Molecular cloning and expression of the human homologue of ... - NCBI

Proc. Natl. Acad. Sci. USA Vol. 85, pp. 2623-2627, April 1988 Cell Biology

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor (hemopoietic differentiation factor/yeast expression/gene sequence/evolution/oligonucleotide-mediated mutagenesis)

NICHOLAS M. GOUGH, DAVID P. GEARING, JULIE A. KING, TRACY A. WILLSON, DOUGLAS J. HILTON, NICOS A. NICOLA, AND DONALD METCALF The Walter and Eliza Hall Institute of Medical Research, Post Office, Royal Melbourne Hospital, Victoria 3050, Australia

Contributed by Donald Metcalf, December 14, 1987 A human homologue of the recently cloned ABSTRACT murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the murine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsecl. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine Ml leukemic cells in a manner analogous to murine LIF. This factor competed with "I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors.

MATERIALS AND METHODS Library Screening. Phage plaques representing "Sau3Apartial" human genomic libraries in the A phage vector EMBL3A were grown at a density of -50,000 plaques per 10-cm petri dish and transferred to nitrocellulose in duplicate. Hybridization was as described (7), using a nicktranslated murine LIF cDNA fragment [pLIF7.2b (7)] as a probe at a concentration of -2 x 106 cpm/ml. After hybridization, filters were washed in 6 x SSC/0.1% NaDodSO4 at 650C and then autoradiographed. (Standard saline citrate, 1 x SSC, is 0.15 M NaCl/0.015 M sodium citrate, pH 7.0.) Plaques positive on duplicate filters were rescreened at lower density. Southern Blots. Aliquots (20 ttg) of genomic DNA were digested with various restriction endonucleases, electrophoresed in 0.8% agarose gels, and transferred to nitrocellulose. Filters were prehybridized and hybridized in either 6 x SSC or 2 x SSC (see Figs. 1 and 2) as described (7). The hybridization probe, nick-translated murine LIF cDNA fragment [pLIF7.2b (7)] at a specific activity of -"4 x 10' cpm/,ug, was used at -2 x 107 cpm/ml. Filters were washed in either 6x SSC, 2x SSC, or 0.2x SSC, all plus 0.1% NaDodSO4, at the temperatures indicated. Modification of the Human Gene and Expression in Yeast. An -3-kilobase-pair (kbp) BamHI fragment spanning the human LIF gene was subcloned in plasmid pEMBL8+ (10) and in vitro mutagenesis was performed (11) using oligodeoxyribonucleotides of 39, 48, and 39 bases to modify the 5' end [5' d(CTGCACTGGACCTTAGGGGCGGGATCCCCCCTCCCCATC) 3'], the intervening sequence [5' d(GCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGGAGCCGTTC)3'], and the 3' end [5' d(CAGGCCTTCTAGTAAGATATCAAGCTTTGTGCTGTGAAC)3'] of the coding region. A BamHI-HindIII fragment carrying the modified gene was ligated into plasmid YEpsecl (12) and used to transform (13) Saccharomyces cerevisiae strain GY1 + (leu2 ura3 ade2 trpi cir+; from G. Cesareni, European Molecular Biology Laboratory, Heidelberg). Transformants were selected and maintained on synthetic minimal medium under uracil deprivation. LIF was produced either by growing ura+ transformants in nonselective medium containing galactose or by growth in minimal medium containing 2% glucose, passage through ethanol-containing medium to overcome glucose repression, and then induction of the GAL-CYC promoter by addition of 2% galactose (14).

The identification of specific factors able to suppress myeloid leukemic cells by induced differentiation has been of intense interest, both from a theoretical view point and also because of their therapeutic potential (1). Several such factors have been described. For human cells, the hemopoietic colony-stimulating factors granulocyte-CSF (G-CSF) and granulocyte/macrophage-CSF (GM-CSF), which act as proliferative as well as differentiative stimuli for normal myeloid progenitors, are able to induce the macrophage differentiation of HL-60 promyelocytic cells (2), and tumor necrosis factor a (TNF-a) has been shown to induce the differentiation of both HL-60 and ML-1 leukemic cells (3). For murine cells, G-CSF and GM-CSF are able to induce the differentiation of WEHI-3B D+ leukemic cells (4, 5) and, in the case of G-CSF, Ml cells (6). Leukemia-inhibitory factor (LIF), a factor that we have recently purified (D.J.H., N.A.N., and D.M., unpublished work) and cloned (7) and that may be equivalent to macrophage/granulocyte-inducer type 2 (MGI2, ref. 8) and D factor (9), is able to induce the differentiation of Ml cells, but not WEHI-3B D+ cells. LIF, which is structurally distinct from other factors previously shown to be differentiative stimuli for myeloid leukemias (in particular G-CSF and TNF-a), is of particular interest because, unlike the CSFs, it is not a proliferative stimulus for either normal or leukemic progenitor cells. To identify a human counterpart to murine LIF and ultimately to establish its actions on both primary and established human myeloid leukemic cells, we have cloned and sequenced a human gene homologous to the murine LIF gene and have expressed the factor encoded by this gene in yeast cells. *

Abbreviations: LIF, leukemia-inhibitory factor; CSF, colonystimulating factor; G-CSF, granulocyte-CSF; GM-CSF, granulocyte/macrophage-CSF; CSF-1, macrophage-CSF; TNF, tumor necrosis factor. *The sequence reported in this paper is being deposited in the EMBL/GenBank data base (Intelligenetics, Mountain View, CA, and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03261).

The publication costs of this article were defrayed in part by page charge

payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

2623

2624

Cell

Biology: Gough et al.

RESULTS Detection of the Human LIF Gene by Hybridization with a Murine Probe. To look for a human counterpart of murine LIF, and to establish conditions for cross-species hybridization, Southern blots of human genomic DNA were screened with a mouse LIF cDNA probe under a variety of hybridization and washing conditions. Initial experiments using EcoRI-digested human genomic DNA indicated that the mouse cDNA probe could detect a human counterpart under certain conditions of hybridization and washing (650C in 6 x SSC; data not shown). Under these conditions bands could be seen in human genomic DNA digested with a variety of restriction enzymes (Fig. 1), although the intensity of bands representing the presumptive human LIF gene above the background smear was different for different restriction enzymes, ranging from BamHI-digested DNA, in which a specific band of -3 kbp was clearly distinct from the background smear, to EcoRI- or HindIII-digested DNA, in which specific bands were barely evident. A high degree of homology between the mouse and human LIF sequences was apparent when mouse and human genomic DNA digested with BamHI was hybridized with a mouse LIF cDNA probe under a variety of conditions of hybridization and washing (Fig. 2). As the stringency of hybridization and washing was raised, the background smear was reduced, revealing a unique fragment of =3 kbp hybridizing with the mouse probe. Significantly, the human gene retained substantial hybridization even at 650C in 0.2 x SSC, and the size of the BamHI fragment in the two species was indistinguishable. Cloning of the Human LIF Gene. To isolate a clone encompassing the human LIF gene, two human genomic DNA libraries were screened using the mouse LIF cDNA fragment as a probe. Among several candidate clones that hybridized with the mouse probe, those clones most likely to contain the human LIF gene were distinguished by the presence of BamHI and Pst I fragments hybridizing with the mouse cDNA of the sizes predicted from genomic Southern blot experiments (for example, see Fig. 1). Three isolates, probably representing the same primary clone, were thus identified. These clones contained a 9-kbp segment of chromosomal DNA spanning the human LIF gene, and all of the E-E

E2 E` aai E? a'

cJ a m2cLcc/) co W r cOLu

23-19.4 6.5 -

2.3 4.32.0 -

1 *

,*

FIG. 1. Detection of the human LIF gene with a mouse probe. Human genomic DNA digested with the indicated restriction enzymes was hybridized with a murine LIF cDNA probe (pLIF7.2b) as described in Materials and Methods. Both hybridization and washing were in 6 x SSC at 65TC. HindIII fragments of A phage DNA were used as size markers (lengths in kbp at left).

~ ~ .,

Proc. Natl. Acad. Sci. USA 85 (1988) Hybridization 55, 6 Washing 65 :6 MH

3

kbp-

65:/ 6 65/6

MH

65! 2

65,2

65/2 65,0.2 MH M H

FIG. 2. Detection of the human LIF gene with a mouse probe at different stringencies. Pairs of tracks of human (H) and mouse (M) genomic DNA digested with BamHI were hybridized with a murine LIF cDNA probe (pLIF7.2b) under a variety of conditions of hybridization and washing. Temperature (550C or 650C) and SSC concentration (6 x or 2 x ) used for hybridization are indicated on the top line and the conditions of washing on the second line.

sequences in these clones hybridizing to the murine cDNA pLIF7.2b (7) were contained within an =3-kbp BamHI fragment; this fragment was subcloned into pEMBL8+ for further analysis. Structure of the Human LIF Gene. The entire nucleotide sequence of the BamHI fragment spanning the LIF gene (2840 bp) was determined, of which 1297 bp is shown in Fig. 3. Alignment of this sequence with the murine LIF mRNA sequence revealed that the sequences encoding the mature human LIF protein are present on two exons separated by an intron of 693 bp (Fig. 3). For the region encoding the mature protein, there is a high degree of homology between the two species at both the nucleotide and the amino acid sequence level. Within exon 1 there is 88% nucleotide sequence identity (114/129 residues compared) and 91% amino acid sequence identity (39/43) for the region encoding the mature protein (positions 58-186). Exon 2 is somewhat less homologous, with 77% identity at the nucleotide level (318/411) and 74% identity at the amino acid level (101/136) within the coding region. For the mature protein as a whole, mouse and human LIF are identical at 140 of 179 positions (78%) with no insertions or deletions (Fig. 4). Moreover, many of the differences are highly conservative substitutions (Lys/Arg, Glu/Asp, and Val/Leu/Ala/Ile). Upstream of the codon for the N-terminal proline residue of mature LIF (position 58 in Fig. 3), the human gene is homologous with the murine LIF mRNA sequence through a region encoding most of the hydrophobic leader. However, the entire leader is not encoded on this exon, since the mRNA and gene sequences diverge at a typical RNA splice site (TCCCCAG) (17). The exon specifying the 5' untranslated region and the first residues of the leader is not present within 1097 bp 5' of this splice site. The high degree of sequence conservation evident within the regions encoding the mature protein appears to diminish within the region encoding the hydrophobic leader and the 3' untranslated region, compatible with selective pressure being exerted on the mature protein. Expression of Human LIF in Yeast. We have previously produced biologically active recombinant murine LIF in yeast (7, 14) by using an expression vector, YEpsecl (12), that provides an N-terminal leader sequence from the killer toxin of Kluveromyces lactis transcribed from a galactoseinducible promoter. To express human LIF from the YEpsecl vector, it was necessary to modify the cloned gene in several ways. At the presumed start of the sequence encoding the mature protein, it was necessary to introduce a restriction site (BamHI), to allow insertion in-frame with the K. lactis leader and to retain an appropriate signal peptidase

Cell Biology:

Proc. Natl. Acad. Sci. USA 85 (1988)

Gough et al.

2625

+1 GlyValValProLeuLeuLeu---ValLeufisTrpLysHisGlyAlaGlySerProLeuProIleThrProValAsnAlaThrCysAlaIleA H TCCCCAGGAGTTGTGCCCCTGCTGTTG--- GTTCTGCACTGGAAACATGGGGCGGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATAC **

******** * *** **

97

***************** ***** ******** ** ************** ** ****************

M

gggattgtgcccttactgctgctggttctgcactggaaacacggggcagggagccctcttcccatcacccctgtaaatgccacetgtgccatac

H

GCCACCCATGTCACAMCAACCTCATGAACCAGATCAGGAGCCAACTGGCACAGCTCAMTGGCAGTGCCMATGCCCTCTTTATTCTCTATGTAMGTTACCC 197

rgHisProCysHisAsnAsnLeuMetAsnGlnIleArgSerGlnLeuAlaGlnLeuAsnGlySerAlaAsnAlaLeuPheIleLeuTyr

********** ***

******************** **

*********************** ******** ***** ***

****

H gccacccatgccacggcaacctcatgaaccagatcaagaatcaactggcacagctcaatggcagcgc~aatgctctct teat ttcctat

297 397 497 597 697 797

H H H H H H

CTGGGATACTGACAGGAGATGGCAGGGAGGGGGCTTGTAMAATATCATTAGGGGCTGTCCTGATCTGGGTTGAGGGGACCrTTTTGGGGCTGGAAGGAGAGA ATGGGGAGAGGGCTTGATTAAACCACCCCCAGACTCCTGCCACTTCCTGCCCAAGCTTCCCCAGGGAAGCTTCCCCAGGGTGCCCAGTTAGCAAGGGGAG AACTGAGTGCAAAGGTGGGGACCTGGCACTTCTTATCTTGTGATTGTCCTGCTGCAGGGAGCGAGGGATGGAGGGGAAATGGGCGTGAGGCACCAGGGAG ATGCGGTTGAGAGGCAGTGGGTCTGTGGGTGCTGGGCATGGAGGGGACGTCCCGGAACATTGTGAGTGCAGGGATGGAAGTACTTGATGTGGGTGCCCCAGC TAGGGCTAGACACCGAGTTTTCCCTTCTGTCCCCTTAGGGTGGTGATGATGATGATGATGATAATGATGACTGCGTGCATGGCTCAGTCTTTGATCTTTA GCAAGGGCACTCACATTACAATTAGTTTTGGCTCTCATGACAATTCCAGATGCTTACAGGGCAAGGAGTTGGGTCCTCATGCGCTAGATGGGGAAACAGA

H

TyrThrAlaGlnGlyGlu CGCAAGAGCTTGCCCAAAGGGTTGGCGGCAGGGCTGGGACACTGACCCGGTGACTCCCACGTCACCTCCCTTCTGCCCCTCAGTACACAGCCCAGGGGoGAG 897 ******** ** ** ***

tacacagctcaaggagag

M

ProPheProAsnAsnLeuAspLysLeuCysGlyProAsnValThrAspPheProProPheHisAlaAsnGlyThrGluLysAlaLysLeuValGluLeuT

H

CCGTTCCCCAMCAACCTGGACAAGCTATGTGGCCCCAMCGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAMGGCCAAGCTGGTGGAGCTGT 997 ***** ********* **** **********

H

** *** **** ********

* ***** * ****** ** ****** ***** ************

ccgt ttcccaacaacgtggaaaagctatgtgcgcctaacatgacagacttcccatct ttccatggcaacgggacagagaagaccaagt tggtggagctgt

yrArgIleValValTyrLeuGlyThrSerLeuGlyAsnIleThrArgAspGlnLysIleLeuAsnProSerAlaLeuSerLeu~isSerLysLeuAsnAl

H ACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGCCCTCAGCCTCCACAGCAAGCTCAACGC 1097 * ** ** ****

*****

** ********

*** ****************** **** ******* **** * ********

********* **

Matcggatggtcgcatacctgagcgcctccctgaccaatatcacccgggaccagaaggtcctgaaccccactgccgtgagcctccaggtcaagctcaatgc

aThrAlaAspIleLeuArgGlyLeuLeuSerAsnValLeuCysArgLeuCysSerLysTyr~isValGly~isValAspValThrTyrGlyProAspThr

H CACCGCCGACATCCTGCGAGGCCTCCTTAGCAMCGTGCTGTGCCGCCTGTGCAGCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACC 1197 *** ** ** * ******** ***** ***** ***** ******* ********

**

H

******** ***** *** *

* *** ***

*

tcaaagctaggcctaeaggttegeggacatcggggcctgtteaegccgca

SerGlyLysAspValPheGlnLysLysLysLeuGlyCysGlnLeuLeuGlyLysTyrLysGlnIleIleAlaValLeuAlaGlnAlaPheTER H TCGGGTAAGGATGTCTTCCAGAAGAAGAMGCTGGGCTGTCAACTCCTGGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTAGCAGGAGG 1297 *

H

*

** ** * ****** * *** *** **** ** ** ** *******

** *****

****

*** *** ************* ** ***

tctgacaaagaagcct tccaaaggaaaaagttgggt tgccagct tctggggacatacaagcaagtcataagtgtggtggtccaggcct tctag-ag-agg

FIG. 3. Nucleotide sequence of the human LIF gene. The sequence of the mRNA-synonymous strand of the human LIF gene (H) is presented in a 5'-to-3' orientation. The corresponding nucleotide sequence of the murine LIF mRNA (M) derived from cDNA clones pLIF7.2b (7), pLIFNKl (14), and pLIFNK3 (N.M.G., D.P.G., and J.A.K., unpublished data) is aligned beneath the human gene and given in lowercase letters. Identities between the mouse and human sequences are indicated with asterisks. The amino acid sequence encoded by the human gene is shown above the nucleotide sequence. The presumed N-terminal residue of mature human LIF, by analogy with the mouse (R. J. Simpson, D.J.H., and N.A.N., unpublished data), is designated as + 1. Sequencing was performed on alkaline-denatured supercoiled DNA (15, 16), using both the Klenow fragment of Escherichia coli DNA polymerase I and avian myeloblastosis virus reverse transcriptase. The sequence of both strands was determined processively, using a variety of oligonucleotides.

cleavage site: exactly the same modification previously made to the mouse cDNA (7). Second, it was necessary to remove the 693-bp intervening sequence that is present within the coding region, fusing the two exons in-frame. Finally, it was necessary to introduce a suitable restriction site (HindIII) immediately after the stop codon, to allow insertion into YEpsecl. These modifications were achieved by oligonucleotide-mediated mutagenesis, and their authenticity was confirmed by nucleotide sequence analysis. After introducing the YEpsecl/HLIF recombinant into yeast, transformed yeast clones were grown in medium containing galactose to induce the GAL-CYC promoter and the growth media were assayed for LIF activity. Given the high degree of sequence conservation between murine and human LIF (see Fig. 4) the activity of yeast-derived human LIF on mouse Ml cells was tested. The representative experiment in Fig. 5 shows that medium conditioned by galactoseinduced yeast cells containing the YEpsecl/HLIF recombinant was able to induce differentiation in cultures of murine Ml cells, in a manner similar to that induced by either pure native or recombinant murine LIF. The estimate of LIF concentration in the medium assayed in this experiment was 50,000 units/ml (the specific activity of purified murine LIF is -108 units/mg; D.J.H., N.A.N., and D.M., unpublished

data). As with murine LIF, increasing concentrations of the yeast-derived human LIF also progressively reduced the number and size of Ml colonies that developed. Yeast cells containing the YEpsecl/HLIF recombinant did not produce detectable LIF in the absence of galactose induction (Fig. 5). Medium conditioned by galactose-induced yeast cells containing the YEpsecl/HLIF recombinant was able to compete for the binding of '25W-labeled native murine LIF-A to specific cellular receptors on murine Ml cells to the same extent as native and recombinant murine LIF-A, at 37°C (Fig. 6) and at 0°C (data not shown). Medium from uninduced yeast cells and from yeast cells containing the vector YEpsecl alone did not. Thus, there appears to be a strong conservation of the receptor binding domain in murine and human LIFs, compatible with the high degree of amino acid sequence similarity (Fig. 4).

DISCUSSION There is considerable interest in the potential therapeutic use of naturally occurring factors to enforce the differentiation of leukemic cells, thereby suppressing their proliferation (1). Several protein factors have been described that can induce the differentiation of various myeloid leukemic cell lines in vitro. G-CSF (and to a lesser extent GM-CSF) can induce the

2626

Cell Biology:

Gough et al.

Proc. Natl. Acad. Sci. USA 85 (1988)

-:---------------------------------------------------Gly---

H: ProLeuProIleThrProValAsnAlaThrCysAlaIleArgHisProCysHisAsnAsn

M: ---------------LysAsn--------------------------------------H: LeuMetAsnGlnhleArgSerGlnLeuAlaGlnLeuAsnGlySerAlaAsnAlaLeuPhe

M: ---Ser------------------------------------ValGlu---------Ala H: IleLeuTyrTyrThrAlaGlnGlyGluProPheProAsnAsnLeuAspLysLeuCysGly M: ------Met------------Ser------Gly---------------Thr--------H: ProAsnValThrAspPheProProPheHisAlaAsnGlyThrGluLysAlaLysLeuVal M: ------------Met---Ala------SerAla------Thr-----------------H: GluLeuTyrArgIleValValTyrLeuGlyThrSerLeuGlyAsnIleThrArgAspGln

M: ---Val---------Thr---Val------GlnVal---------------Ile---Val H: LysIleLeuAsnProSerAlaLeuSerLeuHisSerLysLeuAsnAlaThrAlaAspIle

M: Met------------------------------------Asn------Arg--------H: LeuArgGlyLeuLeuSerAsnValLeuCysArgLeuCysSerLysTyrHisvalGlyHis M: ---------ProProVal------His---Asp---GluAla------Arg--------H: ValAspValThrTyrGlyProAspThrSerGlyLysAspValPheGlnLysLysLysLeu

M: ------------------Thr---------Val---Ser---ValVal--------H: GlyCysGlnLeuLeuGlyLysTyrLysGlnIleIleAlaValLeuAlaGlnAlaPhe

FIG. 4. Comparison of mouse and human LIF amino acid sequences. The mature murine LIF amino acid sequence (M) derived from cDNA clones pLIF7.2b (7) and pLIFNK1 (14) and from direct amino acid sequencing (R. J. Simpson, D.J.H., and N.A.N., unpublished data) is compared with the analogous sequence deduced from the human gene (H).

differentiation of certain myeloid leukemic cells (murine WEHI-3B D+ and Ml and human HL-60) (2, 4, 5), but since they are proliferative stimuli not only for normal progenitor cells, but also for primary human myeloid leukemic cells (19), their use carries the potential hazard of expanding the leukemic population. TNF-a can suppress certain human leukemic cell lines (ML1, HL-60) in vitro (3), but a wide range of systemic and organ-specific toxicities have been seen in most patients receiving recombinant TNF (20). Interferon 'y induces monocytic differentiation in the human promyelocytic leukemia cell line HL-60 and the human myeloid leukemia cell line ML1 (21, 22), an action potentiated by lymphotoxin or TNF (23). However, the monocytic differentiation induced in HL-60 cells by interferon 'y is not accompanied by inhibition of cell proliferation (22). We have recently purified (D.J.H., N.A.N., and D.M., unpublished work) and cloned (7) a murine molecule (LIF) that both induces monocytic differentiation and inhibits the

proliferation of the murine myeloid leukemic cell line Ml. This factor is possibly the same as D factor (9) and MGI-2 (8). It bears no sequence similarity to G-CSF, GM-CSF, interferon y, TNF-a, or TNF-f3 and, in contrast to these differentiation inducing factors, LIF neither stimulates nor inhibits the proliferation of normal bone marrow-derived hemopoietic progenitor cells. These findings and the observation that receptors for LIF appear to be restricted mainly to cells of the mature monocyte/macrophage lineage (D.J.H., N.A.N., and D.M., unpublished data) suggest that in vivo administration of LIF may result in minimal effects on hemopoiesis. Thus, having characterized, cloned, and expressed murine LIF (7), we wished to search for a human counterpart. Southern blotting experiments (Figs. 1 and 2) suggested not only that there is a human counterpart to murine LIF but E

0a 600-

100 0

8 80

.0

'a0

400 c.)0 =

c

60

"-

40

L.

O

20

c.J

=

0

0. CO

0) a)

U) a-

-

0

0~~~~~~~~~~~

0 U,

In

00'

Reciprocal dilution FIG. 5. Induction of differentiation in colonies of Ml leukemic cells by dilutions of purified native murine LIF (o----o) and conditioned medium from yeast cells containing the YEpsecl/HLIF construct induced with galactose (.-). Medium from uninduced yeast cultures containing the YEpsecl/HLIF recombinant (o--o) was inactive. Mean data from replicate 7-day cultures are presented. Assays were performed using Ml cells (kindly provided by M. Hozumi, Saitama Cancer Research Center, Saitama, Japan) as described (7).

65,536

4096

256 Reciprocal dilution

16

1

FIG. 6. Competition of yeast-derived human LIF with 25Ilabeled murine LIF for binding to specific receptors on Ml cells. Dilutions of authentic native murine LIF-A (o), recombinant murine LIF (l), and conditioned medium from yeast cells containing the YEpsecl/HLIF construct uninduced (o) and induced (o) with galactose were tested for ability to compete for the binding of native I251-labeled LIF-A to cellular receptors on murine Ml cells at 37°C. LIF-A was iodinated and receptor binding competition was performed as described (7, 18).

Cell

Biology: Gough et al.

also that there is a high degree of similarity between the LIF molecules from these two species (Fig. 2). Indeed, the nucleotide sequence of the cloned human LIF gene revealed that LIF, along with macrophage-CSF (CSF-1), is the most highly conserved of the regulators known to act within the myeloid system. For the mature LIF protein, the murine and human sequences are identical at 140 of 179 positions (78%) with no insertions or deletions (Fig. 4). Similarly, for the region believed to represent the final mature molecule, CSF-1 displays 78% similarity between mouse and man, with no insertions or deletions (24, 25). This compares with multi-CSF, for which there is only 31% identity with 5 insertions or deletions (26, 27); GM-CSF, 56% identity and 1 insertion or deletion (28, 29); and G-CSF, 76% identity with 3 insertions or deletions (30). Given the high degree of similarity between the LIF molecules from these two species, it is not surprising that the human molecule competes with 125I-labeled murine LIF for receptor binding (Fig. 6) and that the human molecule is biologically active on mouse Ml cells (Fig. 5). Functional domains and small secondary-structure assemblies in proteins often correspond to regions encoded by individual exons, with exon boundaries frequently occurring in loop regions of the protein (31, 32). In this context it is interesting that the highest conservation between murine and human LIF is evident in the first 60 residues (Fig. 4), implicating this region as a key structural element for receptor binding, and that this corresponds almost exactly to an exon (Fig. 3). It should be pointed out, however, that residues within the C-terminal 9 amino acids are also apparently required for biological activity, at least of the murine molecule (7). The relationships to human LIF of several partially characterized human myeloid leukemia-differentiation inducers, produced by a human T-lymphocyte cell (Hut-102) (33), activated human T lymphocytes (34), human lung cancer tissue (35), and a human hepatoma cell line (SK-hep-1; ref. 36), remain unknown. In some cases preparations of these differentiation inducers have been shown to be free of G-CSF, GM-CSF, interferon y, and TNF activities, but their possible identity to human LIF, defined here by gene cloning, can only be proven by direct amino acid sequencing of

purified proteins. The availability of recombinant human LIF should facilitate studies on the biological effects of this molecule on human myeloid leukemic cells, as an initial step in establishing its possible therapeutic value in the management of myeloid leukemia and related myeloproliferative disorders. We are grateful to Dr. M. Hozumi (Saitama Cancer Research Center, Saitama, Japan) for the Ml cell line. We thank Luba Oddo, Yvonne Pattison, and Melinda Lahn for technical assistance. This work was supported by AMRAD Corporation Ltd. (Melbourne), the Anti-Cancer Council of Victoria, the National Health and Medical Research Council (Canberra), and the J. D. and L. Harris Trust. 1. Hozumi, M. (1983) Adv. Cancer Res. 38, 121-169. 2. Begley, C. G., Metcalf, D. & Nicola, N. A. (1987) Int. J. Cancer

39, 99-105. 3. Takeda, K., Iwamoto, S., Sugimoto, H., Takuma, T., Kawatani, N., Noda, M., Masaki, A., Morise, H., Arimura, H. & Konno, K. (1986) Nature (London) 323, 338-340. 4. Metcalf, D. & Nicola, N. A. (1982) Int. J. Cancer 30, 773-780. 5. Metcalf, D. (1979) Int. J. Cancer 24, 616-623. 6. Tomida, M., Yamamoto-Yamaguchi, Y., Hozumi, J., Okabe, T. & Takaka, F. (1986) FEBS Lett. 207, 271-275.

Proc. Natl. Acad. Sci. USA 85

(1988)

2627

7. Gearing, D. P., Gough, N. M., King, J. A., Hilton, D. J., Nicola, N. A., Simpson, R. J., Nice, E. C., Kelso, A. & Metcalf, D. (1987) EMBO J. 6, 3995-4002. 8. Lipton, J. H. & Sachs, L. (1981) Biochim. Biophys. Acta 673, 552-569. 9. Tomida, M., Yamamoto-Yamaguchi, Y. & Hozumi, M. (1984) J. Biol. Chem. 259, 10978-10982. 10. Dente, L., Cesareni, G. & Cortese, R. (1983) Nucleic Acids Res. 11, 1645-1655. 11. Nisbet, I. T. & Beilharz, M. W. (1985) Gene Anal. Technol. 2, 23-29. 12. Baldari, C., Murray, J. A. H., Ghiara, P., Cesareni, G. & Galeotti, C. L. (1987) EMBO J. 6, 229-234. 13. Klebe, R. J., Harriss, J. V., Sharp, Z. D. & Douglas, M. G. (1983) Gene 25, 333-341. 14. Gough, N. M., Hilton, D. J., Gearing, D. P., Willson, T. A., King, J. A., Nicola, N. A. & Metcalf, D. (1988) Blood Cells, in press. 15. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 16. Chen, E. Y. & Seeburg, P. H. (1985) DNA 4, 165-170. 17. Mount, S. M. (1982) Nucleic Acids Res. 10, 459-472. 18. Nicola, N. A. & Metcalf, D. (1984) Proc. Natl. Acad. Sci. USA 81, 3765-3769. 19. Begley, C. G., Metcalf, D. & Nicola, N. A. (1986) Leukemia 1, 1-8. 20. Bock, G. & Marsh, J., eds. (1987) Tumor Necrosis Factor and Related Cytokines: CIBA Foundation Symposium Vol. 131

(Wiley, London). 21. Takei, M., Takeda, K. & Konno, K. (1984) Biochem. Biophys. Res. Commun. 124, 100-105. 22. Ball, E. D., Guyre, P. M., Shen, L., Glynn, J. M., Maliszewski, C. R., Baker, P. E. & Fanger, M. W. (1984) J. Clin. Invest. 73, 1072-1077. 23. Trinchieri, G., Kobayashi, M., Rosen, M., Loudon, R., Murphy, M. & Perussia, B. (1986) J. Exp. Med. 164, 1206-1225. 24. DeLamarter, J. F., Hession, C., Semon, D., Gough, N. M., Rothenbuhler, R. & Mermod, J.-J. (1987) Nucleic Acids Res. 15, 2389-2390. 25. Wong, G. G., Temple, P. A., Leary, A. C., Witek-Giannotti, J. S., Yang, Y.-C., Ciarletta, A. B., Chung, M., Murtha, P., Kriz, R., Kaufman, R. J., Ferenz, C. R., Sibley, B. S., Turner, K. J., Hewick, R. M., Clark, S. C., Yanai, N., Yokota, H., Yamada, M., Saito, M., Motoyoshi, K. & Takaku, F. (1987) Science 235, 1504-1508. 26. Yang, Y.-C., Ciarletta, A. B., Temple, P. A., Chung, M. P., Kovacic, S., Witek-Giannotti, J. S., Leary, A. C., Kriz, R., Donahue, R. E., Wong, G. G. & Clark, S. C. (1986) Cell 47, 3-10. 27. Dorssers, L., Burger, H., Bot, F., Delwel, R., Geurtz van Kessel, A. H. M., Lowenberg, B. & Wagemaker, G. (1987) Gene 55, 115-124. 28. Wong, G. G., Witek, J. S., Temple, P. A., Wilkens, K. M., Leary, A. C., Luxenberg, D. P., Jones, S. S., Brown, E. L., Kay, R. M., Orr, E. C., Shoemaker, C., Golde, D. W., Kaufman, R. J., Hewick, R. M., Wang, E. A. & Clark, S. C. (1985) Science 228, 810-815. 29. Gough, N. M., Metcalf, D., Gough, J., Grail, D. & Dunn, A. R. (1985) EMBO J. 4, 645-653. 30. Tsuchiya, M., Asano, S., Kaziro, Y. & Nagata, S. (1986) Proc. Natl. Acad. Sci. USA 83, 7633-7637. 31. Blake, C. (1983) Nature (London) 306, 535-537. 32. Gilbert, W. (1985) Science 228, 823-824. 33. Olsson, 1. L., Sarngadharan, M. G., Breitman, T. R. & Gallo, R. C. (1984) Blood 63, 510-517. 34. Leung, K. & Chiao, J. W. (1985) Proc. Natl. Acad. Sci. USA 82, 1209-1213. 35. Hatake, K., Motoyoshi, K., Hanamura, T., Mukaida, N., Kasahara, T., Miura, Y. & Saito, M. (1987) Exp. Hematol. 15, 915-921. 36. Gabrilove, J. & Moore, M. A. S. (1983) Fed. Proc. Fed. Am. Soc. Exp. Biol. 42, 773 (abstr.).