Correspondence
Mcl-1 gene promoter insertions do not correlate with disease outcome, stage or VH gene mutation status in chronic lymphocytic leukaemia
Leukemia (2005) 19, 871–873. doi:10.1038/sj.leu.2403715 Published online 10 March 2005 TO THE EDITOR
Chronic lymphocytic leukaemia (CLL) is a clinically heterogeneous disease with many patients surviving for years with little or no treatment, while others have a more aggressive disease. In clinical practice, two staging systems are currently widely used (Rai and Binet), but except for these, few good prognostic markers exist that can predict outcome at an early stage of the disease. During recent years, however, the immunoglobulin VH gene mutation status has emerged as an important prognostic factor, since cases displaying mutated VH genes have superior prognosis to unmutated cases.1,2 A characteristic feature of CLL cells is defects in apoptosis, resulting in long-lived neoplastic B cells. High levels of the antiapoptotic protein Mcl-1 has been shown to correlate with disease progression and cytostatic drug resistance in CLL.3–5 Recently, the presence of promoter insertions within the Mcl-1 gene was proposed to influence clinical outcome in CLL.6 Moshynska et al6 reported a 6 nucleotide (nt) (GGCCCC) and an 18 nt (GGCTCAGGCCCCGGCCCC) insertion in the mcl-1 promoter region, which was found to correlate with increased RNA and protein levels in CLL cells. These insertions were found only in CLL cells, but not in healthy controls (n ¼ 17) or in normal tissue from two CLL patients, and the authors concluded that the insertions did not represent insertional polymorphisms. Furthermore, in their cohort of 57 CLL cases, the presence of either insertion was associated with poor overall survival and disease-specific survival for those patients carrying the promoter insertions (17 cases), thus suggesting the potential usage of the mcl-1 promoter insertions as a prognostic factor. To further investigate the clinical significance of the mcl-1 promoter insertions, we analysed a large CLL material as well as healthy age-matched controls, utilizing GeneScan fragment analysis for the detection of the two insertions, and compared this with overall survival and two known predictors of prognosis, for example, VH mutation status and Binet stage. Tumour samples were collected from 173 CLL patients at the University Hospitals of Uppsala, Umea˚ and Stockholm (n ¼ 17), Sweden, between 1981 and 2001. The frozen tumour material was mainly obtained from peripheral blood and bone marrow, but in a few cases also from lymph nodes, spleen and other sources. The median age at diagnosis was 65 years (range, 42– 88 years) and the ratio of men to women approximately 2:1. Overall survival data were available in 165 cases with a median follow-up time of 5.6 years (range o1–23 years). Binet stage data were available in 117 cases: 64 stage A, 32 stage B and 21 stage C. In addition, peripheral blood samples from 105 healthy
Correspondence: Dr G Tobin, Rudbeck Laboratory, Department of Genetics and Pathology, Uppsala University, Uppsala SE-751 85, Sweden; Fax: þ 46184713432; E-mail:
[email protected] 6 These authors contributed equally to this work. Received 11 January 2005; accepted 1 February 2005; Published online 10 March 2005
871
and age-matched controls (median age 66 years, range 52–79 years) were analysed. PCR amplification of the sequence covering the insertion site within the promoter of the mcl-1 gene was carried out on genomic DNA with fluorescent-labelled primers and Platinums Pfx DNA Polymerase (Invitrogen AB, CA, USA), as recommended for GC-rich regions. The primer sequences were as follows: mcl-1 forward, CAGCTTCCGGAGGGTTGCGCAC; and mcl-1 reverse, AGAAGGCCCGAGGTGCTCATGG. The components included in the PCR reaction were: 1 Pfx amplification buffer, 0.3 mM dNTP mix, 1 mM MgSO4, 0.3 mM of each FAM-labelled primer, 1.25 U polymerase and 100 ng DNA. In order to optimise the reaction condition, 0.5 enhancer solution (Invitrogen AB, CA, USA) provided in the polymerase kit was added. The amplification programme comprised of a 2 min denaturing step at 941C followed by 35 cycles of 15 s at 941C, 30 s at 601C and 30 s at 681C. The amplified PCR products were thereafter run on the automated DNA sequencer (ABI 3700, Applied Biosystems, Foster City, CA, USA) and analysed with GeneScan software to distinguish products with no insert (196 bp) and those with inserts (202 or 214 bp). Direct sequencing was performed on various combinations of mcl-1 promoter insertions obtained in 10 cases, all confirming the PCR amplification and GeneScan data. The VH gene mutation was assessed using PCR amplification with consensus VH/JH primers and direct sequencing or subcloning as described previously.7 Sequences were aligned to Ig sequences in the GenBank, V-BASE and IMGT databases; the VH gene was considered mutated when the mutation frequency deviated 42% from the germline VH gene. In the present CLL material, we detected six different mcl-1 allele combinations in the 174 CLL cases investigated; no nucleotide insertion (designated N) on both alleles and various combinations of one (N/6 or N/18) or both alleles containing a 6 or 18 nt (6/6 or 18/18) insertion (Table 1). In total, 61% of cases were found to carry either one or both of the insertions. Furthermore, analysis of over 100 age-matched healthy controls also demonstrated presence of the 6 or 18 nt insertion in 69%. The different combinations of insertions appeared to be distributed similarly in the CLL and control material, where the heterozygous variants (one allele with insert and no inserts in the other allele) dominated in both sets of samples (Table 1). Thus, the frequency of the 6 and 18 nt insertions was found to be considerably higher in this CLL material compared to the reported frequency by Moshynska et al6 (61 vs 40%). This higher frequency in our material may be explained by differences in ethnic background between the two CLL cohorts investigated and/or the relatively small number of cases included in the previous report (n ¼ 57). Importantly, a similarly high frequency of the insertions was detected in our control material, which is in contrast to the Moshynska et al6 study, which did not find the insertions at all in their control material (n ¼ 17) or in normal tissue from two CLL patients. This discrepancy between the two studies are most probably due the low number of controls included in the Moshynska et al report compared to the present study. We therefore believe that the finding of a correspondingly high frequency of the insertions in our CLL cohort as in our control material indicates that these insertions instead represent Leukemia
Correspondence
872 Table 1 Frequency of the mcl-1 promoter insertions in 173 CLL cases and 105 age-matched healthy controls as well as in the VH mutated and unmutated subgroups Mcl-1 allelesa N/N N/6 N/18 6/6 18/18 6/18 Total no.
CLL no.
CLL (%)
Controls no.
Controls (%)
67 25 54 6 6 15
38.7 14.5 31.2 3.5 3.5 8.7
33 25 25 2 7 13
31.4 23.8 23.8 1.9 6.7 12.4
173
Significant difference* NS NS NS NS NS NS
105
Ig VH mutated
Ig VH unmutated
Total no.
34 10 25 3 2 7
32 13 27 3 4 8
66 23 52 6 6 15
81
87
168
Significant difference* NS NS NS NS NS NS
*Significant difference between CLL and control frequency at Po0.05 (Fisher’s exact test). a N ¼ no insert; 6 ¼ 6 nucleotide insertion; 18 ¼ 18 nucleotide insertion; NS ¼ not significant.
Figure 1 Overall survival in the VH mutated (81 cases) and unmutated CLL (87 cases) subgroups in relation to the mcl-1 promoter insertions. The median survival for the VH unmutated and mutated cases was 63 months and 111 months, respectively (log-rank test, Po0.0001). VH mutated cases with or without insertions showed a median survival of 104 and 113 months (log-rank test, P ¼ 0.83), respectively, and VH unmutated cases with or without insertions displayed a median survival of 63 and 62 months, respectively (log-rank test, P ¼ 0.84).
new insertional polymorphisms within the mcl-1 promoter region. The VH gene mutation status was determined in 168 of 173 cases with 87 cases (52%) showing unmutated VH genes and 81 (48%) mutated VH genes. The distribution of allele combinations of the mcl-1 promoter insertions was distributed evenly between the VH mutated and unmutated CLL subgroups (Table 1). Furthermore, the mcl-1 promoter insertions was present in 63% of stage A, 72% of stage B and 76% of stage C cases, where the frequency of the alleles did not differ significantly between the Binet staging groups (P40.05). Overall survival data were available in 165 of our CLL cases and both the VH mutation status (Figure 1) and Binet staging (data not shown) remained good prognostic indicators in this cohort, which is in line with previous CLL reports. Using Kaplan–Meier and log-rank test, the mcl-1 promoter insertions Leukemia
were correlated to overall survival in a number of ways, including the presence or absence of either insertion and individually for the different allele combinations. However, no significant differences in survival was indicated between CLL samples containing either a 6 or 18 nt insertion (n ¼ 63, median survival 83 months) and samples without insertions (n ¼ 102, median survival 86 months) (P ¼ 0.66). The different allele insertions individually (N/6, N/18, 6/6 or 18/18) also gave the same outcome as the samples without insertions (data not shown). Additionally, when including the VH mutation status data or Binet stage data, no difference in survival was found within the VH mutated and unmutated subgroups (Figure 1) or the Binet stage groups (data not shown) with regard to the mcl-1 promoter insertions. Alternatively, combining stages B and C indicated no difference in survival with the mcl-1 promoter insertions. Hence, our data does not support the previous
Correspondence
873 findings regarding the mcl-1 promoter insertions and their clinical relevance in predicting overall survival in our CLL cohort, and we conclude that there is no prognostic value of the mcl-1 promoter insertions in CLL.
Acknowledgements We are grateful to Drs Lars Klareskog and Leonid Padyukov and to the EIRA group for help with the collection of the normal control material. This study was supported by grants from the Swedish Cancer Society, Lion’s Cancer Research Foundation, Uppsala and the research foundation of the Department of Oncology at Uppsala University.
G Tobin1,6 ˚ Skogsberg1,6 A U Thunberg2 A Laurell2 ˚ leskog3 AA M Merup4 C Sundstro¨m1 G Roos5 K Nilsson1 R Rosenquist1
1
Department of Genetics and Pathology, Uppsala University, Uppsala, Sweden; 2 Department of Oncology, Radiology and Clinical Immunology, Uppsala University, Uppsala, Sweden; 3 Department of Medical Sciences, Uppsala University Hospital, Umea˚ University, Sweden; 4 Department of Medicine at Huddinge University Hospital, Umea˚ University, Sweden; and 5 Department of Medical Biosciences, Pathology, Umea˚ University, Sweden
References 1 Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94: 1848–1854. 2 Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood 1999; 94: 1840–1847. 3 Saxena A, Viswanathan S, Moshynska O, Tandon P, Sankaran K, Sheridan DP. Mcl-1 and Bcl-2/Bax ratio are associated with treatment response but not with Rai stage in B-cell chronic lymphocytic leukemia. Am J Hematol 2004; 75: 22–33. 4 Kitada S, Andersen J, Akar S, Zapata JM, Takayama S, Krajewski S et al. Expression of apoptosis-regulating proteins in chronic lymphocytic leukemia: correlations with in vitro and in vivo chemoresponses. Blood 1998; 91: 3379–3389. 5 Johnston JB, Paul JT, Neufeld NJ, Haney N, Kropp DM, Hu X et al. Role of myeloid cell factor-1 (Mcl-1) in chronic lymphocytic leukemia. Leukemia Lymphoma 2004; 45: 2017–2027. 6 Moshynska O, Sankaran K, Pahwa P, Saxena A. Prognostic significance of a short sequence insertion in the MCL-1 promoter in chronic lymphocytic leukemia. J Natl Cancer Inst 2004; 96: 673–682. 7 Tobin G, Thunberg U, Johnson A, Thorn I, Soderberg O, Hultdin M et al. Somatically mutated Ig V(H)3–21 genes characterize a new subset of chronic lymphocytic leukemia. Blood 2002; 99: 2262–2264.
Pathology and clinical features of angioimmunoblastic T-cell lymphoma after successful treatment with thalidomide
Leukemia (2005) 19, 873–875. doi:10.1038/sj.leu.2403710 Published online 3 March 2005 TO THE EDITOR
Angioimmunoblastic T-cell lymphoma (AITL) is a peripheral Tcell lymphoma characterized by generalized lymphadenopathy, hepatosplenomegaly, hypergammaglobulinaemia, skin lesions and B symptoms.1 The clinical outcome of AITL managed by conventional lymphoma protocols remains poor, with a median survival of less than 36 months and a 5-year survival of 30– 35%.2–4 Most of the mortality in AITL is a consequence of profound immune deregulation rather than tumour bulk.1 For this reason, investigators have used immunomodulatory drugs such as cyclosporine5–7 and thalidomide8 with some success in a handful of cases. Here, we report a case of AITL showing a remarkable sustained response to single-agent treatment with thalidomide and describe the distinctive pathological changes in AITL after thalidomide treatment.
Case history A 78-year-old female presented with a 6-month history of generalized lymphadenopathy and 30 kg weight loss. She was wasted and wheelchair bound. Physical examination and computed tomography (CT) imaging showed generalised lymphadenopathy, mild hepatosplenomegaly, ascites and large bilateral pleural effusions (Figure 1). Blood haematology chemistry and bone marrow were normal. She had hypergammaglobulinaemia and two minor monoclonal bands. Lymph node biopsy confirmed AITL. After refusing standard options, she agreed to thalidomide 200 mg daily, which has been maintained for 15 months and well tolerated except for a mild sensory neuropathy. After 4 weeks on thalidomide, she reported a dramatic improvement in her energy and appetite, her weight stabilized, her lymphadenopathy and pleural effusions started to resolve with further clinical resolution by week 8 when a second excisional biopsy of a residual node was performed. Her monoclonal bands and the hypergammaglobulinaemia resolved by 8 months. Her clinical condition is excellent at 18 months when she is noted to have regained weight and is fully selfcaring.
Pathological features Correspondence: Professor A Dogan, Mayo Clinic, 200 First Street SW, Rochester, MN 55905, USA; Fax: þ 1 507 284 1599; E-mail:
[email protected] Received 17 December 2004; accepted 24 January 2005; Published online 3 March 2005
The first biopsy showed typical AITL.1 The lymph node architecture was only partially preserved with only a few atrophic follicle centres (Figure 2). There was a marked proliferation of arborising small vessels and a polymorphic Leukemia
