Minocycline inhibits neuroinflammation and enhances ...

NEURAL REGENERATION RESEARCH Volume 3, Issue 10, October 2008 Cite this article as: Neural Regen Res,2008,3(10),1088-94

www.sjzsyj.com

Basic Medicine

Minocycline inhibits neuroinflammation and enhances vascular endothelial growth factor expression in a cerebral ischemia/reperfusion rat model☆ Zhiyou Cai1, Yong Yan1, Changyin Yu2, Jun Zhang2 1Department of Neurology, the First Affiliated Hospital, Chongqing Medical University, Chongqing Key Laboratory of Neurology, Chongqing 400016, China 2Department of Neurology, the Affiliated Hospital of Zunyi Medical College, Zunyi 563003, Guizhou Province, China

Abstract BACKGROUND: Brain ischemia involves secondary inflammation, which significantly contributes to the outcome of ischemic insults. Vascular endothelial growth factor (VEGF) may play an important role in the vascular response to cerebral ischemia, because ischemia stimulates VEGF expression in the brain, and VEGF promotes formation of new cerebral blood vessels. Minocycline, a tetracycline derivative, protects against cerebral ischemia and reduces inflammation, oxidative stress, and apoptosis. OBJECTIVE: To observe the influence of minocycline on VEGF, interleukin-1 beta (IL-1β), and tumor necrosis factor alpha (TNF-α) expression in Wistar rats with focal cerebral ischemia/reperfusion injury, and to study the neuroprotection mechanism of minocycline against focal cerebral ischemia/reperfusion injury. DESIGN, TIME AND SETTING: Randomized, controlled experiment, which was performed in the Chongqing Key Laboratory of Neurology between March 2007 and March 2008. MATERIALS: A total of 36 female, Wistar rats underwent surgery to insert a thread into the left middle cerebral artery. Animals were randomly divided into sham-operation, minocycline treatment, and ischemia/reperfusion groups, with 12 rats in each group. Minocycline (Huishi Pharmaceutical Limited Company, China) was dissolved to 0.5 g/L in normal saline. METHODS: A 0.5–1.0 cm thread was inserted into rats from the sham-operation group. Rats in the ischemia/reperfusion group underwent ischemia and reperfusion. The minocycline group received minocycline (50 mg/kg) 12 and 24 hours following ischemia and reperfusion, whereas the other groups received saline at the corresponding time points. MAIN OUTCOME MEASURES: mRNA and protein expression of IL-1β and TNF-α was measured by reverse transcriptase-polymerase chain reaction (RT-PCR) and enzyme linked immunosorbent assay (ELISA), respectively. VEGF mRNA and protein expression was examined by RT-PCR, Western blot, and ELISA. RESULTS: Minocycline decreased the focal infarct volume. VEGF, IL-1β, and TNF-αexpression was upregulated in the ischemia-perfusion group after injury. Following minocycline treatment, IL-1β and TNF-α expression was significantly downregulated, and VEGF was significantly upregulated, compared with the ischemia/reperfusion group (all P < 0.01). Expression of VEGF, IL-1β, and TNF-α was greater in the ischemia-perfusion and minocycline treatment groups, compared with sham-operated animals (P < 0.01). CONCLUSION: Minocycline can reduce expression of IL-1β and TNF-α, and increase VEGF expression, in the rat brain following cerebral ischemia/reperfusion. From these findings, a hypothesis can be formed that minocycline attenuates neuroinflammation and enhances recovery of vascular integrity during the process of cerebral ischemia/reperfusion. Key Words: cerebral ischemia/reperfusion; inflammation; minocycline; vascular endothelial growth factor

Received: 2008-06-28;Accepted: 2008-08-18 (15200806250002/GW) Corresponding author: Zhiyou Cai, Studying for doctorate, Attending physician, Department of Neurology, the First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Neurology, Chongqing 400016, China E-mail: [email protected]

1088

Zhiyou Cai☆, Studying for doctorate, Attending physician, Department of Neurology, the First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Neurology, Chongqing 400016, China Cai ZY, Yan Y, Yu CY, Zhang J. Minocycline inhibits neuroinflammation and enhances vascular endothelial growth factor expression in a cerebral ischemia-reperfusion rat model. Neural Regen Res 2008;3(10):1088-94 www.crter.cn www.sjzsyj.com

Cai ZY, et al. / Neural Regeneration Research,2008,3(10):1088-94

INTRODUCTION Various mechanisms of neuronal injury in cerebral ischemia/reperfusion have been proposed. These include formation of free radicals, oxidative stress, mitochondrial dysfunction, inflammatory processes, genetic factors, environmental impact factors, and apoptosis. These factors may interact and amplify each other in a vicious cycle of toxicity, leading to neuronal dysfunction, and finally, cell death. Brain ischemia involves secondary inflammation, which significantly contributes to the outcome after ischemic insults. Because the inflammatory response is a delayed process, the molecules participating in this secondary response are potential targets for clinical therapy. These molecules include cyclooxygenase-2 (COX-2)[1-2], nuclear factor-kappa B (NF- κ B)[3], tumor necrosis factor alpha (TNF- α ) and interleukin 1 beta (IL-1 β ), the latter being a pro-inflammatory cytokine[4-5]. This complex inflammatory response results in the formation of toxic compounds that may contribute to the pathogenesis of cerebral ischemic diseases. Minocycline, a tetracycline derivative, protects against cerebral ischemia and reduces inflammation, oxidative stress, and apoptosis[6-8]. Previously, we demonstrated that minocycline inhibits expression of matrix metalloproteinase 2 (MMP-2) and MMP-9 in rats following cerebral ischemia/reperfusion, and also attenuates cerebral ischemia/reperfusion injury[9]. In the present study, vascular endothelial growth factor (VEGF), IL-1β, and TNF-α expression were analyzed in rat brains following middle cerebral artery occlusion. The rats received minocycline to further analyze the neuroprotective mechanisms of minocycline following cerebral ischemia/reperfusion injury. VEGF and its receptors are critical in the process of angiogenesis[10-11]. The present study addressed the question of whether minocycline could improve VEGF secretion and reduce IL-1β and TNF-α expression in Wistar rats with focal cerebral ischemia/reperfusion injury. In addition, it investigated the neuroprotective mechanisms of minocycline against focal cerebral ischemia/reperfusion injury.

MATERIALS AND METHODS Materials Thirty-six female, Wistar rats, weighing 200–250 g, were provided by the Field Zoology Research Institute of the Third Military Medical University of Chinese PLA. Rats were randomly divided into three groups. Minocycline (100 mg/capsule, Huishi Pharmaceutical Limited Company, China; Batch number: 0501034) was diluted to 0.5 mg/mL in normal saline. The following equipment was used: optical microscope (Chongqing Optical Instrument Factory, China), microphotographic camera (Nikon Company, Japan). This experiment was performed in the Chongqing Key Laboratory of Neurology between March 2007 and March 2008. The experimental animals were handled according to the Care for Laboratory Animals published in 2006[12].

Methods Grouping and drug treatment The precise procedure is shown in Figure 1.

36 rats were randomly divided into 3 groups.

Sham-operation group (n=12)

Insertion of thread, without entering the left middle cerebral artery; equal volume of normal saline by gavage via stomach.

Middle cerebral artery occlusions (MCAO) were established according to previously published methods [13].

Ischemiareperfusion groups (n=12)

Minocycline treatment groups (n=12)

Focal cerebral ischemia was established by inserting a thread into left middle cerebral artery[14- 15]. Animals received equal volume of saline through gavage via stomach. Rats were subdivided into 12-hour and 24-hour groups with 6 rats for each.

Rats received minocycline 50mg/kg/d through gavage via stomach. Minocycline dose was according to published protocols[16-17]. Rats were subdivided into 12-hour and 24-hour groups, with six rats for each time point.

Referring to five scores of Longa [13], rats of more than two scores were selected for analysis.

Figure 1 Flowchart of grouping management and drug application

Morphometric analysis of infarct volume Infarct areas were demarcated by 2, 3, 5-triphenyltetrazolium chloride (TTC) (Sigma) staining. Infarct volumes were calculated by “indirect” morphometric analysis. Upon color development (10 to 15 minutes), sections were fixed in 10% buffered formalin, and maintained at 4 ℃ until images were made (Cool-snap, Nikon camera mounted to a dissecting microscope). Infarct volume was calculated by combining the infarct areas measured in the brain slices. TTC-defined infarct volumes correlated with those measured by conventional histological hematoxylin/eosin staining. The morphometric analysis of infarct volume, in which the indirect method was used to correct for biases caused by brain edema[18]. At the end of 12-hour cerebral ischemia/reperfusion and 24-hour treatment, rats were sacrificed to measure infarct volume. ELISA assay The ELISA assay was performed as previously described[19]. Rat brain tissues were dissected and homogenized in T-PER buffer (Biosource Inc., USA) in the presence of protease inhibitors (Biosource). Following homogenization, the lysates were centrifuged at 100 000 × g. Protein inhibitors and 1089


AEBSF (Sigma) were added to tissue lysates to prevent degradation of VEGF, IL-1β, and TNF-α. The concentration of IL-1β and TNF-α was measured using the VEGF, IL-1β, and TNF-α colorimetric ELISA kit (Biosource), according to the manufacturer’s instructions. Western blotting Rat tissues were dissected and homogenized in T-PER buffer in the presence of protease inhibitors. Following homogenization, the lysates were centrifuged at 100 000 × g, and the supernatants were saved for Western blot analysis by Ciphergen (Biosource) Protein Chip Array. Equal amounts of lysates were subject to SDS-PAGE (tris-glycine mini gel, Biosource) and Western blot analysis using antibodies specific for the following antigens: VEGF (1:2 500, Biosource) and β-tubulin (1:5 000, Biosource). The optical densities of the specific bands were scanned and measured by image analysis software (HPIAS 2000, Tongji Qianping Company, Wuhan, China). Reverse transcription polymerase chain reaction (RT-PCR) Animals were sacrificed at the corresponding time points, and total RNA was extracted from tissue sections using a total RNA extraction kit. A total of 4 μg total RNA was heated at 70 ℃ for 5 minutes, and then chilled on ice. A reaction mix containing 10 mmol/L dNTP, 0.5 g/L oligo (dT), 40 U reverse transcriptase (m-mulv), 5× pH 8.3 RT buffer, and deionized water was added. The total sample volume was 20 μL. Samples were incubated at 37 ℃ for 1 hour, and the reaction was stopped by heating at 70 ℃ for 10 minutes. Specific primers were designed for Vegf, IL-1β, and TNF-α mRNA sequences (Table 1).

confirming that the amplified PCR products comprised VEGF, IL-1β, and TNF-α sequences. Band densities were scanned with a densitometer. The relative amount of mRNA in each sample was calculated using the densitometry ratio of VEGF, IL-1β, and TNF-α absorbance value to β-actin absorbance value. Statistical analysis Quantitative data were expressed as Mean ± SD. All statistical analyses were performed using SPSS software for Windows 8.0 (SPSS Inc., Chicago, IL, USA), as well as Student’s t-test for inter-group comparison. P < 0.05 was considered statistically significant. Statistical analysis was performed by the fourth author.

RESULTS Minocycline decreased focal infarct volume Focal infarct volume was significantly larger in the ischemia/reperfusion and minocycline treatment groups, compared with the sham-operation group (F3,24 = 18.58, P < 0.01; F3,24 = 19.09, P < 0.01). In addition, focal infarct volume was significantly larger in the ischemia-perfusion group, compared with the minocycline treatment group (F3,24 = 21.51, P < 0.01; F3,24 = 17.57, P < 0.01) (Table 2). Minocycline decreased the focal infarct volume following cerebral ischemia/reperfusion injury. _

Table 2 Focal infarct volume in the three groups Group Sham-operation Ischemia/reperfusion Minocycline

Table 1 Oligonucleotides used for reverse transcription polymerase chain reaction Target gene β-actin Forward Reverse VEGF Forward Reverse IL-1β Forward Reverse TNF-α Forward Reverse

Primer sequence (5’-3’)

Annealing Size temperature Cycle (bp) (℃) 266

59

32

228

61

31

312

61

35

371

59

32

GTTCGCCATGGATGACGATATC GCCAGATCTTCTCCATGTCGTC TGCTCAGCATTCGGACTGACCT CAGTATGCATGGACCATGACGG TAAGGAATCACGGTTCTCACCGG GGACCGCATTCTAAGGGATCGTT GTGTTCCACCAGGAGATGTTGC CTCCTGCCCACTGAGTTCGTCT

For PCR, 2 μL cDNA, 2 mmol/L dNTP, specific primer pairs (20 pmol), 2 U DNA polymerase, 5× PCR buffer, and deionized water were added to the cDNA. The PCR products were separated by electrophoresis on a 1.5% (w/v) agarose gel containing 0.5 mg/L ethidium bromide. Single bands, corresponding to the predicted size of the amplified products for VEGF, IL-1β, and TNF-α, and β-actin, were identified using an ultraviolet transilluminator. The products were then transferred to a nylon filter membrane, and hybridized with an ECL 3’-oligolabeling and detection system (10 mL, Biosynthesis, Beijing, China). The bands corresponded to the ethidium bromide-stained products in the gels, thereby 1090

12 h 103.8±38.2 156.5±40.4 126.3±35.6

(x±s, mm3)

24 h 101.6±43.1 152.1±34.6 122.8±47.6

VEGF upregulation following minocycline treatment To further determine the neuroprotective effects of minocycline, VEGF expression was measured by ELISA, Western blotting and RT-PCR. Corresponding with focal infarct volume results, VEGF expression, as determined by ELISA, was significantly greater in the ischemia/reperfusion group, compared with the sham-operation group (F3,24 = 16.51, P < 0.01; F3,24 = 19.04, P < 0.01), and was rapidly up-regulated following cerebral ischemia/reperfusion injury. After minocycline treatment, VEGF expression, as determined by Western blot, was further upregulated in the minocycline treatment group, compared with the ischemia/reperfusion group (F3,24 = 19.56, P < 0.01; F3,24 = 21.32, P < 0.01) (Figure 2). Vegf mRNA expression in the ischemia/reperfusion and minocycline treatment groups was greater in the sham-operated animals (F3,24 = 17.46, P < 0.001; F3,24 = 18.04, P < 0.01). Minocycline downregulates IL-1β and TNF-α expression It has been previously shown that minocycline reduces focal infarct volume in the process of cerebral ischemia/reperfusion injury, and up-regulates VEGF in the cortex and hippocampus tissues[20]. The results demonstrated that minocycline improved the integrity of vascular function. To further explore the neuroprotective mechanisms of minocycline following cerebral ischemia, the proinflammatory cytokines IL-1β and TNF-α


Protein level of IL-1β(pg/mg)

40

a

a

b

b

30 20 10 0

S

M12

M24

MT12

MT24

A: Protein levels of IL-1β a

a

45

b Protein level of TNF-α(pg/mg)

were tested by ELISA and RT-PCR. ELISA analysis indicate that IL-1 β levels were significantly elevated in the ischemia/reperfusion group, compared with the sham-operation group (F3,24 = 13.53, P < 0.01; F3,24 = 15.52, P < 0.01). However, IL-1β levels were significantly decreased in lysates from the lesioned animals following minocycline treatment (F3,24 = 11.51, P < 0.01; F3,24 = 16.56, P < 0.01) (Figure 3A). TNF- α was significantly up-regulated in sham-operation controls, compared with the lesioned animals (F3,24 = 18.8, P < 0.01; F3,24 = 14.90, P < 0.01), and significantly decreased in lesioned animals, following minocycline treatment (F3,24 = 12.56, P < 0.01; F3,24 = 14.54, P < 0.01) (Figure 3B). RT-PCR results demonstrated that IL-1β and TNF-α mRNA levels corresponded to the respective protein levels. IL-1β and TNF-α expression was significantly less after minocycline treatment, compared with the ischemia/reperfusion group (F3,24 = 14.52, P < 0.01; F3,24 = 15.32, P < 0.01) (Figure 4). Expression of IL-1 β gene transcription in cerebral ischemia/reperfusion condition was related to the protein level of TNF-α which was treated with minocycline.

b

30

15

0

S

M12

M24

MT12

MT24

B: Protein levels of TNF-α S

M12

M24

MT12

MT24 VEGF β-actin (internal control)

Absorbance ratio (VEGF/β-actin)

Figure 3 Protein levels of interleukin-1 beta (IL-1β) and tumor necrosis factor alpha (TNF-α)

a

a

45

S: Sham-operation group; M12: Ischemia/reperfusion 12-hour group; M24: Ischemia/reperfusion 24-hour group; MT12: Minocycline treatment 12-hour group; MT24: Minocycline treatment 24-hour group; aP < 0.01, vs. sham-operation group; bP < 0.01, vs. ischemia/perfusion group

b

b

S

30

M12

M24

MT12

MT24

15

IL-1β 0

S

M12

M24

MT12

MT24

TNF-α

A: protein products for VEGF 1

2

3

4

β-actin (internal control)

5 VEGF mRNA

Absorbance ratio (VEGF mRNA/ β-actin mRNA)

3

b a

2

b

a

1 0

S

M12

M24

MT12

MT24

B: RT-PCR products for VEGF

3 Absorbance ratio (IL-1β or TNF-αmRNA/ β-actin mRNA)

β-actin mRNA (internal control)

a

a b

2

b

S M12 M24 MT12 MT24

a

a b

b

1

0 IL-1β

TNF-α

S: Sham-operation group; M12: Ischemia/reperfusion 12-hour group; M24: Ischemia/reperfusion 24-hour group; MT12: Minocycline treatment 12-hour group; MT24: Minocycline treatment 24-hour group; a P