Lutzomyia pseudolongipalpis - Oxford Journals

2 downloads 0 Views 2MB Size Report
La Rinconada, Curarigua, Lara State, Venezuela. JAZZMIN C. ARRIVILLAGA1 ..... 981037 and by the Venezuelan Government–World Bank through the Control ...

ARTICLE

Lutzomyia pseudolongipalpis: The First New Species Within the longipalpis (Diptera: Psychodidae: Phlebotominae) Complex from La Rinconada, Curarigua, Lara State, Venezuela JAZZMIN C. ARRIVILLAGA1

AND

M. DORA FELICIANGELI

Centro Nacional de Referencia de Flebotomos (CNRFV), Seccio´ n Entomologõ´a Medica, BIOMED, Universidad de Carabobo, Facultad de Ciencias de la Salud, Nucleo Aragua, Maracay, Edo. Aragua, Venezuela, Apdo. 4873

J. Med. Entomol. 38(6): 783Ð790 (2001)

ABSTRACT Lutzomyia pseudolongipalpis, the Þrst new sand ßy species within the longipalpis complex, is described based on females and males from La Rinconada, Curarigua, Lara State, Venezuela. Similar to Lutzomyia longipalpis sensu lato, females of the new species show spermathecae with 8 Ð10 annulations and cibarial armature with 8 Ð12 horizontal teeth. However, L. pseudolongipalpis females show conspicuous vertical cibarial teeth, large stipites and wing vein sections, round cerci, and short and broad valvifers that separate them from L. longipalpis s. l. females. L. pseudolongipalpis and L. longipalpis s. l. males are isomorphic, both having parameres with two curved setae on a simple tubercle. The analysis of morphometric characters and their diagnostic value is in progress. KEY WORDS Lutzomyia (Lutzomyia) pseudolongipalpis n. sp., Lutzomyia longipalpis, phlebotominae, sand ßies, species complex

THE PHLEBOTOMINE SANDFLY species Lutzomyia longipalpis (Lutz & Neiva, 1912) is the principal vector of the American visceral leishmaniasis (AVL). However, there is mounting evidence that this species represents a species complex of two or more taxa (Young and Duncan 1994), based on morphological differences (males with pale spot on the tergites third and fourth versus those with only one pale spot on tergum fourth) (Mangabeira 1969), crossbreeding experiments (Ward 1986, Ward et al. 1988, Lanzaro et al. 1993), pheromones (Ward et al. 1988, 1991; Hamilton et al. 1996a, 1996b, 1996c), and genetic data (Lanzaro et al. 1993; Mutebi et al. 1998; Lampo et al. 1999; Arrivillaga et al. 2000a, 2000b). For these reasons, we consider that, at the moment, it seems consistent to refer to this species as L. longipalpis sensu lato. In Venezuela, signiÞcant divergence between a population of “Lu. Longipalpis” from the endemic focus of AVL at La Rinconada, Curarigua, Lara (Venezuela) and populations from Central America (Honduras), Colombia (El Aguila), and Brazil (Jacobina, Lapinha, Sobral) was detected by RAPD-polymerase chain reaction (PCR) by Arrivillaga et al. (1995) and Arrivillaga (1999) using six random primers that indicated low genetic similarity (Jaccard index ⫽ 0.61). Isozyme analysis indicated genetic structuring with large genetic distances (NeiÕs distance ⫽ 0.67) and low gene ßow (Fst ⫽ 0.798, Nm ⫽ 0.06) between the population from La Rinconada, Curarigua/Lara State, and three other Venezuelan populations (Guayabita/ Aragua, El Pao/Cojedes, and Batatillo/Trujillo). Two 1

E-mail: [email protected]

putative species could be distinguished readily using HK, AK, and MDH-2 as diagnostic enzymes and GPI and ME as quasi-diagnostic markers (Arrivillaga 1999; Arrivillaga et al. 2000a, 2000b). Both species are sympatric in El Paso, a hamlet close to La Rinconada (Lampo et al. 1999). Based on mtDNA (citocrome oxidase c unit 1), phylogenetic analyses of eight Venezuelan populations from Aragua, Lara (El Paso/Curarigua), Trujillo, Yaracuy, Cojedes, Guarico, and Nueva Esparta (Margarita Island) conÞrmed the existence of two separate monophyletic lineages (Arrivillaga et al. 1999b). Further comparisons with non-Venezuelan populations using mtDNA and isozymes supported the existence of four distinct taxa, which have not been described formally (J.C.A. and G. C. Lanzaro, unpublished data). Currently, only the taxon from La Rinconada, Lara state, Venezuela, can be clearly separated based on morphological characters of the fourth larval instar (Arrivillaga et al. 1999, 2000b; Arrivillaga and Feliciangeli 2000) and adult females (this article) and a distinct genetic proÞle (Arrivilaga et al. 2000b). The other three species, from Central America, ColombiaÐ Venezuela and Brazil, are at the moment considered as morphospecies (Lanzaro et al. 1993, Arrivillaga 1999). In the current article we name Lutzomyia pseudolongipalpis from La Rinconada, Curarigua (69⬚ 56⬘ 12.92⬙ N, 9⬚ 58⬘ 50.4⬙ W, 680 m asl), as a new species and provide a full description of the female and male, based on reference standard for measurements and nomenclature proposed by the CIPA group (1991) and on new morphological characters. The specimens

0022-2585/01/0783Ð0790$02.00/0 䉷 2001 Entomological Society of America

784

JOURNAL OF MEDICAL ENTOMOLOGY

Table 1.

Vol. 38, no. 6

Morphometric measurements for Lutzomyia pseudolongipalpis female and male paratypes Females (n ⫽ 30)

Head length Frontal length Width of head Labrum-epipharynx Clypeus length Inter ocular distance Flagellomere I Flagellomere II Cibarial armature length Cibarial arch length Cibarial armature width Cibarial arch width Pharynx length Palpomere 1 Palpomere 2 Palpomere 3 Palpomere 4 Palpomere 5 Lateral lobe Piston Genital pump Genital Þlaments Style Paramere Wing length Wing width ␣ ␤ ␥ ␦ ⑀ R5 Fore femur Midfemur Hind femur Fore tibia Mid tibia Hind tibia Fore tarsomere Mid tarsomere Hind tarsomere

Males (n ⫽ 30)

Mean ⫾ SD (␮m)

Min. Max (␮m)

Mean ⫾ SD (␮m)

Min. Max (␮m)

458.6 ⫾ 66.8 284.4 ⫾ 23.1 388.0 ⫾ 54.8 299.1 ⫾ 13.5 164.6 ⫾ 19.0 125.4 ⫾ 7.8 262.6 ⫾ 47.0 117.1 ⫾ 7.1 47.0 ⫾ 31.3 188.1 ⫾ 11.9 105.8 ⫾ 19.6 121.5 ⫾ 7.8 219.5 ⫾ 50.9 58.8 ⫾ 0.4 162.5 ⫾ 9.2 188.8 ⫾ 8.8 158.6 ⫾ 9.9 356.2 ⫾ 55.8 NA NA NA NA NA NA 1821.6 ⫾ 93.4 258.0 ⫾ 62.2 479.7 ⫾ 43.0 319.0 ⫾ 30.7 400.5 ⫾ 35.6 43.5 ⫾ 9.1 627.3 ⫾ 36.9 1508.5 ⫾ 76.2 794.5 ⫾ 48.5 819.6 ⫾ 51.3 897.0 ⫾ 55.1 782.5 ⫾ 3.5 1017.5 ⫾ 115.2 1330.6 ⫾ 116.6 465.5 ⫾ 196.2 624.0 ⫾ 197.5 785.0 ⫾ 248.2

403.7Ð509.6 264.5Ð316 352.8Ð431.2 26.07Ð334.1 137.2Ð176.4 113.6Ð137.2 235.2Ð337.1 110.6Ð124.4 27.4Ð50.9 164.6Ð215.1 90.1Ð117.6 98.0Ð129.3 188.1Ð235.2 58.3Ð59.2 147.8Ð169.8 175.0Ð197.5 140.0Ð177.7 272.3Ð409.5 NA NA NA NA NA NA 1712.7Ð2024.1 498.2Ð700.6 430.5Ð553.5 270.6Ð369 346.0Ð439.6 37.0Ð52.8 553.5Ð738.0 1372.0Ð1601.0 738.2Ð879.2 748.8Ð899.9 936.0Ð973.4 764.4Ð894.9 96.7Ð1083.3 1232.4Ð1419.6 452.4Ð533.8 514.9Ð659.4 670.8Ð832.1

415.5 ⫾ 15.6 279.4 ⫾ 11.7 372.4 ⫾ 23.5 250.8 ⫾ 19.6 143.1 ⫾ 3.9 105.8 ⫾ 15.6 321.4 ⫾ 31.3 141.1 ⫾ 3.9 NA NA NA NA NA 43.1 ⫾ 3.9 133.2 ⫾ 11.7 164.6 ⫾ 15.6 148.9 ⫾ 23.5 356.7 ⫾ 47.0 392.0 ⫾ 15.6 113.6 ⫾ 11.7 154.4 ⫾ 9.6 476.4 ⫾ 53.9 215.6 ⫾ 39.2 145.0 ⫾ 11.7 1759.4 ⫾ 155.7 591.6 ⫾ 11.7 418.2 ⫾ 49.2 295.2 ⫾ 27.4 380.0 ⫾ 8.6 37.5 ⫾ 17.6 584.0 ⫾ 30.7 1497.8 ⫾ 68.1 819.8 ⫾ 41.8 826.8 ⫾ 42.7 967.3 ⫾ 40.4 963.2 ⫾ 54.5 1242.6 ⫾ 70.1 1579.5 ⫾ 39.0 546.0 ⫾ 0.3 640.4 ⫾ 65.0 781.25 ⫾ 2.5

380.2Ð450.8 254.8Ð286.1 364.5Ð399.8 254.8Ð316.6 137.2Ð148.9 105.8Ð137.2 286.1Ð431. 137.0Ð147.9 NA NA NA NA NA 39.2Ð47.0 121.5Ð148.9 141.1Ð184.2 121.5Ð176.4 254.8Ð392.0 352.8Ð431.2 98.0Ð125.4 147.8Ð166.6 427.9Ð544.6 176.4Ð235.2 133.2Ð152.8 1575.3Ð2024.1 513.8Ð560.5 246.0Ð522.7 276.7Ð393.6 358.8Ð390.0 25.0Ð54.7 522.7Ð645.7 1375.0Ð1560.0 780.0Ð863.6 780.0Ð866.8 926.3Ð1014.0 926.3Ð1045.0 1147.0Ð1279.2 1397.3Ð1614.4 514.8Ð561.6 655.2Ð702.0 764.4Ð785.0

NA, not applicable.

were collected by CDC traps and preserved in 70% ethyl alcohol. Females were dissected and clariÞed using two solutions. The head and thorax were clariÞed in 10% KOH for 24 h, because clariÞcation in NesbittÕs solution does not allow observation of the vertical cibarial teeth. The abdomen was clariÞed in NesbittÕs solution for 24 h. Males were dissected and clariÞed in cool 10% KOH for 24 h. The mounted specimens were observed with the aid of a compound phase contrast microscope and the measurements were performed using 10⫻ oculars and different objectives (head: 25 and 40⫻, wing: 6 and 10⫻, genitalia: 25 and 40⫻, legs: 10⫻). Measurements are given in micra for types and paratypes in Table 1 and the following descriptions. Lutzomyia pseudolongipalpis n. sp. Lutzomyia longipalpis: Hamilton & Ward, 1991: 285 (pheromones). Lutzomyia longipalpis: Fausto et al. 1995: 339 (spermatozoon).

Lutzomyia longipalpis: Mazzarri et al. 1997: 335 (susceptibility to insecticides). Lutzomyia longipalpis: Fausto et al. 1998: 71 (larval spiracular system) Lutzomyia longipalpis: Lampo et al. 1999: 1004 (isozymes) Lutzomyia longipalpis: Arrivillaga et al. 2000a: 325 (isozymes) Lutzomyia longipalpis: Arrivillaga et al. 2000b: 171 (larval mouthparts morphometry and genetic proÞle) Lutzomyia longipalpis species A: Arrivillaga and Feliciangeli 2000: 229 (larval mouthparts morphology). Lutzomyia longipalpis: Ma´rquez et al. 2001: 12 (gene ßow). Holotype (乆) Slide 2.5.5.2ÐCNRFV (Fig. 1). Whole insect pigmented. Head. Height from vertex to clypeus 270.48; head width 431.80, clypeus length 163.99. The clypeus does show a ßat lateral proÞle and squared front edge.

November 2001

ARRIVILLAGA AND FELICIANGELI: NEW SPECIES WITHIN Longipalpis COMPLEX

785

Fig. 1. Lutzomyia pseudolongipalpis female. (A) Head. (B) Flagellomere II. (C) Cibarial armature. (D) Spermathecae. (E) Wing.

Eyes large, separated by 117.6 inter ocular distance or by distance ⫽ to 8.20 facet diameters. Pharynx unarmed, 207 long, with posterior ridges. Cibarial armature with eight sharp horizontal teeth and one transverse row of 9 Ð10 pronounced rounded verti-

cal teeth, with the middle 6 Ð7 vertical teeth conspicuous. Distance from cibarial armature to the cibarial arch 23.92, labrum 313.6 long, maxillary cranial stipites 333.2 long. Length of palpomeres: 1 (58.8), 2 (160.72), 3 (184.24), 4 (145.04), 5 (203.84).

786

JOURNAL OF MEDICAL ENTOMOLOGY

Vol. 38, no. 6

Fig. 2. Lutzomyia pseudolongipalpis male. (A) Head. (B) Flagellomere II. (C) Genital pump and Þlaments. (D) Genitalia. (E) Wing.

November 2001

ARRIVILLAGA AND FELICIANGELI: NEW SPECIES WITHIN Longipalpis COMPLEX

Fig. 3. Vertical cibarial teeth. (A) Lutzomyia pseudolongipalpis. (B) Lutzomyia longipalpis sensu lato.

Palpal formula: 1.4.2.3.5. Palpal sensilla present. Flagellomere I, 262.64 long, II ⫹ III ⫽ 239.12 long. Antennal ascoids with barely discernible and rudimentary proximal spurs, distally reaching the next segment; FI/L ⫽ 0.81. Thorax. Pronotum, prescutum, scutum, and postscutellum well pigmented; katepisternum, anepimeron, katepimeron, and coxa lightly pigmented. Pleura with 18 upper and four lower episternal setae. Wings relatively narrow: ␣ ⫽ 448.5, ␤ ⫽ 307.5, ␥ ⫽ 362.85, ␦ ⫽ 92.25, ␧ ⫽ 615; ratio R5/wing width ⫽ 0.42. Abdomen. Spermathecae with 8 Ð10 complete annulations, slender individual sperm ducts 287.92 long, cerci rounded 117.6 long; short and broad valvifers. Allotype (么) Slide 2.5.5.1-CNRFV (Fig. 2). Coloration as in female. Head. Height from vertex to clypeus 380.24; head width 394.84, clypeus 152.88 long, showing ßat (no convex) lateral proÞle and squared front edge. Eyes large, separated by 78.4 or by distance ⫽ to 3.64 facet diameters. Pharynx long, with posterior ridges. Cibarium unarmed. Labrum 274.4 long, maxillary cranial stipites 313.6 long. Length of palpomeres: 1 (47.04), 2 (152.88), 3 (196), 4 (156.8), 5 (321.44). Palpal formula: 1.2.4.3.5. Palpal sensilla present. Flagellomere I 344.96 long, II ⫹ III ⫽ 305.76 long, antennal

787

Fig. 4. Cerci (female genitalia). (A) Lutzomyia pseudolongipalpis. (B) Lutzomyia longipalpis sensu lato.

ascoids with barely discernible and rudimentary proximal spurs, distally not reaching the Þnal segment part; FI/L ⫽ 1.25. Thorax. Pleura with 19 upper and two lower episternal setae. Wings relatively narrow: ␣ ⫽ 430.5, ␤ ⫽ 338.25, ␥ ⫽ 553.5, ␦ ⫽ 67.85; ␧ ⫽ .602.7, R5/wing width ⫽ 0.45. Abdomen. A pair of spots only on tergum 4. Genitalia. Coxite 392 long, bearing a basal tuft of four relatively slender and long setae. Style 176.4 long, with four isolated spines and a subterminal bristle. Paramere with two dorsal curved setae inserted directly on it, long. Lateral lobe 376.32 long, lateral lobe/coxite ⫽ 0.96; lateral lobe/paramere ⫽ 2.4. Aedeagus simple, straight. Genital pump (GP) 152.88 long; genital piston 125.44 long; genital Þlaments (GF) 392 long; GP/GF ⫽ 0.39. Material Examined. Holotype female (slide 2.5.5.2CNRFV): La Rinconada, Curarigua, Lara State, Venezuela, CDC trap, 07Ð 04 Ð2000, collectors: Arrivillaga JC & Arias F; allotype male (slide 2.5.5.1- CNRFV), La Rinconada, Curarigua, Lara State, Venezuela, CDC trap, 07Ð 04 Ð2000, collectors Arrivillaga JC, Arias F and Mendez C; paratypes: 30 females (2.5.5.2Ð1Ð2.5.5.2.Ð31 FP-CNRFV), and 30 males (2.5.5.1Ð2Ð2.5.5.1Ð31 MPCNRFV), La Rinconada, Lara State, Venezuela, CDC trap, 25Ð 03Ð2000, collectors: Arrivillaga JC & Arias F. All types are deposited at the Centro Nacional de

788

JOURNAL OF MEDICAL ENTOMOLOGY

Fig.5. Valvifer(femalegenitalia).(A) Lutzomyiapseudolongipalpi. (B) Lutzomyia longipalpis sensu lato.

Referencia de Flebo´ tomos de Venezuela (CNRFV), BIOMED, Universidad de Carabobo, Nu´ cleo Aragua, Maracay, Venezuela. Morphological Remarks. We designate the female as holotype, because L. pseudolongipalpis females can be distinguished morphologically from L. longipalpis s. l. by the following characters: one row of seven large, conspicuous vertical cibarial teeth (Fig. 3A), ßat (not convex) lateral proÞle of the clypeus, relatively narrow wing (Fig. 1), round cerci (Fig. 4A) and broad valvifers (Fig. 5A). In L. longipalpis s. l. Venezuelan (Isla de Margarita, Cojedes, Trujillo, Guarico, Ara-

Fig. 6. Guillaumin proÞle between L. pseudolongipalpis and L. longipalpis sensu lato from Venezuela. Head length (LC), head width (AC), interocular distance (DIO), labrumepipharynx (LEP), ßagellomere I (FIII), wing length (LA), wing width (AA), alpha (V1), beta (V2), gamma (V3), style (EST), lobule (Lob), and genital piston (PG).

Vol. 38, no. 6

gua), Brazilian, Colombian, and Central American populations, these characters were always distinct as shown in Fig. 3B-5B. We also compared the morphological characters of L. pseudolongipalpis with published descriptions of Brazilian populations of L. longipalpis as given by Forattini (1973) and Azevedo et al. (2000). Forattini described the vertical teeth of the cibarium as small and inconspicuous as seen in all longipalpis Venezuelan, Brazilian, Colombian and Central American populations. Azevedo et al. (2000) did not refer to their shape or size, and only give the number observed (10 Ð17). Therefore, we assumed that in the Þve Brazilian populations, they should be small and similar to those described by Forattini (1973). Cerci and valvifers of L. pseudolongipalpis are always rounded and broader in comparison with the L. longipalpis Venezuelan populations studied and nonVenezuelan samples (not reported here). Unfortunately, Brazilian authors did not give a description and size of these structures. Palpal formula in L. pseudolongipalpis females was consistently 1.4.2.3.5, whereas in males the formula was 1.2.4.3.5. Forattini (1973) gave formulas of 1.4.2.3.5 and 1.4.(2.3).5, and Azevedo et al. (2000) reported that P2 and P4 may be subequal in length, but shorter than P3. L. pseudolongipalpis adults have large wings, with a vein size formula of: epsilon ⬎ alpha ⬎ gamma ⬎ beta ⬎⬎ delta (Table 1) and ßat clypeus in comparison with L. longipalpis s. l. from Venezuela. Using morphological characters, males of these two taxa are isomorphic. However, there are morphometric characters that might be useful in distinguishing L. pseudolongipalpis from L. longipalpis s. l. from Venezuela. Preliminary univariate analysis using Guillaumin proÞles (Fig. 6) showed 10 potential markers in L. pseudolongipalpis. The labrum-epipharynx, ßagellomere I, wing veins (␣,␤,␦), whole genitalia, pump piston, style, and lobule are larger than in L. longipalpis s. l., except the interocular distance, which is shorter. Multivariate principal component and discriminate analyses are in progress. However, it is necessary to take away the allometric and isometric inßuence of size to weight the taxonomic signiÞcance and diagnostic value of the size of these morphometric characters. Geographical Distribution. The geographical distribution of L. pseudolongipalpis currently is restricted to La Rinconada and El Paso, two localities close to Curarigua (9⬚ 59⬘ N, 69⬚ 55⬘ W), between the Þnal Andean Cordillera and the Coriano System, Lara State, Venezuela. Medical Importance. In 1989, two cases of AVL were reported from La Rinconada, Curarigua (Lara state). Further reports include: three cases in 1993 (one from La Rinconada and two from Curarigua capital), two cases in 1998 and two cases in 1999, all from Curarigua (Files of the Unidad de Informa´tica, Instituto de Biomedicina, Caracas). No cases have been reported from El Paso (17 km from Curarigua), the locality where L. longipalpis and L. pseudolongipalpis co-exist. During a longitudinal study from June 1997 to June 1998, 18,076 females were screened for Leishmania spp. by dissection and PCR ampliÞcation

November 2001

ARRIVILLAGA AND FELICIANGELI: NEW SPECIES WITHIN Longipalpis COMPLEX

789

Fig. 7. Diagnostic isozyme Mdh-2 used to distinguish L. pseudolongipalpis (Curarigua and El Paso localities) from Venezuelan L. longipalpis sensu lato (Trujillo & Cojedes).

of pools. Among 10,026 L. pseudolongipalpis dissected, one contained suprapyloric promastigotes. Although no Leishmania identiÞcation was achieved at that moment, the putative vector of AVL in La Rinconada is L. pseudolongipalpis that comprised 99.8% of phlebotomine sand ßies collected (Feliciangeli 1999). Pheromone Data. The principal component produced in L. pseudolongipalpis (⫽L. longipalpis from La Rinconada, Curarigua) is 9-methyl-himachalene (Hamilton and Ward 1991). Isozyme Data. L. pseudolongipalpis is identiÞed by three diagnostic markers: HK85, AK111, and MDH-2B; GPI34 (Fig. 7) is quasi-diagnostic (Arrivillaga et al. 2000a; J.C.A. and G. C. Lanzaro, unpublished data). Molecular Data. COI Region. The mtDNA fragment ampliÞed is the 560-bp product, which has a sequence and SSCP proÞle (four haplotypes) that are diagnostic and useful to separate this new species from Lutzomyia longipalpis sensu lato (J.C.A. and G. C. Lanzaro, unpublished data). ADN Non-LTR Retrotransposon. Type 2 (Wright 1998, Accession AJ006936). This partial fragment was ampliÞed, but it did not appear to be useful in the molecular taxonomy of species in the L. longipalpis complex 1 gtgttttcca aaatcttcga aaaagttctg aagtctagac ttgaaaattt tctaaatagt 61 attaatttct ttagtggtaa ccaatatggt ttcacccccg gtcgtagcac tgaagatgct 121 ttgatcactt ttgttaatca tgttagtctc gcggcgaataatggtaaatg cgtttcagcc 181 gtgtttctgg atttaacgaa agcgtttgac actgtc Larval Morphology Data. L. pseudolongipalpis can be distinguished by a mentum with the median pair of teeth (MVD1) short and rounded, maxillae with a lateral comb (MxC) with 9 Ð14 spines, and mandibles with three broad ventral teeth (MdVD) and a less developed lobule (MdL), (Arrivillaga et al. 1999, 2000b; Arrivillaga and Feliciangeli 2000). Bionomics. The life zone occupied by L. pseudolongipalpis is tropical dry forest, with a 5-months dry season (JanuaryÐMay), annual mean temperature of 24⬚C, and annual precipitation of 500 mm (Ewel and

Madriz 1968). Field data showed that in this habitat L. pseudolongipalpis is present throughout the year and it is strikingly more abundant (up to 400 times) than island and continental populations of L. longipalpis s. l. in Venezuela (M.D.F. et al., unpublished data). A study on the natural blood meal sources of L. pseudolongipalpis, as detected by dot-enzyme immunoassay, indicated that this species feeds frequently on dogs (Agrela et al. 1999). A laboratory colony of L. pseudolongipalpis was started in 1991 with 420 females caught by CDC traps at La Rinconada and fed on golden hamsters. It is maintained at the Centro Nacional de Referencia de Flebo´ tomos, BIOMED, University of Carabobo (23 ⫾ 2⬚C, 80 Ð 85% RH) following the rearing procedures of Killick-Kendrick et al. (1973) with some modiÞcations. In 10 yr, 68 generations have been produced. The average generation time has been 55 d and the average production has been ⬇3,000 adults per generation. The mean fecundity for 60 individual females was 21.6 eggs/female and the average fertility (fertile eggs/total laid eggs) was 80%. Comparative studies with populations of L. longipalpis s. l. from other Venezuelan foci of cutaneous and visceral leishmaniasis are in progress (unpublished data) as well as comparative vector competence studies (unpublished data). Acknowledgments We thank Juan-Carlos Navarro (Universidad Central de Venezuela) for the fruitful discussions and comments on the manuscript; Freddy Arias, Carlos Mendez, Arturo Bravo, and Maria Martinez (Centro Nacional de Referencia en Taxonomõ´a de Flebotomos) for the technical assistance, and Jonathan Liria for the drawings. This research was supported by a fellowship grant for J.C.A. from TDR-WHO project ID No. 981037 and by the Venezuelan GovernmentÐWorld Bank through the Control Program of Endemic Diseases (PCEE Project No. VEN96-002-006).

References Cited Agrela, I., E. Sanchez, B. Gomez, and M. D. Feliciangeli. 1999. Feeding behaviour of phlebotomine sandßies

790

JOURNAL OF MEDICAL ENTOMOLOGY

(Diptera: Psychodidae) involved in the transmission of leishmaniasis in Venezuela. International Symposium on Phlebotomine Sandßies (ISOPSIII), 23Ð27 August, Montpellier, France. Arrivillaga, J. C. 1999. Estudio Morfogenetico de Lutzomyia longipalpis in Venezuela. MSc. Thesis, Universidad Central de Venezuela, Facultad de Agronomia, Postgrado Entomologõ´a Salud Publica, Maracay. Arrivillaga, J. C., and M. D. Feliciangeli. 2000. Diferenciacio´ n morfolo´ gica larval entre poblaciones de Lutzomyia longipalpis (Lutz & Neiva 1912) de Venezuela (Diptera: Psychodidae. Bol. Entomol. Venez. 15(2): 229 Ð234. Arrivillaga, J. C., J. G. Hamilton, R. D. Ward, and R. Maingon. 1995. RAPD- PCR to distinguished between sandßy populations (Lutzomyia longipalpis), p. 32. In Trypanosomiasis and Leishmaniasis. Proceedings of the Seminar at the Meeting of British Society for Parasitology, 3Ð 6 September, University of Glasgow, Glasgow, UK. Arrivillaga, J. C., J. C. Navarro, and M. D. Feliciangeli. 1999a. Morfologia y quetotaxia del tagma cefalico de Lutzomyia (Diptera: Psychodidae). Bol. Entomol. Venez. 14(1): 1Ð12. Arrivillaga, J. C., Y. Rangel, M. D. Feliciangeli, and G. Lanzaro. 1999b. Morphogenetics studies of Lutzomyia longipalpis (Psychodidae: Phlebotominae). J. Am. Mosq. Control Assoc 15: 410 Ð 411. Arrivillaga, J. C., Y. Rangel, M. Oviedo, and M. D. Feliciangeli. 2000a. Genetic Divergence among Venezuelan populations of Lutzomyia longipalpis (Dipteras: Psychodidae: Phlebotominae). J. Med. Entomol. 37: 325Ð330. Arrivillaga, J. C., Y. Rangel, M. Oviedo, and M. D. Feliciangeli. 2000b. Correlated morphological and genetic diversity among Lutzomyia longipalpis (Diptera: Psychodidae) collections in Venezuela.J. Am. Mosq. Control Asocc. 16: 171Ð174. Azevedo, A. C., F. A. Monteiro, P. H. Cabello, N. A. Souza, M. G. Rosa- Freitas, and E. R. Rangel. 2000. Studies on populations of Lutzomyia longipalpis (Lutz & Neiva 1912) (Diptera: Psychodidae: Phlebotominae) in Brazil. Mem Inst Oswaldo Cruz. 95: 305Ð322. CIPA Group [H. Bermudez (Bolivia), J. P. Dedet (Bolivia), A. L. Falcao (Brasil), M. D. Feliciangeli (Venezuela), E. Ferreira Rangel (Brasil), C. Ferro (Colombia), E.A.B. Galati (Brasil), E. L. Gomez (Ecuador), M. V. Herrero (Costa Rica), D. Hervas (Bolivia), J. Lebbe (France), A. Morales (Colombia), E. Ogusuku (Peru´ ), E. Perez (Peru´ ), I. Sherlock (Brasil), M. Torrez (Bolivia), R. Vignes (France), and M. Wolff (Colombia)]. 1991. Proposition for a standard description for phlebotomine sandßies. Parassitologia 33(suppl. 1): 127Ð135. Ewel, J. J., and A. Madriz. 1968. Zonas de vida de Venezuela. Memoria explicativa sobre el mapa ecolo´ gico. Editorial Sucre, Caracas. Fausto, A. M., M. Mazzini, M. Maroli, and M. D. Feliciangeli. 1995. Spermatozoon of the sandßy Lutzomyia longipalpis (Lutz & Neiva) (Diptera: Psychodidae). Boll. Zool., 62: 339 Ð343. Fausto, A. M., M. D. Feliciangeli, M. Mazzini, and M. Maroli. 1998. Morphological study on the larval spiracular system in eight Lutzomyia species (Diptera: Psychodidae). Mem. Inst. Oswaldo Cruz 93: 71Ð79. Feliciangeli, M. D. 1999. Estudio integral de focos de leishmaniasis en Venezuela: Los vectores. Informe te´ cnico del proyecto PCEE-VEN 96 Ð 002Ð 006 (Convenio Gobierno de Venezuela-World Bank). Forattini, O. P. 1973. Entomologõ´a me´ dica, vol. 4. Edgar Blucher and Universidade de Sao Paulo.

Vol. 38, no. 6

Hamilton, J. H., and R. D. Ward. 1991. Gas chromatographic of Lutzomyia longipalpis tergal pheromone gland. Parassitologia 33: 283Ð289. Hamilton, J.G.C., G. W. Dawson, and J. A. Pickett. 1996a. 9-methylgermacrene-B; proposed structure for novel homosesquiterpene from the sex pheromone glands of Lutzomyia longipalpis (Diptera: Psychodidae) from Lapinha, Brazil. J. Chem. Ecol. 22: 1477Ð1491. Hamilton, J.G.C., G. W. Dawson, and J. A. Pickett. 1996b. 3-methyl-himachalene: proposed structure for novel homosesquiterpene sex pheromone of Lutzomyia longipalpis (Diptera: Psychodidae) from Jacobina, Brazil. J. Chem. Ecol. 22: 2331Ð2340. Hamilton, J.G.C., R. D. Ward, M. J. Dougherty, R. Maingon, C. Ponce, E. Ponce, H. Noyes, and R. Zeledon. 1996c. Comparison of the sex-pheromone components of Lutzomyia longipalpis from areas of visceral and atypical cutaneous leishmaniasis in Honduras and Costa Rica. Ann. Trop. Med. Parasitol. 90: 533Ð541. Killick-Kendrick, R., A. L. Leaney, and P. D. Ready. 1973. The establishment, maintenance and productivity of a laboratory colony of Lutzomyia longipalpis (Diptera: Psychodidae). J. Med. Entomol. 13: 429 Ð 440. Lampo, M., D. Torgerson, L. M. Marquez, M. Rinaldi, C. Z. Garcia, and A. Arab. 1999. Occurence of sibling species of Lutzomyia longipalpis (Diptera: Psychodidae) in Venezuela: Þrst evidence from reproductively oslated sympatric populations. Am. J. Trop. Med. Hyg. 61: 1004 Ð1009. Lanzaro, G. C., K. Ostrovska, M. Herrero, P. G. Lawyer, and A. Warburg. 1993. Lutzomyia longipalpis is a species complex: Genetic divergence and interspeciÞc hybrid sterility among three populations. Am. Trop. Med. Hyg. 48: 839 Ð 847. Mangabeira, O. 1969. Sobre a sistematica e biologia dos Phlebotomus do Ceara. Rev. Bras. Malar. Doenc. Trop. 21: 3Ð26. Ma´ rquez, L. M., M. Lampo, M. Rinaldi, and P. Lau. 2001. Gene ßow natural and domestic populations of Lutzomyia longipalpis (Diptera: Psychodidae) in a restricted focus of American visceral leishmaniasis in Venezuela. J. Med. Entomol. 38: 12Ð16. Mazzarri, M. B., M. D. Feliciangeli, M. Maroli, A. Hernandez, and A. Bravo. 1997. Susceptibility of Lutzomyia longipalpis (Diptera: Psychodidae) to selected insecticides in a endemic focus of visceral leishmaniasis in Venezuela. J. Am. Mosq. Control Assoc. 13: 335Ð341. Mutebi, J.-P., E. Rowton, M. Herrero, C. Ponce, A. Belli, S. Valle, and G. Lanzaro. 1998. Genetic variability among populations of the sandßy Lutzomyia (Lutzomyia) longipalpis (Diptera: Psychodidae) from Central America. J. Med. Entomol. 35: 169 Ð174. Ward, R. D. 1986. Genetic diversity in Phlebotominae sandßies (Diptera: Psychodidae). IMEEE, Montpellier. Ward, R. D., A. Phillips, B. Burnet, and C. Marcondes. 1988. The Lutzomyia longipalpis complex reproduction and distribution, pp. 257Ð269. In M. W. Service (ed.), Biosystematics of haematophagous insect. Claredon, Oxford. Wright, C. 1998. Lutzomyia longipalpis (Curangua) NonLtR retrotransposon type 2, partial. In GenBank, submitted direct on 11 June 1998, accessed as AJ0006936. Young, D. M., and M. A. Duncan. 1994. Guide to the identiÞcation and geographic distribution of Lutzomyia sandßies in Mexico, The West Indies, Central and South America (Diptera: Psychodidae) Mem. Am. Entomol. Inst. 54. Associated Publishers, Gainesville, FL. Received for publication 19 September 2000; accepted 11 March 2001.