Genet Resour Crop Evol (2013) 60:49–58 DOI 10.1007/s10722-012-9813-y
RESEARCH ARTICLE
Molecular characterization and diversity of puroindoline b-2 variants in cultivated and wild diploid wheat Feng Chen • Xiaoli Shang • Craig F. Morris • Fuyan Zhang • Zhongdong Dong • Dandqun Cui
Received: 12 September 2011 / Accepted: 6 February 2012 / Published online: 2 March 2012 Ó Springer Science+Business Media Dordrecht 2012
Abstract Cloning and phylogenetic analysis of puroindoline b-2 variants in common wheat (Triticum aestivum L.) and its relatives would advance the understanding of the genetic diversity and evolution of puroindoline b-2 gene in common wheat and its related species. In the present study, common wheat (AABBDD) and four related species, including T. urartu (AuAu), Aegilops speltoides (SS), Ae. tauschii (DD), and T. turgidum (AABB) were sampled for the presence of novel alleles at Pinb2v-A1, Pinb2v-B1/
Electronic supplementary material The online version of this article (doi:10.1007/s10722-012-9813-y) contains supplementary material, which is available to authorized users. F. Chen (&) X. Shang F. Zhang Z. Dong D. Cui (&) Department of Agronomy, Henan Agricultural University, 95 Wenhua Road or 63 Nongye Road, Zhengzhou 450002, People’s Republic of China e-mail:
[email protected] D. Cui e-mail:
[email protected] F. Chen X. Shang F. Zhang Z. Dong D. Cui Key Laboratory of Physiological Ecology and Genetic Improvement of Food Crops in Henan Province, Henan Agricultural University, 95 Wenhua Road or 63 Nongye Road, Zhengzhou 450002, People’s Republic of China C. F. Morris USDA-ARS, Western Wheat Quality Laboratory, E-202 Food Science and Human Nutrition Facility East, Washington State University, Pullman, WA 99164, USA
Pinb2v-S1 and Pinb2v-D1 loci corresponding to common wheat puroindoline b-2 variants. Nine new alleles were identified at these loci, designated Pinb2v-A1a through Pinb2v-A1c, Pinb2v-S1a through Pinb2v-S1e, and Pinb2v-D1a. Alignment of puroindoline variants or alleles from common wheat and its relatives indicated that all alleles in diploid wheats are attributed to single nucleotide substitution when compared with puroindoline b-2 variants in polyploids. Deduced amino acid sequences showed that all three alleles at Pinb2v-A1 locus and four alleles (Pinb2v-S1a, Pinb2v-S1b, Pinb2v-S1c and Pinb2v-S1e) at the Pinb2v-S1 locus could not be normally translated due to the presence of premature stop codons, whereas Pinb2v-D1a at the Pinb2v-D1 locus and Pinb2v-S1d at the Pinb2v-S1 locus could be normally translated, possibly suggesting that the puroindoline b-2 variant in Ae. tauschii was more highly conserved than those in T. urartu and Ae. speltoides. Meanwhile, puroindoline b-2 variant could be normally translated in all of the durum and common wheat cultivars surveyed. None of the puroindoline b-2 alleles previously identified in durum and common wheat were found in the diploid genome donors examined here, even though a greater diversity of alleles were found in diploid wheat compared to polyploid wheat. These results likely reflect the evolutionary history of tetraploid and hexaploid wheats, although it may be that puroindoline b-2 variant alleles have been selected for stability and functionality in common and durum wheat. This study provides a survey of puroindoline b-2 variants in common wheat
123
50
and its relatives, and provides useful information for understanding the genetic diversity of puroindolinelike genes and their duplication events in wheat. Keywords Bread wheat Diploid wheat Durum wheat Puroindoline b-2 variant
Introduction Common wheat (Triticum aestivum L.) is an allohexaploid with six sets of chromosomes (AABBDD). Studies indicate that the A, B and D genomes of common wheat stemmed from T. urartu Thum. ex Gandil., Aegilops speltoides Tausch and Ae. tauschii Coss., respectively (Petersen et al. 2006; Ladizinsky 1984; Talbert et al. 1998; Lagudah et al. 1991a). The origin of the B genome is still somewhat controversial due to some lack of similarity between the genomic sequences of Ae. speltoides versus the B genome of common wheat, when compared with the similarities amongst the other two donors, T. urartu and Ae. tauschii, and the A and D genomes. Predominant views agree that the formation of common wheat was attributed to two evolutionary events (Feuillet et al. 2001; Huang et al. 2002; Gu et al. 2004; Jauhar 2007). The first one was the hybridization between T. urartu (AA) and Ae. speltoides (SS) or other closely related species (BB), resulting in the formation of T. dicoccoides (Ko¨rn. ex Asch. et Graebn.) Schweinf.(AABB). After that, the hybridization of T. dicoccon Schrank (AABB) domesticated from T. dicoccoides and Ae. tauschii (DD) formed current hexaploid common wheat (AABBDD) (Salamini et al. ¨ zkan et al. 2005; Luo et al. 2007; Kilian et al. 2002; O 2007, 2009). Taxonomic nomenclature partly follows that of van Slageren (1994). Puroindolines are basic, cysteine-rich proteins characterized by a tryptophan-rich domain and were first isolated from T. aestivum seeds by Greenwell and Schofield (1986). It has been well documented that puroindoline proteins soften the endosperm of common wheat kernels, i.e. in common wheat, genotypes with wild-type puroindoline genes encoding puroindoline proteins confer soft endosperm, whereas a mutation of either puroindoline a (Pina) or puroindoline b (Pinb) gene results in hard endosperm (Morris 2002; Chen et al. 2006). Currently, a number of puroindoline alleles have been identified in common wheat from different countries or geographic regions
123
Genet Resour Crop Evol (2013) 60:49–58
(Morris and Bhave 2008; Bhave and Morris 2008a, b; Wang et al. 2008a, b; Chen et al. 2010c, 2012). Furthermore, puroindoline genes have been found in almost all of the Triticeae species of diploid (T. urartu, Ae. speltoides, Ae. tauschii, T. monococcum L. and T. boeoticum Boiss. etc.) and hexaploid wheat (Triticum and Aegilops species), barley (Hordeum vulgare L.), rye (Secale cereale L.), and oats (Avena sativa L.) (Chen et al. 2005; Chen et al. 2009; Gautier et al. 2000; Guzma´n et al. 2011). However, puroindoline genes are absent from tetraploid wheat (T. turgidum L., AABB) due to transposable element insertion and two large deletions in the Ha (Hardness) locus caused by illegitimate DNA recombination during the evolution of tetraploid wheat (Chantret et al. 2005). With the in-depth understanding of the molecular genetic basis of kernel hardness, additional puroindoline-like genes have been considered for a role in regulating kernel hardness. Gsp-1 genes with similarities of more than 60% in comparison with puroindoline genes were the first puroindoline-like genes identified in common wheat. Unlike puroindoline genes with a single copy on the short arm of chromosome 5D, Gsp-1 is present in a homoeologous series with copies on the 5A, 5B and 5D chromosomes (Blochet et al. 1993). However, the function of Gsp-1 genes in controlling kernel hardness has not yet been demonstrated (Massa et al. 2004; Gollan et al. 2007), but a role in plant defense has been assumed in common wheat (Gollan et al. 2007). Interestingly, a second series of puroindoline-like genes was reported by Wilkinson et al. (2008) based on three cDNA genes with more than 70% similarity compared to the puroindoline b gene in common wheat. Three genes were mapped to the long arm of chromosome 7A of common wheat (Wilkinson et al. 2008). Recently, two novel puroindoline b-like variants were discovered in common and durum wheat by Chen et al. (2010a, 2011). All five puroindoline b-like variants exhibited more than 91% sequence similarity and were renamed Pinb-2v1, Pinb-2v2 and Pinb-2v3, Pinb-2v4 and Pinb-2v5 (puroindoline b-2 variant 1, 2, 3, 4 and 5, respectively). Additionally, two Pinb-2v3 alleles, designated Pinb-2v3a and Pinb-2v3b, were identified in durum wheat (Chen et al. 2011). Moreover, physical mapping of puroindoline b-2 variants with aneuploids of common and durum wheat indicated that Pinb-2v1 was located on 7DL, Pinb-2v2 on 7BL, Pinb-2v3 on 7B, and Pinb-2v4 on 7AL (Chen
Genet Resour Crop Evol (2013) 60:49–58
51
et al. 2010a, 2011), whereas the location of Pinb-2v5 was not confirmed due to the lack of a variant-specific primer for it. These results were not consistent with the mapping results of puroindoline b-2 variants reported by Wilkinson et al. (2008). The reason for this discrepancy may be that their primer for Pinb-2v1 was not sufficiently specific to delineate the other four variants; this was rectified by the variant specific primers of Chen et al. (2010a, 2011). Of note, unlike the presence of Pinb-2v1 and Pinb-2v4 in all surveyed cultivars, Pinb-2v2 and Pinb-2v3 were always reciprocally present in different common and durum wheat cultivars (Chen et al. 2010a, b, 2011). These results indicate that Pinb-2v2 and Pinb-2v3 are likely allelic. Based on previous studies on puroindoline b-2 variants, the Pinb-2v3 variant was the dominant form present in Chinese and American common wheat cultivars as well as durum wheat cultivars (Chen et al. 2010a, b, 2011; Wilkinson et al. 2008). Further analysis of the influence of puroindoline b-2 variants on wheat characteristics indicated that a modulation of kernel hardness by puroindoline b-2 variants was not obvious although a slight difference in kernel hardness was observed in soft wheat between Pinb-2v2 and Pinb-2v3, whereas Pinb-2v3 genotypes possessed
more preferable grain yield-related traits than those of Pinb-2v2 genotypes (Chen et al. 2010b). This study examined the extent of nucleotide diversity of puroindoline b-2 variants in donors of the different genomes of hexaploid wheat and its related species. The primary objective was to provide a comprehensive, overall view of puroindoline b-2 variants with regard to nucleotide sequence diversity during the formation of hexaploid wheat, and to provide useful information regarding the molecular genetics of kernel hardness and gene duplication events in wheat.
Materials and methods Plant materials In this study, five accessions of T. urartu were used for cloning puroindoline b2-A1 variant, eight accessions of Ae. tauschii were used for cloning puroindoline b2D1 variant, and eight accessions of Ae. speltoides were used for cloning puroindoline b2-S1 variant (Table 1 and Supplement 1). Additionally, twenty durum wheat cultivars and twenty bread wheat cultivars were used
Table 1 Puroindoline b-2 alleles identified in diploid, tetraploid and bread wheat cultivars surveyed Locus
Species
Genome
Accession identifier
Allele
Normal translation
Pinb2v-A1
T. urartu
Au
101004, Ta 428197
Pinb2v-A1a
No
T. urartu
Au
1010016, Ta 428259
Pinb2v-A1b
No
u
Pinb2v-S1
T. urartu
A
IE 29-1
Pinb2v-A1c
No
Ae. speltoides
S
Ae 50, Y162, PI 573450
Pinb2v-S1a
No
Ae. speltoides
S
PI 552295, PI 173614
Pinb2v-S1b
No
Ae. speltoides
S
PI 554300
Pinb2v-S1c
No
Ae. speltoides
S
PI 560748
Pinb2v-S1d
Yes
Ae. speltoides
S
PI 542274
Pinb2v-S1e
No
t
Pinb2v-D1
Ae. tauschii
D
Y155, Ae 42, As 60, As 67, As 95, Ta 1686, Ta 1706, Ta 1716
Pinb2v-D1a
Yes
Pinb2v-A1
T. turgidum
AABB
Duroi, Gallareta, Bolo etc.
Pinb-A2v4
Yes
Pinb2v-B1
T. turgidum
AABB
Bolo, Illora Lesina, Bombasi etc.
Pinb-B2v2 Pinb-B2v3a
Yes Yes
Duroi, Gallareta etc.
Pinb-B2v3b
Yes
Pinb2v-A1,
T. aestivum
AABBDD
Xinmai 19, Yunong 949 etc.
Pinb-A2v4
Yes
Pinb2v-B1
T. aestivum
AABBDD
Pinb2v-D1
T. aestivum
AABBDD
Xinmai 19, Yunong 949 etc.
Pinb-B2v2
Yes
Xinmai 18, Fan6 etc.
Pinb-B2v3a
Yes
Yunong 202, Neixiang184 etc.
Pinb-B2v3b
Yes
Yunong 202, Neixiang184 etc.
Pinb-D2v1
Yes
123
52
for cloning puroindoline b-2 variants of A, B and D genomes from tetraploid and hexaploid wheats (Supplement 1). All of the diploid wheat accessions from Chinese Crop Germplasm Bank were kindly provided by Prof. Xia Xianchun (the Institute of Crop Science, Chinese Academy of Agricultural Sciences) or Li Yiwen (the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). The durum wheat cultivars were kindly provided by Prof. Roberto Tuberosa of University of Bologna. The common wheat accessions we used in this study were popular winter wheat cultivars or advance lines from the Yellow and Huai Valley wheat region of China. Genomic DNA extraction and PCR parameters Genomic DNA of all materials in this study was extracted from young leaves of light-grown plants according to method of Lagudah et al. (1991b). Genomic DNA from each diploid wheat was amplified by universal primer set Pinb-2vU (forward primer: AT GAAGACCTTATTCCTCCTA; reverse primer: TC ASTAGTAATAGCCATTAKTA) previously developed by Chen et al. (2010a) in order to obtain the corresponding sequences of puroindoline b-2 variant in diploid wheat. Four variant-specific primers PinbD2v1 (forward primer: GGTTCTCAAAACTGCCC AT; reverse primer: ACTTGCAGTTGGAATCCAG), Pinb-B2v2 (forward primer: CTTGTAGTGAGCACAA CCTTTGCA; reverse primer: GTATGGACGAACTTG CAGCTGGAG), Pinb-B2v3 (forward primer: GCAGA AAAAGCCATTGCACCTA; reverse primer: CATTA GTAGGGACGAACTTGCAGCTA) and Pinb-A2v4 (forward primer: CCTTTCTCTTGTAGTGAGCACAA CCA; reverse primer: GACGAACTTGCAGTTGGAA TCCAA) reported by Chen et al. (2010a, 2011) were used for identification of puroindoline b-2 variants in each durum and bread wheat cultivars surveyed and PCR products with three repeated independent amplification for each haplotype were all directly sequenced, respectively, from both directions by SinoGenoMax Co., Ltd. in order to confirm the each puroindoline b-2 allele. PCR reactions were performed in an MJ Research PTC-200 thermal cycler in a total volume of 25 ll including 20 mM of Tris–HCl (pH 8.4), 20 mM of KCl, 150 lM of each of dNTPs, 1.5 mM of MgCl2, 8 pmol of each primer, 1 unit of Taq DNA polymerase (Toyobo Biotech
123
Genet Resour Crop Evol (2013) 60:49–58
Co.), and 50 ng of genomic DNA. Reaction conditions were 95°C for 10 min, followed by 35 cycles of 95°C for 50 s, 54°C to 65°C for 45 s (primer-specific annealing temperatures, see Chen et al. (2010a, 2011)), and 72°C for 1 min, with a final extension of 72°C for 10 min. An aliquot (8 lL) of the PCR products was analyzed on 1.5% (w/v) agarose gels, stained with ethidium bromide, and visualized using UV light.
Cloning and sequencing of puroindoline b-2 variants in diploid wheat After separation on agarose gel, the mixture of three repeated PCR amplifications of each diploid wheat accession with universal primer set was purified by the QIAquick PCR Purification Kit (Qiagen) according to the instruction of manufacture. The purified products were ligated into pGEM-T Easy vector (Promega) and transformed into cells of the Escherchia coli DH-5a strain. Plasmids containing targeted fragments were extracted by Plasmid Rapid Isolation Kit (Biodev-tech Company). Ten positive plasmids for each diploid wheat accession were selected for sequencing by SinoGenoMax Co., Ltd. Multiple plasmids were sequenced due to the possible existence of more than one haplotype in each diploid surveyed. Reliability of all sequencing results was checked by examining the sequence chromatograms using software FinchTV version 1.4.0 (http://www.geospiza.com/Products/finchtv. shtml).
Phylogenetic analyses All of the genomic DNA sequences of puroindoline b-2 variants cloned in this study, together with those of common and durum wheat genes Pinb-2v1, Pinb-2v2, Pinb-2v3a, Pinb-2v3b, Pinb-2v4, and Pinb-2v5, designated previously by Chen et al. (2010a, 2011) were used to construct the phylogenetic trees. Full multiple alignments of sequences and translations of nucleotides into amino acid sequence were performed by software DNAMAN Version 6.0 (http://www.soft landsl.com/free/dnaman?6?full.html). Phylogenetic tree was drawn by software MEGA 5.05 with Neighbor-Joining method.
Genet Resour Crop Evol (2013) 60:49–58
Results
53
located on chromosome 7B of common wheat (Chen et al. 2010a, 2011).
Cloning of puroindoline b2-A1 variant in T. urartu Cloning of puroindoline b2-D1 genes in Ae. tauschii
From the A genome of diploid wheats T. urartu, three novel puroindoline b-2 alleles were cloned, and designated as Pinb2v-A1a (T. urartu, 101004 and TA 428197), Pinb2v-A1b (T. urartu, 1010016 and TA 428259) and Pinb2v-A1c (T. urartu, IE29-1) (Table 1). The three Pinb2v-A1 alleles identified in the A-genome wheat relatives showed high similarities at the DNA level from 99.3 to 99.8% (Table 2), whereas the similarities of three Pinb2v-A1 alleles and six known Pinb-2v variants or alleles cloned in common and durum wheat (Pinb-2v1, Pinb-2v2, Pinb-2v3a, Pinb-2v3b, Pinb-2v4 and Pinb-2v5) ranged from 91.8 to 98.7% at the DNA level; differences were attributed to a number of SNPs (Supplement 2). When compared with six known variants or alleles from common and durum wheat, three novel Pinb2vA1 alleles from T. urartu exhibited highest similarity to Pinb-2v4 (98.7% with Pinb2v-A1a, 98.7% with Pinb2v-A1b and 98.5% with Pinb2v-A1c, Supplement 2 and Table 2) previously located on the chromosome 7AL of common wheat (Chen et al. 2010a, 2011).
From the D genome of eight accessions of diploid wheat Ae. tauschii, a single novel puroindoline b-2 allele was cloned and designated as Pinb2v-D1a (Ae. tauschii, Y155, Ae 42, As 60, As 67, As 95, TA 1686, TA 1706 and TA 1716) (Table 1). In these eight accessions of Ae. tauschii surveyed, all of them possessed the exact same sequence of Pinb2v-D1a allele, suggesting that puroindoline b-2 gene possessed higher conservation in Ae. tauschii than those of T. uratu and Ae. speltoides. The similarity of Pinb2v-D1a with six known Pinb-2v variants or alleles of common and durum wheat (Pinb2v1, Pinb-2v2, Pinb-2v3a, Pinb-2v3b, Pinb-2v4 and Pinb-2v5) were 98.5, 93.2 91.6, 91.8, 96.0 and 95.8%, respectively, at the DNA level (Table 2); differences were attributed to a number of single nucleotide substitutions (Supplement 2). Among these sequences, the Pinb2v-D1a allele showed the highest similarity to Pinb-2v1 variant previously located on chromosome 7DL of common wheat (Chen et al. 2010a, 2011).
Cloning of puroindoline b2-S1 genes in Ae. speltoides
Allelic variation of puroindoline b2 genes in the durum and bread wheat
From the S genome of 8 accessions of the diploid wheat Ae. speltoides, five novel puroindoline b-2 alleles were cloned, and designated as Pinb2v-S1a (PI554300, Ae 50 and Y162), Pinb2v-S1b (PI 542295, PI 173614), Pinb2v-S1c (PI 554300), Pinb2v-S1d (PI 560748) and Pinb2v-S1e (PI 542274) (Table 1). The five Pinb2v-S1 alleles cloned in this study shared high sequence identities ranging from 93.2 to 98.9% (Table 2); differences resulted from a number of single nucleotide substitutions (Supplement 2). The level of similarity of these five novel Pinb2v-S1 alleles with six known Pinb-2v variants or alleles of common and durum wheat (Pinb-2v1, Pinb-2v2, Pinb-2v3a and Pinb-2v3b, Pinb-2v4 and Pinb-2v5) ranged from 91.6 to 96.7% at the DNA level. When compared with six known Pinb-2v variants or alleles of common and durum wheat, four alleles of Pinb2v-S1 (b, c, d and e) showed highest similarities to Pinb-2v2 and Pinb-2v3b (ranging from 96.0 to 96.9%, Table 2) previously
Sequencing results of amplifying fragments with variant-specific primer sets in durum and bread wheats indicated that the Pinb-2v4 sequence from A genome in 20 durum wheat cultivars and 20 bread wheat cultivars are exactly the same with the sequences of GQ496619 previously reported by Chen et al. (2010a). Pinb-2v1 sequence from D genome of 20 bread wheat cultivars are exactly the same with the sequence of AM944731 and GQ496616 previously reported by Wilkinson et al. (2008) and Chen et al. (2010a). Amplifying results with Pinb-2v2 specific primer set indicated that 2 of the 20 durum wheat cultivars and 4 of bread wheat cultivars possessed Pinb-2v2 variant previously located on chromosome 7B of common wheat (Chen et al. 2010a, 2011) and sequencing results showed that both of them are exactly the same with sequences of AM9944732 and GQ496617 previously reported by Wilkinson et al. (2008) and Chen et al. (2010a). However, sequencing results of 18
123
123
93.2
91.6
91.8
96.0
95.8
95.6
95.6
95.4
96.7
93.2
94.3
93.8
93.8
98.5
Pinb2v2
Pinb2v3a
Pinb2v3b
Pinb2v4
Pinb2v5
Pinb2vA1a
Pinb2vA1b
Pinb2vA1c
Pinb2vS1a
Pinb2vS1b
Pinb2vS1c
Pinb2vS1d
Pinb2vS1e
Pinb2vD1a
Pinb2v1 (%)
93.2
94.9
96.9
96.5
94.3
93.2
93.6
93.8
93.8
94.0
94.7
94.3
94.0
Pinb2v2 (%)
91.6
96.5
94.9
94.0
95.8
91.6
91.8
91.8
91.8
92.1
92.7
99.8
Pinb2v3a (%)
91.8
96.7
94.7
94.3
96.0
91.8
92.1
92.1
92.1
92.3
92.9
Pinb2v3b (%)
96.0
94.5
94.9
94.7
93.8
95.6
98.5
98.7
98.7
98.9
Pinb2v4 (%)
95.8
94.3
94.5
94.5
93.6
95.4
98.2
98.5
98.5
Pinb2v5 (%)
95.6
94.0
94.3
94.3
93.8
95.1
99.3
99.6
Pinb2vA1a (%)
95.6
94.0
94.3
94.3
93.8
95.1
99.8
Pinb2vA1b (%)
95.4
94.0
94.0
94.0
93.8
94.9
Pinb2vA1c (%)
96.9
93.8
93.6
93.8
93.2
Pinb2vS1a (%)
93.2
98.9
95.6
95.1
Pinb2vS1b (%)
94.3
95.8
97.4
Pinb2vS1c (%)
93.6
96.2
Pinb2vS1d (%)
93.8
Pinb2vS1e (%)
Table 2 Homology comparison of nine novel puroindoline b-2 alleles from diploid wheats and six known puroindoline variants or alleles from tetraploid and hexaploid wheats
54 Genet Resour Crop Evol (2013) 60:49–58
Genet Resour Crop Evol (2013) 60:49–58
durum and 17 bread wheat cultivars with Pinb-2v3 variant identified by Pinb-2v3 specific primer set indicated that 3 of durum wheat cultivars and 5 of bread wheat cultivars belonged to Pinb-2v3a and the remaining 15 durum and 12 bread wheat cultivars belonged to Pinb-2v3b previously located on chromosome 7BL of common wheat (Chen et al. 2010a, 2011). Comparison of deduced amino acid sequence of puroindoline b-2 variants and alleles in wheat and related species Alignment of nine novel puroindoline b-2 alleles from diploid wheats and six known puroindoline b-2 variants or alleles from common and durum wheat indicated that high sequence identities were present, ranging from 91.6% to 98.7% at the deduced amino acid level (Supplement 3). No introns were found in any of the fifteen puroindoline b-2 variants or alleles. The deduced amino acid sequences of three novel Pinb2v-A1 alleles indicated that none could be translated normally due to the presence of premature stop codons in the A-genome species T. urartu. Similarly, four Pinb2v-S1 alleles (a, b, c and e) in Ae. speltoides could not be normally translated as well, based on their deduced amino acid sequences (Supplement 3). This phenomenon was previously found by Wilkinson et al. (2008). However, Pinb2v-S1d (Ae. speltoides, PI 560748) and Pinb2v-D1a present in the eight accessions of Ae. tauschii surveyed could be normally translated according to their deduced amino acid sequences (Supplement 3). The results suggest that puroindoline b-2 variant may be more highly conserved in Ae. tauschii compared to T. urartu and Ae. speltoides due to the discovery of 3, 5 and 1 alleles in T. urartu, Ae. speltoides and Ae. tauschii, respectively. Interestingly, in spite of the indication that some of the puroindoline b-2 alleles could not be translated in some of the diploid wheats, the cysteine backbone composed of 10 residues and the tryptophan motif KWWK were perfectly conserved in the deduced amino acid sequences from all nine novel Pinb-2v alleles and six known puroindoline b-2 variants or alleles, except for PINB2v-S1b with 9 cysteine residues. Moreover, eight of nine novel puroindoline b-2 alleles in this study were terminated with amino acids GY whereas PINB2v-S1d, PINB-2v2 and PINB2v3 were terminated with GYY (Supplement 3).
55
Phylogenetic inferences and sequence comparisons The phylogenetic tree was generated using the neighbor-joining method with bootstrap value 1,000 and distance method of Maximum Composite Likelihood (Fig. 1). Based on the phylogenetic tree (Fig. 1), four major clusters were obviously delineated. Of these, cluster I was composed of three Pinb2v-A1 alleles (Pinb2v-A1a, Pinb2v-A1b and Pinb2v-A1c) from T. urartu and two Pinb-2v variants (Pinb-2v4 and Pinb-2v5) from the A genome of T. aestivum and T. turgidum, which is consistent with the view that T. urartu was the donor of the A genome of common and durum wheat. Cluster II consisted of the allele Pinb2v-D1a from Ae. tauschii, Pinb-2v1 from the D genome of T. aestivum and Pinb2v-S1a from Ae. speltoides. It is plausible that Pinb2v-D1a and Pinb-2v1 belong to the same cluster because Ae. tauschii was the donor of the D genome in T. aestivum, whereas Pinb2v-S1a were contained in cluster II possibly due to larger sequence divergences of Ae. speltoids on puroindoline b-2 variant. Cluster III and IV were composed of four Pinb2v-S1 alleles (b, c, d and e) from Ae. speltoides, and three Pinb-2v alleles (Pinb-2v2, Pinb-2v3a and Pinb-2v3b) from the B genome of T. aestivum, which is consistent with the view that the B genome of common wheat possibly originated from Ae. speltoides or a close relative. Based on the four clusters, the puroindoline b-2 gene showed more variability in sequence divergence in Ae. speltoides than it did in T. urartu and Ae. tauschii (Table 2; Fig. 1).
Discussion Common wheat (T. aestivum, AABBDD) originated from the hybridization of emmer wheat (T. dicoccon, AABB) with Ae. tauschii (DD) about 7,000–10,000 years ago (McFadden and Sears, 1946), whereas emmer wheat stemmed from T. urartu (AA) and Ae. speltoides (SS) or closely related species (BB) before the formation of common wheat (Salamini et al. 2002; ¨ zkan et al. 2005; Kilian et al. 2007, 2009). Based on O this study, in diploid wheat, puroindoline b-2 variants could not be normally translated in all surveyed accessions of T. urartu and T. boeoticum (AbAb) as well as most of the surveyed accessions of Ae.
123
56
Genet Resour Crop Evol (2013) 60:49–58
67 96
Pinb2v-A1b Pinb2v-A1c
87
Pinb2v-A1a
99
Cluster I
Pinb-2v5 Pinb-2v4 Pinb2v-S1a Pinb-2v1
98 93
Pinb2v-D1a
45
Pinb2v-S1d
64
Pinb-2v2
Cluster II
Cluster III
Pinb2v-S1c 97
99
Pinb2v-S1b Pinb2v-S1e
Cluster IV
Pinb-2v3a
93 100
Pinb-2v3b
Fig. 1 Phylogenetic tree using the Neighbor-Joining method with bootstrap value 1,000 and the distance matrix of Maximum Composite Likelihood for the alignment of nine novel
puroindoline b-2 alleles from diploid wheats and six known puroindoline variants or alleles from polyploid wheats
speltoides, whereas it could be normally translated in all of the surveyed accessions of Ae. tauschii. These results may indicate that Ae. tauschii possesses more conservative sequence of puroindoline b-2 variant than those of T. urartu and Ae. speltoides. More accessions of diploid wheat should be investigated to test this point. Meanwhile, puroindoline b-2 variants could be normally translated in all of the common and durum wheat cultivars reported by Chen et al. (2010a, b, 2011) and Wilkinson et al. (2008) as well as the common and durum wheat cultivars surveyed in this study. The results may possibly suggest that evolution and selection of some puroindoline b-2 variants may have occurred during the formation of tetraploid and hexaploid wheat. Pinb-2vU universal primers were also used to attempt the amplification of Pinb-2v sequences from genomic DNA of three diploids: barley (Hordeum vulgare L., HH), oat (Avena strigosa Schreb., AsAs) and rye (Secale cereale L., RR). However, no amplicon was obtained, possibly due to gene absence or sufficient sequence divergence of puroindoline b-2 variant in these three diploids. In puroindoline genes from wheat and its relatives, some alleles (Pina-D1 l, Pinb-D1p, Pinb-D1r, PinbD1u and Pinb-D1ab) possess a frame-shift mutation due to insertion of a single nucleotide. However, all of the deduced un-translated puroindoline b-2 variants in
the diploid wheats reported here were due to singlebase substitutions at identical sites resulting in premature stop codons. Meanwhile, puroindoline b-2 variants were highly conserved in common and durum wheat cultivars. Until now, only 1 allele has been found for Pinb-2v1, Pinb-2v2, Pinb-2v4 and Pinb-2v5 variants, and 2 for Pinb-2v3 (Chen et al. 2010a, b, 2011; Wilkinson et al. 2008). However, none of the puroindoline b-2 alleles previously identified in common or durum wheat cultivars was present in any of the diploid wheats surveyed here. These results likely reflect the evolutionary history of tetraploid and hexaploid wheats, although it may be that puroindoline b-2 variant alleles have been selected for stability and functionality in common and durum wheat. In addition, one of A, B and D genome in durum and bread wheats possessed more than one copy of puroindoline b-2 due to the discovery of Pinb-2v5, suggesting that puroindoline b-2 was duplicated during evolution of durum and bread wheats. Similar to the Gsp-1 genes which have high sequence similarity to puroindoline genes, but no demonstrated role in kernel texture, the role of puroindoline b-2 variant in modulating wheat kernel texture remains to be seen. A minor effect of puroindoline b-2 variant on kernel hardness in soft wheat, and their association with some agronomic traits were observed in different common wheat cultivars (Chen
123
Genet Resour Crop Evol (2013) 60:49–58
et al. 2010b). Wilkinson et al. (2008) suggested that puroindoline b-2 variants might slightly associate with kernel hardness in mapping populations. At this point, more in-depth study is required before a clear role of puroindoline b-2 variant can be ascribed. However, the assessment of genetic diversity of puroindoline b-2 variants in diploid wheat in this study still could provide insight into neutrality selection models and patterns of linkage disequilibrium and recombination according to the report of Massa et al. (2004). Acknowledgments This project was financially supported by the grants from National Natural Science Foundation (31000708), Specialized Research Fund for the Doctoral Program of Higher Education (20104105120003), 973 project (2009CB118300) and International Science & Technology Cooperation Program of Henan Province (114300510013) of China.
References Bhave M, Morris CF (2008a) Molecular genetics of puroindolines and related genes: allelic diversity in wheat and other grasses. Plant Mol Biol 66:205–219 Bhave M, Morris CF (2008b) Molecular genetics of puroindolines and related genes: regulation of expression, membrane binding properties and applications. Plant Mol Biol 66:221–231 Blochet JE, Chevalier C, Forest E, Pebay-Peyroula E, Gautier MF, Joudrier P, Pe´zolet M, Marion D (1993) Complete amino acid sequence of puroindoline, a new basic and cystine-rich protein with a unique tryptophan-rich domain, isolated from wheat endosperm by Triton X-114 phase partitioning. FEBS Lett 329:336–340 Chantret N, Salse J, Sabot F, Rahman S, Bellec A, Laubin B, Dubois I, Dossat C, Sourdille P, Joudrier P, Gautier MF, Cattolico L, Beckert M, Aubourg S, Weissenbach J, Caboche M, Bernard M, Leroy P, Chalhoub B (2005) Molecular basis of evolutionary events that shaped the Hardness locus in diploid and polyploid wheat species (Triticum and Aegilops). Plant Cell 17:1033–1045 Chen MJ, Wilkinson M, Tosi P, He GY, Shewry P (2005) Novel puroindoline and grain softness protein alleles in Aegilops species with the C, D, S, M and U genomes. Theor Appl Genet 111:1159–1166 Chen F, He ZH, Xia XC, Xia LQ, Zhang XY, Lillemo M, Morris CF (2006) Molecular and biochemical characterization of puroindoline a and b alleles in Chinese landraces and historical cultivars. Theor Appl Genet 112:400–409 Chen Q, Qi PF, Wei YM, Wang JR, Zheng YL (2009) Molecular characterization of the pina gene in einkorn wheat. Biochem Genet 47:384–396 Chen F, Beecher B, Morris CF (2010a) Physical mapping and a new variant of puroindoline b-2 genes in wheat. Theor Appl Genet 120:745–751
57 Chen F, Zhang FY, Cheng XY, Morris CF, Xu HX, Dong ZD, Zhan KH, Cui DQ (2010b) Association of Puroindoline bB2 variants with grain traits, yield components and flag leaf size in bread wheat (Triticum aestivum L.) varieties of the Yellow and Huai Valleys of China. J Cereal Sci 52:247–253 Chen F, Zhang FY, Morris CF, He ZH, Xia XC, Cui DQ (2010c) Molecular characterization of the Puroindoline a-D1b allele and development of an STS marker in wheat (Triticum aestivum L.). J Cereal Sci 52:80–82 Chen F, Xu HX, Zhang FY, Xia XC, He ZH, Wang DW, Dong ZD, Zhan KH, Cheng XY, Cui DQ (2011) Physical mapping of puroindoline b-2 genes and molecular characterization of a novel variant in durum wheat (Triticum turgidum L.). Mol Breed 28:153–161 Chen F, Zhang FY, Xia XC, He ZH, Cui DQ, Dong ZD, Cheng XY, Xu HX, Zhan KH (2012) Molecular characterization of puroindoline alleles in bread wheat of the Yellow and Huai Valley of China and discovery of a novel puroindoline a allele without PINA protein. Mol Breed 29:371–378 Feuillet C, Penger A, Gellner K, Mast A, Keller B (2001) Molecular evolution of receptor-like kinase genes in hexaploid wheat. Independent evolution of orthologs after polyploidization and mechanisms of local rearrangements at paralogous loci. Plant Physiol 125:1304–1313 Gautier MF, Cosson P, Guirao AR, Joudrier P (2000) Puroindoline genes are highly conserved in diploid ancestor wheat and related species but absent in tetraploid Triticum species. Plant Sci 153:81–91 Gollan P, Smith K, Bhave M (2007) Gsp-1 genes comprise a multigene family in wheat that exhibits a unique combination of sequence diversity yet conservation. J Cereal Sci 45:184–198 Greenwell P, Schofield JD (1986) A starch granule protein associated with endosperm softness in wheat. Cereal Chem 63:379–380 Gu YQ, Coleman-Derr D, Kong XY, Anderson OD (2004) Rapid genome evolution revealed by comparative sequence analysis of orthologous regions from four Triticeae genomes. Plant Physiol 135:459–470 Guzma´n C, Caballero L, Martı´n MA, Alvarez JB (2011) Molecular characterization and diversity of the Pina and Pinb genes in cultivated and wild diploid wheat. Mol Breed. doi:10.1007/s11032-011-9599-1 Huang S, Sirikhachornkit A, Su X, Faris J, Gill B, Haselkorn R, Gornicki P (2002) Genes encoding plastid acetyl-CoA carboxylase and 3-phosphoglycerate kinase of the Triticum/Aegilops complex and the evolutionary history of polyploid wheat. Proc Natl Acad Sci 99:8133–8138 Jauhar PP (2007) Meiotic restitution in wheat polyhaploids (amphihaploids): a potent evolutionary force. J Hered 98:188–193 ¨ zkan H, Deusch O, Effgen S, Brandolini A, Kohl J, Kilian B, O Martin W, Salamini F (2007) Independent wheat B and G genome origins in outcrossing Aegilops progenitor haplotypes. Mol Biol Evol 24:217–227 ¨ zkan H, Pozzi C, Salamini F (2009) Domestication of Kilian B, O the Triticeae in the Fertile Crescent. In: Feuillet C, Muehlbauer GJ (eds) Genetics and genomics of the Triticeae. Plant genetics and genomics: crops and models 7. Springer Science Business Media, LLC, New York, pp 81–119
123
58 Ladizinsky G (1984) Founder effect in crop plant evolution. Econ Bot 39:191–199 Lagudah ES, Appels R, Brown ADH, McNeil D (1991a) The molecular genetic analysis of Triticum tauschii, the D genome donor to hexaploid wheat. Genome 34:375–386 Lagudah ES, Appels R, Mcneil D (1991b) The Nor-D3 locus of Triticum tauschii: natural variation and genetic linkage to markers in chromosome 5. Genome 34:387–395 Luo MC, Yang ZL, You FM, Kawahara T, Waines JG, Dvorak J (2007) The structure of wild and domesticated emmer wheat populations, gene flow between them, and the site of emmer domestication. Theor Appl Genet 114:947–959 Massa AN, Morris CF, Gill BS (2004) Sequence diversity of puroindoline-a, puroindoline-b, and the grain softness protein genes in Aegilops tauschii cross. Crop Sci 44:1808–1816 McFadden ES, Sears ER (1946) The origin of Triticum spelta and its free-threshing hexaploid relatives. J Hered 37:81–89 Morris CF (2002) Puroindolines: the molecular genetic basis of wheat grain hardness. Plant Mol Biol 48:633–647 Morris CF, Bhave M (2008) Reconciliation of D-genome puroindoline allele designations with current DNA sequence data. J Cereal Sci 48:277–287 ¨ zkan H, Brandolini A, Pozzi C, Effgen S, Wunder J, Salamini O F (2005) A reconsideration of the domestication geography of tetraploid wheats. Theor Appl Genet 110:1052–1060 Petersen G, Seberg O, Yde M, Berthelsen K (2006) Phylogenetic relationships of Triticum and Aegilops and evidence
123
Genet Resour Crop Evol (2013) 60:49–58 for the origin of the A, B and D genomes of common wheat (Triticum aestivum). Mol Phylogenet Evol 39:70–82 ¨ zkan H, Brandolini A, Scha¨fer-Preg R, Martin W Salamini F, O (2002) Genetics and geography of wild cereal domestication in the Near East. Nat Rev Genet 3:429–441 Talbert LE, Smith LY, Blake NK (1998) More than one origin of hexaploid wheat is indicated by sequence comparison of low copy DNA. Genome 41:402–407 Van Slageren MW (1994) Wild wheats: a monograph of Aegilops L. and Amblyopyrum (Jaub. & Spach) Eig (Poaceae). Agricultural University, Wageningen Wang J, Sun JJ, Liu DC, Yang WL, Wang DW, Tong YP, Zhang AM (2008a) Analysis of Pina and Pinb alleles in the microcore collections of Chinese wheat germplasm by Ecotilling and identification of a novel Pinb allele. J Cereal Sci 48:836–842 Wang L, Li GY, Xia XC, He ZH, Mu PY (2008b) Molecular characterization of Pina and Pinb allelic variations in Xinjiang landraces and commercial wheat cultivars. Euphytica 164:745–775 Wilkinson M, Wan Y, Tosi P, Leverington M, Snape J, Mitchel RAC, Shewry PR (2008) Identification and genetic mapping of variant forms of puroindoline b expressed in developing wheat grain. J Cereal Sci 48:722–728
