Leukemia/lymphomarelated factor regulates ... - Wiley Online Library

GLIA 60:1378–1390 (2012)

Leukemia/Lymphoma-Related Factor Regulates Oligodendrocyte Lineage Cell Differentiation in Developing White Matter NICOLE R. DOBSON,1 RYAN T. MOORE,1 JENNIFER E. TOBIN,2 AND REGINA C. ARMSTRONG2* 1 Department of Pediatrics, Uniformed Services University of Health Sciences, Bethesda, Maryland 2 Department of Anatomy, Physiology, and Genetics, Uniformed Services University of Health Sciences, Bethesda, Maryland

KEY WORDS oligodendrocyte; differentiation; LRF; development

ABSTRACT Leukemia/lymphoma-related factor (LRF) is a zinc-finger transcription factor that regulates differentiation and oncogenesis in multiple tissues and cell lineages. The potential role for LRF in cells of the CNS has not been examined to date. This study shows prominent nuclear expression of LRF in diverse neuronal populations and in oligodendrocytes. We focused on examining the function of LRF during the transition from oligodendrocyte progenitor (OP) to mature oligodendrocyte that is associated with myelination in the postnatal spinal cord. During spinal cord myelination, LRF is expressed in only a minority of OP cells whereas most mature oligodendrocytes exhibited nuclear LRF immunoreactivity. Mice with floxed alleles of the Zbtb7a gene, which encodes for LRF protein, were used for in vivo analysis of LRF function. Lentiviral driven Cre recombinase inactivation of LRF at postnatal day 7 reduced the proportion of OP cells that differentiated into mature oligodendrocytes by postnatal day 28. Astrocyte populations were not altered by LRF deletion in the same tissues. These results indicate that LRF deletion reduces differentiation within the oligodendrocyte lineage and does not alter OP lineage choice. In vitro analysis confirmed a specific effect of LRF on OP differentiation. In neonatal OP cultures, RNA interference targeting LRF inhibited OP differentiation while LRF transduction was sufficient to induce differentiation into oligodendrocytes. These results support a critical role for LRF in transcriptional control of differentiation in oligodendrocyte lineage cells during developmental myelination in the CNS. V 2012 Wiley Periodicals, Inc. C

INTRODUCTION During CNS development, an appropriate complement of diverse neuronal and glial cell types is generated through a complex network of environmental signals and cell autonomous controls. Temporally and spatially regulated expression of transcription factors directs commitment to specific lineages and facilitates appropriate distribution and differentiation of progenitor cells. Importantly, transcriptional function of a DNA-binding protein depends on the complement of nuclear proteins that contribute to the transcriptional assembly and can vary significantly between cell types and developmental stages. Therefore, transcriptional controls on neural proC 2012 V

Wiley Periodicals, Inc.

genitor cells cannot be readily predicted from non-neural lineages and must be examined within each neural lineage context. Leukemia/lymphoma-related factor (LRF) is a member of the BTB-ZF family of zinc-finger DNA binding proteins that serve as critical regulators of development and oncogenesis (Kelly and Daniel, 2006). The BTB domain of the BTB-ZF family acts as a transcriptional repressor through recruitment of histone deacetylases (HDACs) and subsequent chromatin remodeling (Liu et al., 2004; Maeda et al., 2005b; Stogios et al., 2007). In adipogenesis, LRF acts as a dual regulator that inhibits proliferation and promotes differentiation through regulation of cyclin-A and E2F-4 by direct and indirect mechanisms involving recruitment of HDAC-1 and Sin3A into repressor complexes (Laudes et al., 2004, 2008). LRF regulates lymphoid lineage fate decisions by reducing the T-cell inductive effect of Notch1 signaling, by an as yet unknown mechanism, and thereby favoring B cell development (Maeda et al., 2007). LRF transcriptional repression can also lead to potent oncogenic effects through repression of the ARF tumor suppressor (Maeda et al., 2005b). In fibroblasts, LRF overexpression leads to oncogenic transformation while LRF genetic deletion makes cells refractory to oncogenic signals (Maeda et al., 2005b). FBI-1, the human homologue of LRF, has been associated with gliomas by in silico analysis (Rovin and Winn, 2005) and by chromosomal localization from comparative hybridization analysis of glioblastoma multiforme (Wiltshire et al., 2004). The murine Zbtb7a gene encodes for LRF protein. In the embryonic CNS, Zbtb7a transcript expression is present in diverse neuronal and glial cell types (Allen Brain Atlas, available at: www.brain-map.org). LRF protein expression in the CNS has not been previously reported. The present study characterizes the expression and role of LRF in the important transition from OP cell Grant sponsor: National Multiple Sclerosis Society; Grant number: RG4224; Grant sponsor: National Institutes of Health; Grant number: NS39293. Dr. Moore is currently affiliated with Carl R. Darnall Medical Center, Fort Hood, TX. Dr. Tobin is currently affiliated with Science Applications International Corporation, Frederick, MD *Correspondence to: Regina C. Armstrong, Department of Anatomy, Physiology, and Genetics, B2050 APG/Uniformed Services University of the Health Sciences, 4301 Jones Bridge Rd., Bethesda, MD 20814, USA. E-mail: [email protected] Received 28 February 2012; Accepted 25 April 2012 DOI 10.1002/glia.22356 Published online 21 May 2012 in Wiley Online Library (wileyonlinelibrary.com).

LRF REGULATES OLIGODENDROCYTE DIFFERENTIATION

to mature oligodendrocyte during spinal cord myelination. The tracts of the dorsal column exhibit a distinct temporal pattern of progressive myelination (Murtie et al., 2005), allowing analysis of LRF in the context of physiologically appropriate developmental signals. A normal overproduction of oligodendrocytes precedes the peak of myelination at postnatal day 15 (P15), then OP number and proliferation decreases in conjunction with differentiation into oligodendrocytes as myelination progresses (Murtie et al., 2005). We use Cre recombination in mice with floxed Zbtb7a alleles to inactivate LRF at P7 in actively proliferating OP cells and examine the effect of LRF loss on the development of white matter glia. A specific effect of LRF on oligodendrocyte lineage differentiation is examined by in vitro retroviral infection of OP cells with shRNA constructs to knockdown LRF expression. Finally, sufficiency of LRF to induce oligodendrocyte maturation is tested by LRF transduction of cultured OP cells. These studies reveal a critical role for LRF in transcriptional control of differentiation from OP cell to oligodendrocyte during developmental myelination in the CNS.

MATERIAL AND METHODS Animals Mice were bred and maintained in the Uniformed Services University of Heath Sciences (USUHS) animal housing facility and all procedures were performed in accordance with guidelines of the National Institutes of Health, the Society for Neuroscience, and the USUHS Institutional Animal Care and Use Committee. C57BL/ 6J mice (Jackson Laboratories; Bar Harbor, ME) were used for analysis of the endogenous LRF expression pattern in normal spinal cord development. For analysis of LRF through loss-of-function, endogenous Zbtb7a was conditionally deleted using Cre recombination in mice with floxed alleles of Zbtb7a (Maeda et al., 2007). Heterozygous breeding pairs of the floxed Zbtb7a mouse line were provided by Dr. Pier Paola Pandolfi (Beth Israel Deaconess Medical Center, Boston, MA). Mice were genotyped using PCR analysis of tail genomic DNA to identify wild-type and floxed alleles of Zbtb7a (Maeda et al., 2007).

Immunohistochemistry Mice were perfused with 4% paraformaldehyde. Brains and spinal cords were cut in 15 lm thick coronal and transverse sections, respectively (Murtie et al., 2005). LRF protein was detected with LRF (13E9) Armenian hamster monoclonal antibody (1:100; Santa Cruz Biotechnology; Santa Cruz, CA) or zbtb7/FBI-1 rabbit polyclonal antibody (1:10,000, Bethyl Laboratories; Montgomery, TX). Primary antibodies for NeuN (1:100; Chemicon/Millipore; Billerica, MA), Olig2 (1:100; Chemicon/Millipore), NG2 (1:500; from Dr. William Stallcup; La Jolla, CA), CC1/APC (1:50; Calbio-

1379

chem; San Diego, CA), glutathione S-transferase pi isoform (GSTpi; Millipore; Danvers, MA) and glial fibrillary acidic protein (GFAP; 1:500; DAKO; Carpinteria, CA) were used to identify neurons (NeuN), oligodendrocyte lineage cells (Olig2), OP cells (NG2), oligodendrocytes (CC1, GSTpi), and astrocytes (GFAP). The nuclear stain DAPI (1:500; Sigma; St. Louis, MO) was added before mounting. Appropriate secondary antibodies (Jackson Immunoresearch; West Grove, PA) to detect each primary antibody were tested for specificity in multilabel immunofluorescence protocols by lack of cross-reactivity with sequential deletion of the primary antibodies. For cell density quantification in transverse spinal cord sections of postnatal spinal cord, the area of each anatomical region (dorsal column, ventral white matter, gray matter) was measured using Spot Advanced software (Diagnostic Instruments; Milwaukee, WI) and all labeled cells within the region were counted to determine cells per square millimeter.

Lentivirus Production Plasmids for lentivirus production [pCAG VSV-G (envelope protein), PAX2 (packaging plasmid)] were obtained from Dr. Patrick Salmon (Centre Medical Universitaire; Geneva, Switzerland). The expression vector LentiCreEGFP was obtained from Dr. Erich Ehlert (Netherlands Institute for Neuroscience; Amsterdam, The Netherlands; Ahmed et al., 2004). For LRF transduction, the 1.7-kb murine Zbtb7a sequence with FLAG epitope (PSG5-Flag-LRF plasmid obtained from Dr. Pier Paola Pandolfi) was cloned into the lentiviral expression vector, pLVX-IRES-tdTomato (Clontech Laboratories; Mountain View, CA) to create LentiTom-LRF plasmid. In this replication-incompetent lentiviral plasmid, the sequence encoding LRF was followed by an IRES element and tdTomato reporter. The parental vector pLVX-IRES-tdTomato was used to generate control virus (LentiTom). For virus production, LentiCreEGFP, LentiTom, or LentiTom-LRF plasmid was co-transfected together with the viral core packaging construct PAX2 and the VSV-G envelope protein vector pCAG VSV-G into 293T/17 cells (ATCC #CRL-11268; Manassas, VA) utilizing a modification of a previously described protocol (Murtie et al., 2005; Zhou et al., 2006). Briefly, 293T/17 cells were seeded at a density of 5 3 105 cells into 20-mm tissue culture dishes 24 h before transfection in Dulbecco’s Modified Eagle Medium (GIBCO DMEM; Invitrogen; Carlsbad, CA) supplemented with pyruvate in a 10% CO2 incubator. Two micrograms of expression vector plasmid, 2 lg of packaging plasmid, and 1 lg of envelope plasmid were co-transfected with FuGENE 6 Transfection Reagent (Roche; Mannheim, Germany). The medium was collected 48 to 72 h later, filtered through 0.45 lm cellulose acetate filter, and then the supernatant was concentrated by ultra centrifugation (25,000 rpm for 2.5 h). The pellet was re-suspended in Hanks Balanced Salt Solution (GIBCO HBSS; Invitrogen), and viGLIA

1380

DOBSON ET AL.

rus was aliquoted and stored at 280°C.The titer was determined by infecting NIH3T3 cells with serial dilutions of virus as previously described (Murtie et al., 2005; Zhou et al., 2006). Lentivirus Injection and In Vivo Identification of Infected Cell Types Stereotaxic surgery and lentivirus injection were performed on P7 male littermates from heterozygous breedings of floxed Zbtb7a mice utilizing procedures previously described (Dobson et al., 2008; Murtie et al., 2005). LentiCreEGFP lentivirus (approximately 100 colony forming units (CFU) in 1 lL) was injected into the lumbar (L5) dorsal funiculus. At P28, the mice were perfused with 3% paraformaldehyde and longitudinal 15lm thick sections through the dorsal funiculus were immunostained (see above) for LRF or with Olig2, NG2, CC1, or GFAP antibodies, to identify oligodendrocyte lineage cells, OP cells, mature oligodendrocytes, or astrocytes, respectively. The proportion of infected cells that became each cell type was quantified as the number of GFP1 cells co-expressing a specific cell marker (i.e. Olig21, NG21, CC11, etc) among the total number of GFP1 cells counted. For each cell-type specific antigen, at least 100 GFP1 cells were counted per animal, with three to four animals analyzed for each genotype.

Lentiviral Transduction of LRF in OP Cells: In Vitro Differentiation Assay Lentiviral infection of OP cells was performed in a similar fashion to that previously described for retroviral infection (Dobson et al., 2008; Nielsen et al., 2004; Zhou et al., 2006). OP cultures were prepared as detailed previously (Armstrong et al., 1998). Briefly, brains from P2 rats were dissociated and plated in tissue culture flasks to produce stratified ‘‘primary’’ cultures. After shaking to dislodge microglia, flasks were shaken overnight to yield OP cells which were plated in 24-well plates in defined medium supplemented with platelet derived growth factor (PDGF) and fibroblast growth factor 2 (FGF2; both 10 ng/mL; R&D Systems; Minneapolis, MN) to induce proliferation and prevent differentiation. In similarly prepared cultures, the OP population immunolabeled with A2B5 represented approximately 77% of the cells with the remainder being mainly mature oligodendrocytes and microglia (Armstrong et al., 1995). One day after plating, the cells were infected by incubation for 6 h with either LentiTom-LRF or parental control lentivirus (3,000 CFU/well). The cells were maintained for 2 days in defined medium with PDGF and FGF2, and then the cultures were transferred to defined medium without PDGF or FGF2 for 3 days to allow differentiation. The cells were fixed and immunostained with O1 (1:20; IgM hybridoma supernatant) to identify mature oligodendrocytes followed by detection with a fluorescently labeled donkey anti-mouse GLIA

IgM secondary antibody (Jackson Immunoresearch). The nuclear stain DAPI (1:500; Sigma) was added before mounting. The proportion of infected mature oligodendrocytes was quantified as the number of Tomato1 cells that were double labeled for O1.

Lentiviral Tansduction of LRF in OP Cells: In Vitro Proliferation Assay OP cells were infected with LentiTom-LRF or parental control lentivirus, as detailed above. After infection, cells were grown for 4 days in defined medium supplemented with PDGF and FGF2. Bromodeoxyuridine (BrdU) (0.2 lM; Sigma) was added during the final 20 h. BrdU incorporation was detected by immunostaining, as detailed previously (Dobson et al., 2008; Nielsen et al., 2004). Proliferation of the infected OP cells was quantified as the percentage of Tomato1 cells that had incorporated BrdU.

RNA Interference of LRF Expression In Vitro Retroviral transduction of short hairpin RNA (shRNA) sequences was used to knockdown LRF in cultured OP cells, prepared as detailed above. A short hairpin RNA construct containing a 20 nucleotide (nt) sense sequence (50 GCCTGCTGCGTGCCAAGGAG 30 ) and a 20 nt antisense sequence (50 CTCCTTGGCACGCAGCAGGC 30 ) joined by a 9 nt hairpin loop was designed to target LRF. A scrambled 19 nt shRNA sequence was used to generate a control fragment (control shRNA). To construct the shRNA expression vector, complementary oligonucleotides (including both the sense and antisense sequences of the corresponding 20 bp shRNA, the hairpin-forming sequence, and the adapter sequences for cloning) were annealed to form a double-stranded DNA fragment using the Knockout Clone and Confirm Kit (Clontech Laboratories). The fragment was ligated into pSIREN-RetroQZsGreen vector (Clontech Laboratories), a replicationincompetent retroviral plasmid containing ZsGreen fluorescent reporter sequence. The pSIREN-RetroQ-ZsGreen vector contains multiple promoters, which allows LRF shRNA and the ZsGreen reporter to be expressed independently. Retrovirus was generated in GP2-293 packaging cells and titered as previously reported (Dobson et al., 2008; Murtie et al., 2005; Zhou et al., 2006). The efficacy of shRNA knockdown of LRF gene expression was confirmed by analyses in mouse embryonic fibroblast (MEF) cells and C3H10T1/2 cells (both cell lines from American Type Culture Collection; Manassas, VA). LRF expression was first confirmed in both cell lines as similar immunostaining patterns with two different LRF antibodies (see above), no staining without inclusion of primary antibody, and no staining with preabsorption using a 1003 excess of the LRF competitive blocking peptide (Bethyl Laboratories). LRF expression and relative knockdown efficiency was estimated by quantification of pixel intensity following LRF immuno-


staining using Metamorph software (Molecular Devices, Inc.; Sunnyvale, CA). LRF immunostaining after LRF shRNA or control shRNA infection in MEF cells was performed to prove that retroviral infection and ZsGreen expression did not interfere with LRF immunodetection and to establish intensity thresholds to define LRF-positive and LRF-negative cells. LRF shRNA infection significantly reduced expression of LRF in ZsGreen1 cells compared with control shRNA infection (15.99 6 1.34% versus 34.91 6 2.28%, P < 0.0001). In addition, Western blot analysis of C3H10T1/2 cells 3 days after infection with LRF shRNA or control shRNA confirmed reduced expression of LRF protein after infection with LRF shRNA (data not shown). OP cultures were infected with LRF shRNA or control shRNA as previously described (Nielsen et al, 2004; Zhou et al., 2006). The cultures were maintained for 2 days in defined medium with PDGF and FGF2, and then the cultures were transferred to defined medium without PDGF or FGF2 for 3 days to allow differentiation. The cultures were fixed and immunostained for O1 as detailed above. The proportion of infected mature oligodendrocytes was quantified as the number of ZsGreen1 cells that were double labeled for O1.

Imaging and Statistical Analyses Images of immunohistochemistry were acquired and prepared as panels as previously detailed (Dobson et al, 2008; Murtie et al., 2005). For analysis of tissue sections, at least three mice of each condition (i.e. postnatal age and genotype) were analyzed with at least three sections quantified for each mouse. All in vitro quantification was based on data combined from at least three independent preparations of cells from separate litters of animals. At least 100 cells per well were counted with three or more wells counted per experiment and at least three experiments assessed with each virus and condition. Unpaired Student’s t-tests (two-tailed) were used to distinguish significant differences in cell density values between groups. The v2 test with the Mantel-Haenzel subgroup analysis was used to compare percentages of retrovirally or lentivirally labeled cells with a specific phenotype (i.e. immunostained for O1, BrdU, LRF, Olig2, NG2, CC1, or GFAP). All values are presented as means with standard error of the mean. A P value 0.05 for all comparisons). N 5 3 Zbtb7awt/wt mice; N 5 4 Zbtb7awt/fl mice; N 5 3 Zbtb7afl/fl mice. Scale bars: A, C 10 lm; B, D–G 25 lm.

LRF Transduction Increases OP Differentiation In Vitro

immunoreactivity (40.38 6 3.58%), compared with infection with the control lentivirus (24.13 6 1.17%,P < 0.0001; Fig. 7B). These results show that LRF transduction promotes OP differentiation into mature oligodendrocytes.

To further define the function of LRF in oligodendrocyte differentiation, we assessed the effect of transduction of a construct encoding the full length LRF protein. OP cell cultures were infected with lentivirus expressing LRF followed by an IRES element and tdTomato fluorescent reporter (Fig. 7A,B). The parental lentivirus vector was used to generate control virus. Lentiviral transduction of LRF significantly increased the proportion of Tomato1 cells that differentiated into oligodendrocytes, identified by O1

LRF Transduction does not Alter OP Proliferation To test whether LRF transduction modulated OP proliferation, OP cells were infected with lentivirus expressing LRF or parental control virus and then maintained GLIA

1386

DOBSON ET AL.

Fig. 5. LRF knockdown in vivo does not affect astrocyte populations. LentiCreEGFP was injected into the dorsal funiculus of P7 mice with wild-type (wt) or floxed (fl) alleles of Zbtb7a to assess the effects of genetic deletion of Zbtb7a on astrocytes in the developing white matter. Longitudinal sections through the dorsal column white matter were immunostained for GFAP to identify astrocytes. A: Examples of GFP1 cells (green) that express GFAP (red; white arrows) in fl/fl mouse. White arrowhead shows a GFP1 cell that does not express GFAP. B: Quantification of the proportion of GFP1 cells that express GFAP. The percentage of GFP1 cells identified as GFAP1 astrocytes was similar between all genotypes (P > 0.05 for all comparisons). N 5 3 Zbtb7awt/wt mice; N 5 4 Zbtb7awt/fl mice; N 5 3 Zbtb7afl/fl mice. Scale bar: 10 lm.

in defined medium with mitogens (PDGF and FGF2). These conditions prevented OP differentiation into postmitotic oligodendrocytes and stimulated sufficient proliferation to detect positive or negative modulation by LRF transduction. BrdU was added during the final 20 h of culture to label proliferating cells undergoing active DNA synthesis. BrdU incorporation was detected by immunostaining (Tomato1 BrdU1 cells in Fig. 7C). A similar result was obtained with the lentivirus expressing LRF (27.01 6 2.18% of the Tomato1 cells were BrdU1) or the control lentivirus (24.47 6 1.64% of the Tomato1 cells were BrdU1; P 5 0.2062, Fig. 7D). These findings indicate that LRF transduction does not impact OP proliferation.

DISCUSSION The current study demonstrates that LRF is expressed in the developing CNS and serves as a critical GLIA

regulator of oligodendrocyte differentiation. This study is the first to describe LRF protein expression and identify a role in differentiation of a neural cell lineage in the CNS. Interestingly, although LRF has a role in early differentiation and oncogenesis in several non-neural lineages, LRF expression in the CNS is prominent in differentiated neurons and oligodendrocytes, which are postmitotic cells. Our in vivo and in vitro studies demonstrate that LRF plays an important role in late stage OP cells to promote terminal differentiation into oligodendrocytes. The nuclear expression of LRF is maintained in mature oligodendrocytes. Genetic deletion of LRF in vivo demonstrated that LRF regulates OP maturation but does not alter oligodendrocyte versus astrocyte lineage choice. Consistent with this in vivo analysis, RNA interference studies in cultured OP cells showed that LRF knockdown inhibits OP differentiation into oligodendrocytes. LRF transduction promotes differentiation without altering OP proliferation. Taken together, these results clearly indicate that LRF contributes to the regulation of differentiation of oligodendrocyte lineage cells in the developing CNS. LRF modulation of NG2 versus CC1/O1 populations along with the lack of an effect of LRF on proliferation points to LRF acting during the transition from late OP stage to mature oligodendrocyte. Further studies are warranted to determine the specific targets and binding partners of LRF that may regulate OP cell cycle exit and/or expression of oligodendrocyte specific genes. Lentiviral driven Cre recombinase inactivation of LRF in a mouse line with floxed alleles of Zbtb7a facilitated analysis of LRF deletion in developing white matter. This approach allowed analysis of genetic deletion of LRF on both oligodendrocyte and astrocyte populations in the same tissues. Moreover, lentiviral driven Cre recombinase reduced endogenous LRF to nondetectable levels in infected cells of Zbtb7afl/fl mice (Fig. 3). Therefore, this approach resulted in a much higher efficiency of endogenous gene deletion than reported for inducible site-specific recombination in transgenic mice with Cre expression under transcriptional control of oligodendrocyte lineage-specific gene promoters (Doerflinger et al., 2003; Takebayashi et al., 2002: Zhu et al., 2011). In addition to a high efficiency of LRF knockdown, this lentiviral approach allows differentiation of a subset of cells with LRF deletion to be analyzed within the context of an otherwise normal complement of CNS cellular and environmental interactions. However, the lentiviral infection density is not high enough to expect a detectable difference in overall myelination within a given tract. LRF is a BTB/POZ domain zinc finger transcription factor belonging to the POK protein family, which is particularly important for normal hematopoiesis and immune system development (He et al., 2005; Piazza et al., 2004; Sun et al., 2005). Several members of the POK protein family have been linked to human leukemia and lymphoma (Chen et al., 1993; Maeda et al., 2005a; Ye et al., 1997). During development and differentiation, LRF has pleiotropic functions but can also act as an oncogene (Maeda et al., 2005a). In mouse em-


1387

Fig. 6. RNA interference targeting LRF in vitro inhibits OP differentiation. OP cell cultures were infected with a replication-incompetent retrovirus expressing ZsGreen reporter and shRNA fragment targeting LRF. A scrambled nucleotide sequence in the same shRNA cassette was used to generate control retrovirus. Cultures were immunostained with O1 (red) to examine differentiation into mature oligodendrocytes. A, B: Infection with control retrovirus (A) or LRF shRNA (B). White arrow (A) identifies an O11 oligodendrocyte infected with control retrovirus. Cells transducing the LRF shRNA (gray arrows, B) are not labeled by

O1 and exhibit an immature morphology compared with the processbearing morphology of the non-infected O11 cell (arrowhead, B). C: Quantification of the proportion of ZsGreen1 cells that are immunolabeled by O1. Infection with LRF shRNA (white bar) significantly reduced the proportion of ZsGreen1 cells that expressed O1 compared with infection with control retrovirus (black bar, P < 0.0001). Values shown are derived from three independent experiments with at least 300 infected cells counted for each retrovirus during each experiment. Scale bars: 10 lm.

bryonic fibroblasts (MEFs), LRF deletion causes aberrant upregulation of the tumor suppressor p19/ARF, resulting in proliferation defects and premature senescence (Maeda et al., 2005b). MEFs lacking Zbtb7a are refractory to transformation while LRF over-expression leads to oncogenic transformation (Maeda et al., 2005b), proving that LRF is a critical factor in oncogenesis in some cell types. FBI-1, the human homologue of the murine Zbtb7a gene, is localized on chromosome 19p13.3, a common locus for chromosomal translocations in human tumors. Comparative genomic hybridization analysis of gliomas revealed high-level gains of the 19p13.3 locus in glioblastoma multiforme (Wiltshire et al., 2004). In silico analysis has suggested association of FBI-1 with gliomas (Rovin and Winn, 2005). LRF represses transcription of the tumor suppressor p14/ARF in humans, and inactivation of p14/ARF is often observed in glioblastoma multiforme (Nakamura et al., 2001). These findings confirm that LRF functions as an oncogene in CNS tumors derived from immature cell types. Our results associating LRF with mature, terminally differentiated postmitotic neural cell types (Figs. 1 and 2) suggests that further studies will be important to determine the full range of neural cell stages that express LRF, the relationship and susceptibility to oncogenic transformation, and the distinctly different

functions LRF may have in mature postmitotic neural cell types. Transcription factors and microRNAs (miRNAs) often work cooperatively and commonly have intersecting regulatory mechanisms to guide development and differentiation of specific cell types. LRF expression has recently been shown to be down-regulated by miR-20a (Poliseno et al., 2008). Furthermore, LRF modulates miR-28 and miR-505 to mediate effects on MEF cell proliferation, senescence, and viability (Verduci et al., 2010). Therefore, differences in LRF expression and roles in different cell lineages may involve regulatory microRNAs acting together with transcriptional controls. Although other zinc finger transcription factors regulate oligodendrocyte lineage development, each has a different expression pattern and function in the oligodendrocyte lineage. Yin Yang 1 (YY1) is ubiquitously expressed and required for differentiation yet represses myelin proteolipid protein gene expression in immature oligodendrocytes (He and Casaccia-Bonnefil, 2008; Zolova and Wight, 2011). Myelin transcription factor 1 (Myt1) is expressed early in the lineage and then downregulated during terminal differentiation (Armstrong et al., 1995). Zbtb45, another zinc finger transcription factor belonging to the BTB/POZ family, is required for proper glial differentiation of multipotent neural stem cells and OP cells (S€ odersten et al., 2010). The precise GLIA

1388

DOBSON ET AL.

Fig. 7. LRF transduction increases OP differentiation in vitro without affecting proliferation. OP cells were infected with lentivirus expressing LRF followed by an IRES element and tdTomato reporter. The IRES element allows LRF and tdTomato to be transcribed as a single transcript that is then translated as two separate proteins. The parental lentivirus vector without LRF was used to generate control virus. Cultures were analyzed for differentiation based on O1 immunolabeling (A, B), or proliferation, estimated from BrdU incorporation (C, D). A: O11 (green) oligodendrocyte infected with control lentivirus (red). B: Quantification of the percentage of O11 oligodendrocytes among Tomato1 cells in cultures infected with control (black bar) or LRF (gray bar) lentivirus. Infection with LRF-expressing lentivirus sig-

nificantly increased the percentage of cells that differentiated into mature oligodendrocytes compared with infection with the control virus (P < 0.001). C: Two OP cells infected with the LRF-expressing lentivirus (red) that have incorporated BrdU (green; overlap of red and green appears yellow). D: Quantification of the percentage of Tomato1 cells with BrdU labeling in cultures infected with control (black bar) or LRF (gray bar) lentivirus. A similar percentage of OP cells were actively proliferating in cultures infected with either lentivirus (P 5 0.2062). Values shown are derived from three independent experiments with at least 300 infected cells counted for each lentivirus during each experiment. Scale bars: 10 lm.

mechanism of LRF regulation of differentiation in the oligodendrocyte lineage is not yet known. In non-neural cells, LRF exerts transcriptional repressor activity by recruiting HDACs and subsequent remodeling of chromatin (Lin et al., 1998; Melnick et al., 2002). LRF regulates adipocyte and chondrogenic differentiation by recruiting HDAC-1 and Sin3A (Laudes et al., 2008; Liu et al., 2004). Histone deacetylation is required for oligodendrocyte lineage progression (Marin-Husstege et al., 2002; Ye et al., 2009), and HDAC inhibitors block oligodendrocyte differentiation (Marin-Husstege et al., 2002; Shen et al., 2005). Other zinc finger transcription factors, including YY1 and Myt1, recruit HDACs and Sin3A to promote OP differentiation and myelin gene expression (He et al., 2007; Nielsen et al., 2004; Romm et al., 2005). Thus, one possible mechanism by which LRF regulates oligodendrocyte lineage differentiation may be related to recruitment of co-repressors, such as

HDAC1, with direct or indirect effects on expression of differentiation factors and myelin genes. Indeed, LRF may inhibit transcription of target genes that themselves are negative regulators of oligodendrocyte differentiation and/or myelin genes similar to LRF suppression of the ARF tumor suppressor. This LRF role would be consistent with a de-repression model of oligodendrocyte lineage progression put forth from studies of multiple transcriptional control mechanisms (Swiss et al., 2011). The continued expression of LRF in mature oligodendrocytes in the adult CNS could potentially maintain transcriptional de-repression of myelin genes to support the transcription required for normal myelin turnover. Another potential mechanism by which LRF may regulate OP differentiation is attenuation of Notch1 signaling. Notch1 activation inhibits differentiation along the oligodendrocyte lineage (Wang et al., 1998). Mice with Notch1 knockout and haploinsufficiency exhibit acceler-

GLIA


ated OP differentiation and myelination during postnatal development, identifying Notch1 as a critical regulator of maturation within the oligodendrocyte lineage (Genoud et al., 2002; Givogri et al., 2002). Retroviral transduction of the constitutively active Notch1 intracellular domain inhibits OP differentiation without altering proliferation (Zhou et al., 2007). In lymphogenesis, Notch signaling is the key molecular determinant of B versus T cell fate decisions in the bone marrow (Maillard et al., 2005; Pui et al., 1999; Radtke et al., 1999). LRF blocks Notch signaling in bone marrow progenitor cells, favoring their development into B cells (Maeda et al., 2007). The site of action of LRF in the Notch signaling pathway is not presently known but LRF likely targets upstream components of the Notch pathway rather than repressing downstream Notch1 target genes (Maeda et al., 2007; Maillard and Pear, 2007). Further studies are needed to determine if LRF impacts the Notch1 signaling pathway to regulate differentiation in the oligodendrocyte lineage. This work highlights the role of the zinc finger transcription factor LRF as a key regulator of oligodendrocyte lineage differentiation in the postnatal CNS. In this initial analysis of LRF in the developing CNS, LRF expression was prominent in diverse neural cell types. A better understanding of the molecular controls involving LRF in neurons and oligodendrocytes may have important implications for preventing oncogenesis since high LRF expression in these postmitotic neural cells occurs with very low likelihood of transformation, in contrast to other cell types. Importantly, analysis of the mechanism of LRF function in the oligodendrocyte lineage may also elucidate potential targets for therapeutic interventions to promote recovery from diseases with a demyelinating component, such as multiple sclerosis, spinal cord injury, and perinatal white matter injury.

ACKNOWLEDGMENTS The authors thank the investigators who generously contributed mice and reagents, as noted in text, and Tuan Le and Laurel Beer for technical assistance. The views expressed are those of the authors and do not necessarily reflect the official policy or position of the Department of the Army (DOA), Department of Defense (DOD), nor the U.S. Government.

REFERENCES Ahmed BY, Chakravarthy S, Eggers R, Hermens WT, Zhang JY, Niclou SP, Levelt C, Sablitzky F, Anderson PN, Lieberman AR, Verhaagen J. 2004. Efficient delivery of Cre-recombinase to neurons in vivo and stable transduction of neurons using adeno-associated and lentiviral vectors. BMC Neurosci 5:4. Armstrong RC. 1998. Isolation and characterization of immature oligodendrocyte lineage cells. Methods 16:282–292. Armstrong RC, Kim JG, Hudson LD. 1995. Expression of myelin transcription factor I (MyTI), a ‘‘zinc-finger’’ DNA-binding protein, in developing oligodendrocytes. Glia 14:303–321. Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang ZY, Waxman S, Zelent A. 1993. Fusion between a novel Kruppel-like zinc finger gene

1389

and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. EMBO J 12:1161–1167. Dobson NR, Zhou YX, Flint NC, Armstrong RC. 2008. Musashi1 RNAbinding protein regulates oligodendrocyte lineage cell differentiation and survival. Glia 56:318–330. Genoud S, Lappe-Siefke C, Goebbels S, Radtke F, Aguet M, Scherer SS, Suter U, Nave KA, Mantei N. 2002. Notch1 control of oligodendrocyte differentiation in the spinal cord. J Cell Biol 158:709–718. Givogri MI, Costa RM, Schonmann V, Silva AJ, Campagnoni AT, Bongarzone ER. 2002. Central nervous system myelination in mice with deficient expression of Notch1 receptor. J Neurosci Res 67:309–320. He X, Dave VP, Zhang Y, Hua X, Nicolas E, Xu W, Roe BA, Kappes DJ. 2005. The zinc finger transcription factor Th-POK regulates CD4 versus CD8 T-cell lineage commitment. Nature 433:826–833. He Y, Casaccia-Bonnefil P. 2008. The Yin and Yang of YY1 in the nervous system. J Neurochem 106:1493–1502. Kelly KF, Daniel JM. 2006. POZ for effect--POZ-ZF transcription factors in cancer and development. Trends Cell Biol 16:578–587. Laudes M, Bilkovski R, Oberhauser F, Droste A, Gomolka M, Leeser U, Udelhoven M, Krone W. 2008. Transcription factor FBI-1 acts as a dual regulator in adipogenesis by coordinated regulation of cyclin-A and E2F-4. J Mol Med (Berl) 86:597–608. Laudes M, Christodoulides C, Sewter C, Rochford JJ, Considine RV, Sethi JK, Vidal-Puig A, O’Rahilly S. 2004. Role of the POZ zinc finger transcription factor FBI-1 in human and murine adipogenesis. J Biol Chem 279:11711–11718. Lin RJ, Nagy L, Inoue S, Shao W, Miller WH Jr, Evans RM. 1998. Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature 391:811–814. Liu CJ, Prazak L, Fajardo M, Yu S, Tyagi N, Di Cesare PE. 2004. Leukemia/lymphoma-related factor, a POZ domain-containing transcriptional repressor, interacts with histone deacetylase-1 and inhibits cartilage oligomeric matrix protein gene expression and chondrogenesis. J Biol Chem 279:47081–47091. Maeda T, Hobbs RM, Pandolfi PP. 2005a. The transcription factor Pokemon: A new key player in cancer pathogenesis. Cancer Res 65:8575–8578. Maeda T, Hobbs RM, Merghoub T, Guernah I, Zelent A, Cordon-Cardo C, Teruya-Feldstein J, Pandolfi PP. 2005b. Role of the proto-oncogene Pokemon in cellular transformation and ARF repression. Nature 433:278–285. Maeda T, Merghoub T, Hobbs RM, Dong L, Maeda M, Zakrzewski J, van den Brink MR, Zelent A, Shigematsu H, Akashi K, Teruya-Feldstein J, Cattoretti G, Pandolfi PP. 2007. Regulation of B versus T lymphoid lineage fate decision by the proto-oncogene LRF. Science 316:860–866. Maillard I, Fang T, Pear WS. 2005. Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol 23:945–974. Maillard I, Pear WS. 2007. Immunology. Keeping a tight leash on Notch. Science 316:840–842. Marin-Husstege M, Muggironi M, Liu A, Casaccia-Bonnefil P. 2002. Histone deacetylase activity is necessary for oligodendrocyte lineage progression. J Neurosci 22:10333–10345. Melnick A, Carlile G, Ahmad KF, Kiang CL, Corcoran C, Bardwell V, Prive GG, Licht JD. 2002. Critical residues within the BTB domain of PLZF and Bcl-6 modulate interaction with corepressors. Mol Cell Biol 22:1804–1818. Murtie JC, Zhou YX, Le TQ, Armstrong RC. 2005. In vivo analysis of oligodendrocyte lineage development in postnatal FGF2 null mice. Glia 49:542–554. Nakamura M, Watanabe T, Klangby U, Asker C, Wiman K, Yonekawa Y, Kleihues P, Ohgaki H. 2001. p14ARF deletion and methylation in genetic pathways to glioblastomas. Brain Pathol 11:159–168. Nielsen JA, Berndt JA, Hudson LD, Armstrong RC. 2004. Myelin transcription factor 1 (Myt1) modulates the proliferation and differentiation of oligodendrocyte lineage cells. Mol Cell Neurosci 25:111–123. Nishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. 1996. Co-localization of NG2 proteoglycan and PDGF alpha-receptor on O2A progenitor cells in the developing rat brain. J Neurosci Res 43:299–314. Piazza F, Costoya JA, Merghoub T, Hobbs RM, Pandolfi PP. 2004. Disruption of PLZP in mice leads to increased T-lymphocyte proliferation, cytokine production, and altered hematopoietic stem cell homeostasis. Mol Cell Biol 24:10456–10469. Poliseno L, Pitto L, Simili M, Mariani L, Riccardi L, Ciucci A, Rizzo M, Evangelista M, Mercatanti A, Pandolfi PP, Rainaldi G. 2008. The proto-oncogene LRF is under post-transcriptional control of MiR-20a: implications for senescence. PLoS One 3:e2542. Pui JC, Allman D, Xu L, DeRocco S, Karnell FG, Bakkour S, Lee JY, Kadesch T, Hardy RR, Aster JC, Pear WS. 1999. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11:299–308.

GLIA

1390

DOBSON ET AL.

Radtke F, Wilson A, Stark G, Bauer M, van Meerwijk J, MacDonald HR, Aguet M. 1999. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10:547–558. Romm E, Nielsen JA, Kim JG, Hudson LD. 2005. Myt1 family recruits histone deacetylase to regulate neural transcription. J Neurochem 93:1444–1453. Rovin RA, Winn R. 2005. Pokemon expression in malignant glioma: An application of bioinformatics methods. Neurosurg Focus 19:E8. Shen S, Li J, Casaccia-Bonnefil P. 2005. Histone modifications affect timing of oligodendrocyte progenitor differentiation in the developing rat brain. J Cell Biol 169:577–589. Sodersten E, Lilja T, Hermanson O. 2010. The novel BTB/POZ and zinc finger factor Zbtb45 is essential for proper glial differentiation of neural and oligodendrocyte progenitor cells. Cell Cycle 9:4866–4875. Stogios PJ, Chen L, Prive GG. 2007. Crystal structure of the BTB domain from the LRF/ZBTB7 transcriptional regulator. Protein Sci 16:336–342. Sun G, Liu X, Mercado P, Jenkinson SR, Kypriotou M, Feigenbaum L, Galera P, Bosselut R. 2005. The zinc finger protein cKrox directs CD4 lineage differentiation during intrathymic T cell positive selection. Nat Immunol 6:373–381. Swiss VA, Nguyen T, Dugas J, Ibrahim A, Barres B, Androulakis IP, Casaccia P. 2011. Identification of a gene regulatory network necessary for initiation of oligodendrocyte differentiation. PLoS One 6:1– 13. Verduci L, Simili M, Rizzo M, Mercatanti A, Evangelista M, Mariani L, Rainaldi G, Pitto L. 2010. MicroRNA (miRNA)-mediated interaction between leukemia/lymphoma-related factor (LRF) and alternative splicing factor/splicing factor 2 (ASF/SF2) affects mouse embryonic fibroblast senescence and apoptosis. J Biol Chem 285:39551–39563.

GLIA

Wang S, Sdrulla AD, diSibio G, Bush G, Nofziger D, Hicks C, Weinmaster G, Barres BA. 1998. Notch receptor activation inhibits oligodendrocyte differentiation. Neuron 21:63–75. Weng AP, Ferrando AA, Lee W, Morris JPt, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC. 2004. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306:269–271. Wiltshire RN, Herndon JE, 2nd, Lloyd A, Friedman HS, Bigner DD, Bigner SH, McLendon RE. 2004. Comparative genomic hybridization analysis of astrocytomas: Prognostic and diagnostic implications. J Mol Diagn 6:166–179. Ye BH, Cattoretti G, Shen Q, Zhang J, Hawe N, de Waard R, Leung C, Nouri-Shirazi M, Orazi A, Chaganti RS, Rothman P, Stall AM, Pandolfi PP, Dalla-Favera R. 1997. The BCL-6 proto-oncogene controls germinalcentre formation and Th2-type inflammation. Nat Genet 16:161–170. Ye F, Chen Y, Hoang T, Montgomery RL, Zhao XH, Bu H, Hu T, Taketo MM, van Es JH, Clevers H, Hsieh J, Bassel-Duby R, Olson EN, Lu QR. 2009. HDAC1 and HDAC2 regulate oligodendrocyte differentiation by disrupting the beta-catenin-TCF interaction. Nat Neurosci 12:829–838. Zhou YX, Armstrong RC. 2007. Interaction of fibroblast growth factor 2 (FGF2) and notch signaling components in inhibition of oligodendrocyte progenitor (OP) differentiation. Neurosci Lett 421:27–32. Zhou YX, Flint NC, Murtie JC, Le TQ, Armstrong RC. 2006. Retroviral lineage analysis of fibroblast growth factor receptor signaling in FGF2 inhibition of oligodendrocyte progenitor differentiation. Glia 54:578–590. Zolova OE, Wight PA. 2011. YY1 negatively regulates mouse myelin proteolipid protein (Plp1) gene expression in oligodendroglial cells. ASN Neuro 3:e00067.