Jakarta 10430, Indonesia Communicated by R.G.H. Cotton
We report two Indonesian families with Leber's hereditary optic neuropathy (LHON), a maternally inhgrited degenerative disorder characterized by an acute or subacute optic nerve degeneration resulting in late-onset bilateral visual failure (Carrol and Mastaglia, 1979; Riordan-Eva et al., 1995).The first family is of Chinese ethnic origin, from the Jambi province in the island of Sumatera. The other family is from Subang in the province of West Java and is of Sundanese (related to the Malay) ethnic origin. Very little study has been carried out on disease-related mtDNA mutations in non-Japanese Asian populations, and to our knowledge there has been no cases of LHON reported from Southeast Asia. The pedigrees constructed for the two families are shown in Figure 1A (Jambi family) and Figure 1B (West Java family). Signs of optic neuropathy typical of LHON were detected in 13 of the total 124 members of the Jami family examined, and in 10 of 70 of the West Java family members. These signs included partial or total papil atrophy with decreased acuity and scotoma. There is no recovery of the eyesight reported in either family. Furthermore, no other neurological abnormalities were detected in any of the members examined. In both cases, a clear maternal mode of inheritance was observed. Since around one-half of the LHON families reported in the literature are associated with the mtDNA 11778G>A base substitution,the probands (A in Fig. 1) were first examined for this mutation. The 11778G>A mutation was found in the mtDNA of the proband of the Jambi family (Fig. lA, bottom) but was not present in the West Java mtDNA. As expected, all members of the Jambi family from the maternal line of inheritance were found to carry the 11778G>A mtDNA mutation, when subsequently 01998 WILEY-LISS, INC.
examined (Fig. 1A). The degree of the mtDNA heteroplasmicity varied fom 90% to practically homoplasmic for the mutated species. The mtDNA of selected members of both families was also examined for other mutations reported to be associated with LHON: 3394T>C (Johns et al., 1992),3460C>A (Huoponenet al., 1991;Howell et al., 1991), 4136A>G (Howell et al., 1991), and 4216T>C (Johns and Berman, 1991) mutations in the NDI gene, the 4917A>G (Johns and Berman, 1991), and 5244G>A mutations in the ND2 gene (Brown et al., 1992), the 7444G>A mutation in the COI gene (Brown et al., 1992), the 13708G>A mutation in theND5 gene (Brown et al., 1992;Johns and Berman, 1991; Johns and Neufeld, 1991), the 14484T>Cmutation in the ND6 gene (Johns et al., 1992), and the 15257G>A (Brown et al., 1992) and 15812G>A (Brown et al., 1992;Johns and Neufeld, 1991) mutations in the Cytb gene. Published detection procedures were employed, except for the 14484T>C mutation, for which a PCR-RFLP procedure has been devised (Fig. 1B). The West Java family was found to carry the 14484T>C mutation (Fig. IB, bottom), which led to a 64Met>Val amino acid replacement in the ND6 subunit of respiratory complex I. The degree of mtDNA heteroplasmicity in the various family members varied between 19% and 69% for the mutated species. This mutation was not found in the Jambi family, and neither family was Received 11 May 1996;accepted 14 October 1996. *Correspondence to: Prof. Sangkot Marzuki, Eijkma Institute for Molecular Biology,JI. Diponegoro69,Jakarta 10430,Indonesia;Fax:
(62-21) 3147982. Contract grant sponsor: PT Krakatau Steel; Contract grant sponsor: PT Inti Contract grant sponsor: National Development Planning Agency of the Republic of Indonesia.
ZP6 1 LH
1 A
II
111 Al
LEBER'S HEREDITARY OPTIC NEUROPATHY IN INDONESIA
S273
I
I H14701
/
V
5'CAGGAT. . .GAC=A
5' CAGGAT . . . G A C ~ A 3' GTCCTA , ,, . CTGCACGTAGTAAGG
3' GTCCTA
0
i
i a b c
0
d
FIGURE1. LHON Families from (A) Jambi-Sumatera with the
ll778G>A and (B) Subang-West Java with the 14484T>C mtDNA mutations. Top: Pedigrees showing the following members of the families: 0IW, male; 0 0 0 ,female; W 0, affected; I0,asymptomatic but carry the 11778G>A (A) or the 14484TzC (B) mtDNA mutation; 00, asymptomatic no 11778G>A or 14484T>C mutation; deceased; A , proband. Bottom: Detection of the mtDNA mutations by PCR-induced RFLI? Blood (5ml) and hair root samples were kept at 4°C for about 24 hr before being transported to Jakarta. Immediately upon arrival, buffy coat and platelet fractions were prepared according to standard procedures (Sudoyo et al., 1992). DNA samples were prepared from leukocytes, platelets, or hair follicles (3pieces) by the addition of 100 pI of lysis buffer (50 mM Tris pH 8.5 containing 1 mM EDTA, 0.5% Tween 20) and 200 pdml of proteinase K, and incubation at 37" C overnight. The reaction mixtures were
a($,
.., , CTGCACGTGGTAAGG
e
f
then placed at 95" C for 10 min and were either used immediately or stored at -20" C. A segment of the mtDNA was amplified by PCR (Saiki et al., 1985) with: denaturation at 95" C for 60 sec, annealing at 56" C for 60 sec and extension at 72" C for 120 sec. A Analysis of the 11778G>A mutation. Amplification was from nt11728 to nt11942 (214 bp) using the following primers: L11728 (11728CTCATTACTATTCTGCCTAGCAAACTTAC GAACGCACTCATGATC) and H11942 (11942GTAGGAGAGTGATATTTGATCAGG). L11728 has been specifically designed to correspond to nt11728-11777 of the light strand of the human mtDNA, except that nt11773-11775 CAG have been substituted by TGA (unshaded box). Black dots indicate the position of the ntl1778G>A LHON mutation. V,pre-existing BCIl restric-
5214
SUDOYO ET AL.
found to carry the other LHON mutations examined (data not shown). The discovery of the 11778G>A mutation in the mtDNA of the Jambi family adds to the number of cases in whom this particular mutation has been found. Although we have not carried out an extensive haplotyping study, it is unlikely that the mtDNA of the Jambi family has originated from the same founder populations as those of the Caucasian, American black and Japanese LHON families (see Riordan-Eva et al., 1995; Brown et al., 1992, for recent reviews). Therefore, the 11778G>A mutation in the Jambi family must have arisen independently from those reported in previous studies. The reason why the same 11778G>A mutation occurred independently many times in distinctly unrelated populations is one of the unanswered questions in human mitochondrial genetics. The West Java family is of a particular interest. The 14484T>C mutation has not been found previously ip an Asian population. Furthermore, the West Java family does not carry a 13708G>A or a 3394T>C secondary mutation previously reported in 10/14 and 5/14 Caucasian probands, respectively (Johns et al., 1992). The Indonesian families documented here are important additions to the list of LHON families reported in the Caucasian, American black, and Japanese populations.
ACKNOWLEDGMENTS We thank the staff of the Jambi General Hospital, in particular Dr. Jasril Sari and Dr. Bambang Sutopo, for the excellent support given during our study in Jambi, and Ms. Suwatio Santun for her expert technical assistance. This work was supported by grants
tion site; V , BCn restriction site 11773TGATCA11778, which would be created by the 11778G>A mutation. Thus, the PCR amplified fragments (214 bp) in patients with the LHON mutation would be digested into three fragments of 147 bp 46 bp, and 21 bp, while mtDNA of a normal individual would yield only two fragments of 193bp and 2 1 bp. B: 14484T>C mutation. PCR amplification was from nt14436 to nt14701 (265bp) using the following primers: L14436 (14436CAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACGTGCA) and H14701 (14701GGTCGTGGTTGTAGTCCGTGCGAG). L14436 has been specifically designed to correspond to nt14436-14483 of the light strand of the human
from PT Krakatau Steel and PT Inti through the Agency for Strategic Industries (Indonesia), and by a generous Development Fund from the National Development Planning Agency (BAPPENAS) of the Republic of Indonesia.
REFERENCES Brown MD, Voljavec AS, Lott MT, MacDonald I, Wallace DC (1992) Leber’s hereditary optic neuropathy: A model for mitochondrial neurodegenerative diseases. FASEB J 6:2791-2799. Carrol WM, Mastaglia FL (1979) Leber’s optic neuropathy. A clinical and visual evoked potential study of affected and asymptomatic membersof a six-generationfamily. Brain 102559-580. Howell N, Kubacka I, Xu M, McCullough DA (1991) Leber hereditary optic neuropathy: Involvement of the mitochondrial ND I gene and evidence for an intragenic suppressor mutation. Am J Hum Genet 48:935-942. Huoponen K, Vilkki J, Aula F: Nikoskelainen EK, Savontaus ML (1991) A new mtDNA mutation associated with Leber hereditary optic neuropathy. Am J Hum Genet 48: 1147-1 153. Johns DR, Berman J (1991) Alternative, simultaneous complex I mitochondrial DNA mutations in Leber’s hereditary optic neuropathy. Biochem Biophys Res Commun 174:1324-1330. Johns DR, Neufeld MJ (1991) Cytochrome b mutations in Leber hereditary optic neuropathy. Biochem Biophys Res Commun 181:1358-1364. Johns DR, Neufeld MJ, Park RD (1992) An ND6 mitochondrialDNA mutation associated with Leber hereditary optic neuropathy. Biochem Biophys Res Commun 187:1551-1557. Riordan-Eva E: Sanders MD, Govan GG, Sweeney MG, DaCosta J, Harding AE (1995) The clinical features of Leber’s hereditary optic neuropathy defined by the presence of a pathogenic mitochondrial DNA mutation. Brain 118:319-337. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GGT, Erlich HA, Amheim N (1985) Enzymaticamplificationof a p-globin genomic sequences and restriction site analysis of a sickle cell anemia. Science 230:1350-1354. Sudoyo H, Marzuki S, Mastaglia F, Carol1 W (1992) Molecular genetics of Leber’s hereditary optic neuropathy: Study of a sixgenerationfamily from Western Australia.J Neurol Sci 108:7-17.
mtDNA, except that nt14479-14481 CAA have been substituted by GTG (unshaded box). Black dots indicate the position of the nt14484T>C LHON mutation. V ,ApaLl restriction site that would be created by the 14484T>C mutation (14479GTGCAC14484). yielding two fragments of 217 bp and 48 bp; in a normal person, the 265-bp PCR amplified fragment would not be digested by ApaLI. Shown are PCR fragments obtained after digestion and electrophoretic separation on 2% agarose gel, for the LHON patients carrying the mtDNA mutation (lanes c, d, e, 3, and two control mtDNA samples (lanes a.b).
